ID: 927448338

View in Genome Browser
Species Human (GRCh38)
Location 2:23185342-23185364
Sequence AATCAGTATTACCTAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927448330_927448338 1 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data
927448332_927448338 -5 Left 927448332 2:23185324-23185346 CCTGTGCCAGACAAGCTAAATCA No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data
927448331_927448338 -4 Left 927448331 2:23185323-23185345 CCCTGTGCCAGACAAGCTAAATC No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data
927448329_927448338 2 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927448338 Original CRISPR AATCAGTATTACCTAGGGAG GGG Intergenic