ID: 927467355

View in Genome Browser
Species Human (GRCh38)
Location 2:23347507-23347529
Sequence GCCTGTTCCCGGCCATTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927467355_927467360 -2 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467360 2:23347528-23347550 GCAATGCATCACAGGTGTGCAGG No data
927467355_927467367 28 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467367 2:23347558-23347580 CTCAGGGAAGGAGAAGACAGAGG No data
927467355_927467362 12 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467362 2:23347542-23347564 GTGTGCAGGCCACACCCTCAGGG No data
927467355_927467363 16 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467363 2:23347546-23347568 GCAGGCCACACCCTCAGGGAAGG No data
927467355_927467361 11 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467361 2:23347541-23347563 GGTGTGCAGGCCACACCCTCAGG No data
927467355_927467359 -10 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467359 2:23347520-23347542 GGGAACAGGCAATGCATCACAGG No data
927467355_927467368 29 Left 927467355 2:23347507-23347529 CCCGCCAATGGCCGGGAACAGGC No data
Right 927467368 2:23347559-23347581 TCAGGGAAGGAGAAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927467355 Original CRISPR GCCTGTTCCCGGCCATTGGC GGG (reversed) Intergenic
No off target data available for this crispr