ID: 927457770

View in Genome Browser
Species Human (GRCh38)
Location 2:23271870-23271892
Sequence GTGGTGAAGTCCTGCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927457763_927457770 0 Left 927457763 2:23271847-23271869 CCCCTGTTACTCCATCCTGCTCA No data
Right 927457770 2:23271870-23271892 GTGGTGAAGTCCTGCTTTATGGG No data
927457764_927457770 -1 Left 927457764 2:23271848-23271870 CCCTGTTACTCCATCCTGCTCAG No data
Right 927457770 2:23271870-23271892 GTGGTGAAGTCCTGCTTTATGGG No data
927457765_927457770 -2 Left 927457765 2:23271849-23271871 CCTGTTACTCCATCCTGCTCAGT No data
Right 927457770 2:23271870-23271892 GTGGTGAAGTCCTGCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927457770 Original CRISPR GTGGTGAAGTCCTGCTTTAT GGG Intergenic
No off target data available for this crispr