ID: 927455818

View in Genome Browser
Species Human (GRCh38)
Location 2:23248394-23248416
Sequence CTTAATGCCCAGAGGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927455818_927455821 -5 Left 927455818 2:23248394-23248416 CCTGGCCACCTCTGGGCATTAAG No data
Right 927455821 2:23248412-23248434 TTAAGACGTCACTGAGTTTCAGG No data
927455818_927455822 -4 Left 927455818 2:23248394-23248416 CCTGGCCACCTCTGGGCATTAAG No data
Right 927455822 2:23248413-23248435 TAAGACGTCACTGAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927455818 Original CRISPR CTTAATGCCCAGAGGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr