ID: 927460921 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:23297622-23297644 |
| Sequence | TATAAGGACACCAGTCATAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7024 | |||
| Summary | {0: 199, 1: 801, 2: 1703, 3: 2220, 4: 2101} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927460916_927460921 | -7 | Left | 927460916 | 2:23297606-23297628 | CCTAATCCCCTCTGCTTATAAGG | No data | ||
| Right | 927460921 | 2:23297622-23297644 | TATAAGGACACCAGTCATATTGG | 0: 199 1: 801 2: 1703 3: 2220 4: 2101 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927460921 | Original CRISPR | TATAAGGACACCAGTCATAT TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||