ID: 927460921

View in Genome Browser
Species Human (GRCh38)
Location 2:23297622-23297644
Sequence TATAAGGACACCAGTCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7024
Summary {0: 199, 1: 801, 2: 1703, 3: 2220, 4: 2101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927460916_927460921 -7 Left 927460916 2:23297606-23297628 CCTAATCCCCTCTGCTTATAAGG No data
Right 927460921 2:23297622-23297644 TATAAGGACACCAGTCATATTGG 0: 199
1: 801
2: 1703
3: 2220
4: 2101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927460921 Original CRISPR TATAAGGACACCAGTCATAT TGG Intergenic
Too many off-targets to display for this crispr