ID: 927462856

View in Genome Browser
Species Human (GRCh38)
Location 2:23313913-23313935
Sequence CTACTTCATCACACCAATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927462848_927462856 25 Left 927462848 2:23313865-23313887 CCTCTACCTTTCTCCCAGAAACT No data
Right 927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG No data
927462847_927462856 26 Left 927462847 2:23313864-23313886 CCCTCTACCTTTCTCCCAGAAAC No data
Right 927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG No data
927462851_927462856 11 Left 927462851 2:23313879-23313901 CCAGAAACTCAGCACAAAACTTT No data
Right 927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG No data
927462849_927462856 19 Left 927462849 2:23313871-23313893 CCTTTCTCCCAGAAACTCAGCAC No data
Right 927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG No data
927462850_927462856 12 Left 927462850 2:23313878-23313900 CCCAGAAACTCAGCACAAAACTT No data
Right 927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927462856 Original CRISPR CTACTTCATCACACCAATAT CGG Intergenic
No off target data available for this crispr