ID: 927464746

View in Genome Browser
Species Human (GRCh38)
Location 2:23328747-23328769
Sequence CAGTGAAACCAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927464746_927464755 9 Left 927464746 2:23328747-23328769 CCTGCCTCCCTCTGGTTTCACTG No data
Right 927464755 2:23328779-23328801 TGTGGCTGCTATGTGTCGATGGG No data
927464746_927464752 -9 Left 927464746 2:23328747-23328769 CCTGCCTCCCTCTGGTTTCACTG No data
Right 927464752 2:23328761-23328783 GTTTCACTGGCCAGTGGTTGTGG No data
927464746_927464757 16 Left 927464746 2:23328747-23328769 CCTGCCTCCCTCTGGTTTCACTG No data
Right 927464757 2:23328786-23328808 GCTATGTGTCGATGGGTAGGTGG No data
927464746_927464756 13 Left 927464746 2:23328747-23328769 CCTGCCTCCCTCTGGTTTCACTG No data
Right 927464756 2:23328783-23328805 GCTGCTATGTGTCGATGGGTAGG No data
927464746_927464754 8 Left 927464746 2:23328747-23328769 CCTGCCTCCCTCTGGTTTCACTG No data
Right 927464754 2:23328778-23328800 TTGTGGCTGCTATGTGTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927464746 Original CRISPR CAGTGAAACCAGAGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr