ID: 927465931

View in Genome Browser
Species Human (GRCh38)
Location 2:23336405-23336427
Sequence GGGCCATGACCATAGATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927465931_927465932 -5 Left 927465931 2:23336405-23336427 CCTCAGATCTATGGTCATGGCCC No data
Right 927465932 2:23336423-23336445 GGCCCCTAAGCAAATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927465931 Original CRISPR GGGCCATGACCATAGATCTG AGG (reversed) Intergenic
No off target data available for this crispr