ID: 927460924

View in Genome Browser
Species Human (GRCh38)
Location 2:23297652-23297674
Sequence TACCTTAATCACCTCTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2126
Summary {0: 10, 1: 103, 2: 342, 3: 630, 4: 1041}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927460916_927460924 23 Left 927460916 2:23297606-23297628 CCTAATCCCCTCTGCTTATAAGG No data
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041
927460922_927460924 -3 Left 927460922 2:23297632-23297654 CCAGTCATATTGGCCTCATTTAC No data
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041
927460918_927460924 17 Left 927460918 2:23297612-23297634 CCCCTCTGCTTATAAGGACACCA No data
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041
927460920_927460924 15 Left 927460920 2:23297614-23297636 CCTCTGCTTATAAGGACACCAGT 0: 6
1: 261
2: 926
3: 1897
4: 2420
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041
927460919_927460924 16 Left 927460919 2:23297613-23297635 CCCTCTGCTTATAAGGACACCAG 0: 3
1: 48
2: 176
3: 359
4: 608
Right 927460924 2:23297652-23297674 TACCTTAATCACCTCTTTAAAGG 0: 10
1: 103
2: 342
3: 630
4: 1041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927460924 Original CRISPR TACCTTAATCACCTCTTTAA AGG Intergenic
Too many off-targets to display for this crispr