ID: 927460916

View in Genome Browser
Species Human (GRCh38)
Location 2:23297606-23297628
Sequence CCTTATAAGCAGAGGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927460916_927460924 23 Left 927460916 2:23297606-23297628 CCTAATCCCCTCTGCTTATAAGG No data
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041
927460916_927460921 -7 Left 927460916 2:23297606-23297628 CCTAATCCCCTCTGCTTATAAGG No data
Right 927460921 2:23297622-23297644 TATAAGGACACCAGTCATATTGG 0: 199
1: 801
2: 1703
3: 2220
4: 2101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927460916 Original CRISPR CCTTATAAGCAGAGGGGATT AGG (reversed) Intergenic
No off target data available for this crispr