ID: 927462917

View in Genome Browser
Species Human (GRCh38)
Location 2:23314440-23314462
Sequence CTAAGGTTATCCAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927462917_927462920 11 Left 927462917 2:23314440-23314462 CCATCTTGCCTGGATAACCTTAG No data
Right 927462920 2:23314474-23314496 GATTCCTTCTCAGCTGACTTTGG No data
927462917_927462922 22 Left 927462917 2:23314440-23314462 CCATCTTGCCTGGATAACCTTAG No data
Right 927462922 2:23314485-23314507 AGCTGACTTTGGACATTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927462917 Original CRISPR CTAAGGTTATCCAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr