ID: 927462313

View in Genome Browser
Species Human (GRCh38)
Location 2:23309858-23309880
Sequence GCTGCATGTCCTCTCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927462311_927462313 -9 Left 927462311 2:23309844-23309866 CCTCCAGCTCAGCTGCTGCATGT No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462310_927462313 -4 Left 927462310 2:23309839-23309861 CCACACCTCCAGCTCAGCTGCTG No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462305_927462313 30 Left 927462305 2:23309805-23309827 CCTCATCTCATTCCACCAAGCAA No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462309_927462313 3 Left 927462309 2:23309832-23309854 CCTGCTGCCACACCTCCAGCTCA No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462306_927462313 18 Left 927462306 2:23309817-23309839 CCACCAAGCAAAGTCCCTGCTGC No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462308_927462313 4 Left 927462308 2:23309831-23309853 CCCTGCTGCCACACCTCCAGCTC No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data
927462307_927462313 15 Left 927462307 2:23309820-23309842 CCAAGCAAAGTCCCTGCTGCCAC No data
Right 927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927462313 Original CRISPR GCTGCATGTCCTCTCCATCC AGG Intergenic
No off target data available for this crispr