ID: 927467967

View in Genome Browser
Species Human (GRCh38)
Location 2:23351156-23351178
Sequence GTGGAGCTGATGGGCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927467967_927467973 -4 Left 927467967 2:23351156-23351178 CCCACGGGGCCCATCAGCTCCAC 0: 1
1: 0
2: 1
3: 9
4: 180
Right 927467973 2:23351175-23351197 CCACTGGCCCATGTGTTTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927467967 Original CRISPR GTGGAGCTGATGGGCCCCGT GGG (reversed) Intergenic
900177330 1:1296646-1296668 GTGGAGCTGCTCGGTCCCGCAGG + Intronic
903526495 1:23994977-23994999 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
903923424 1:26817435-26817457 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
904585186 1:31576237-31576259 GTGGAGCTGAGGGGCTCTGGTGG - Intergenic
904794825 1:33051305-33051327 GAGGAGCGGACGGGCCCCGCGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906436929 1:45804031-45804053 GAGGAGCGGACGGGCCCCGCGGG + Exonic
906486655 1:46240466-46240488 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
907453917 1:54563077-54563099 GAGGAGCGGACGGGCCCCGCAGG - Intronic
912825479 1:112899327-112899349 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
912844665 1:113068778-113068800 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
915380153 1:155433230-155433252 GTGGAGGTGATGGGCCAGGGGGG + Intronic
918199647 1:182255294-182255316 AGGGAGCTGATGGGCCACGATGG - Intergenic
918235411 1:182575413-182575435 ATGGAGCTGGTGGGGCCAGTGGG - Exonic
918660507 1:187081988-187082010 GTGAAGATGATGGACCCCCTAGG + Intergenic
920263797 1:204707222-204707244 GTGGAGTTTATGGGCACAGTTGG + Intergenic
920932273 1:210400237-210400259 GTGGAGCTGATGGGACTCTGGGG + Intronic
921414441 1:214870433-214870455 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
922775945 1:228214239-228214261 GTGGAGCTGGCGGTCCCGGTGGG + Exonic
923153712 1:231257432-231257454 GTGGAGATGAAGGGGCCCGTTGG - Intronic
923508700 1:234630138-234630160 GTGGAGCTGTTGGGCCCATCTGG + Intergenic
924617326 1:245622923-245622945 GTGGAGCTGATGGAGGCCGCAGG + Intronic
924797008 1:247300007-247300029 GTGGGACTGATGGGCTCAGTGGG - Exonic
1065335697 10:24655539-24655561 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1067234680 10:44437616-44437638 GAGGAGCTGATGGGCCCTGGGGG + Intergenic
1069920886 10:71815033-71815055 GTGGAGCTCAAGGGGCCCGATGG + Exonic
1070318250 10:75334208-75334230 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1070783315 10:79149665-79149687 GTGGGGCTGCGTGGCCCCGTGGG + Intronic
1071397571 10:85238565-85238587 GAGGAGGTGAGGGGCCCTGTGGG + Intergenic
1072150168 10:92675996-92676018 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1072950121 10:99840136-99840158 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1073328631 10:102656941-102656963 GTGGAGCTGCAGGGCCCCAGGGG - Exonic
1074769683 10:116725178-116725200 GTGGAGCTCCTGGGCCCTGGAGG - Intronic
1075735519 10:124662353-124662375 GAGGAGCTGATGTGCCCAATGGG + Intronic
1076698389 10:132257792-132257814 GGGCAGCTGATGGGTCCCCTGGG - Intronic
1076728247 10:132423812-132423834 GTGGAGCCGCTGGGTCCTGTGGG + Intergenic
1076843519 10:133057998-133058020 GTGCAGGTGAGGGGCCCCGCAGG + Intergenic
1078348729 11:10574725-10574747 GAGTAGCTGATGGGCCACTTGGG + Exonic
1081784950 11:45739185-45739207 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1085512081 11:77093505-77093527 GGGGAGCAGATGGGCCCTATGGG + Intronic
1085916046 11:80889257-80889279 GCACAGCTGATGGGCCCTGTAGG + Intergenic
1091798311 12:3309624-3309646 CTGGAGCTGACGGGACCCCTGGG - Intergenic
1092396914 12:8134780-8134802 GTGGAGGTGATGGGCCAGGGGGG - Intronic
1093470732 12:19499208-19499230 GTGGAGCTGATTGGCAGCTTTGG + Intronic
1094839540 12:34337161-34337183 CCGGAGCTGCTGGGCCCCGCGGG + Intergenic
1094841538 12:34344509-34344531 TCGGAGCTGCTGGGCCCCGCGGG - Intergenic
1094841953 12:34345951-34345973 CCGGAGCTGCTGGGCCCCGCGGG - Intergenic
1094842873 12:34349314-34349336 CCGGAGCGGCTGGGCCCCGTGGG - Intergenic
1094852006 12:34386512-34386534 GTGGACCTGAGGCGCTCCGTGGG + Intergenic
1096022481 12:48333774-48333796 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1102578393 12:113871850-113871872 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1103731770 12:123032629-123032651 GTGGAGCTGAGGGGCTCCTGTGG + Intronic
1104066103 12:125307219-125307241 GTGGAGCTGATGGGTTTAGTGGG - Intronic
1104448764 12:128853348-128853370 GTGGCGCGGGTGTGCCCCGTGGG - Intergenic
1107677941 13:42816324-42816346 ATGGAGCTGATGGCCCTGGTGGG + Intergenic
1110269181 13:73574269-73574291 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1113185974 13:107686049-107686071 GTGGAGCAGCTGGGCCTCGAGGG + Intronic
1113924752 13:113935241-113935263 GAGGAGCTGAAGGGCGCCGGGGG - Intergenic
1115609552 14:35038535-35038557 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1122964019 14:105112706-105112728 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1123018070 14:105384930-105384952 GGGGAGCTGGTGGGCACAGTTGG - Exonic
1124405114 15:29385056-29385078 GGGGATCTGATGGGCCCCCTGGG - Intronic
1125079043 15:35655555-35655577 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1125506635 15:40271331-40271353 GTGGAGCTGAGGGGCAGCCTGGG - Intronic
1125659008 15:41381923-41381945 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1125764161 15:42121924-42121946 GTGGAGCTGAGGGGGCCCTCAGG + Intergenic
1128242852 15:66113268-66113290 ATGCAGCTGATGGGCCCGGCTGG - Intronic
1128656702 15:69467816-69467838 AAGGAGCTAATGGGCCCCGCCGG - Intergenic
1129428276 15:75480796-75480818 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1129672362 15:77614329-77614351 GTTGGGCTGATGGGGCCAGTCGG + Exonic
1133473186 16:6095414-6095436 GTGGAGCTGATTGGACCCTTGGG + Intronic
1135691148 16:24539220-24539242 GAGGAGCTGACGGGGCCTGTGGG + Intronic
1138349168 16:56337376-56337398 GTGGGGCTGATGGGCCAGGAAGG + Intronic
1141131544 16:81441023-81441045 GTGGAGCTGAGGGGCAGCCTAGG - Intergenic
1143652932 17:8275451-8275473 GTGCAACTGAAGGGCCCTGTTGG - Intergenic
1145205670 17:20984005-20984027 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1146887472 17:36482382-36482404 GTGGAGTGGGTGGGCCCAGTTGG - Intergenic
1147963187 17:44180007-44180029 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1148443769 17:47725664-47725686 GTGGAGCTGACGGGCCCAGGGGG - Intergenic
1148799520 17:50214549-50214571 ATGGAGCTGATGCGCCCCCGGGG - Intergenic
1148871705 17:50662285-50662307 GCTGAGCTGATGGGCTCGGTGGG + Intronic
1149908730 17:60550839-60550861 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1151327131 17:73386313-73386335 CGGGAGCTGAAGGGCCCAGTGGG + Intronic
1151683608 17:75634445-75634467 GTGCAGCAGAGGGGCCCCGAGGG + Intronic
1151711962 17:75812246-75812268 GCGGAGGTCATGGGGCCCGTGGG - Exonic
1151733576 17:75925141-75925163 GTGGAGGAGATGGCCCCAGTGGG - Intronic
1153006341 18:501055-501077 GGGGAGCTGCTGTGCCCCGGGGG + Intergenic
1153967630 18:10196114-10196136 GAGGAGCTGATGGGCCAGATCGG + Intergenic
1159387321 18:67742655-67742677 GTGGAGCTGATGCGCCGTGCTGG - Intergenic
1160781087 19:878255-878277 GGCGAGCTGCTGGGGCCCGTGGG - Intronic
1160781240 19:878745-878767 GGGGAGCTGCTGGGGCACGTGGG - Intronic
1160781259 19:878801-878823 GGGGAGCTGCTGGGGCACGTGGG - Intronic
1161033162 19:2069080-2069102 GTGGAGCAGATGGTCTCTGTTGG + Intergenic
1162886694 19:13702765-13702787 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1163906085 19:20150719-20150741 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1164653338 19:29901712-29901734 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1165007292 19:32817626-32817648 GTGGAGCTGCTGGGCCCTGTGGG + Intronic
1165060871 19:33204689-33204711 GTGGGGCTGCTGGGCCCAGCAGG - Exonic
1165458052 19:35926295-35926317 GAGGAGCTGAGGGGCCCAGTGGG - Intergenic
1166261440 19:41644235-41644257 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1166918559 19:46212913-46212935 GTGGAGCTGGCGGGACCCCTGGG - Intergenic
1166921002 19:46229195-46229217 GTGGAGCTGGCGGGACCCCTGGG - Intergenic
1167571548 19:50292163-50292185 CGGGAGCTGAGGAGCCCCGTCGG + Intronic
1168267550 19:55230830-55230852 GGGGGGCTGGTGGGCCCCGGAGG + Exonic
1168538151 19:57189239-57189261 ATGGAGCTGATGGGAGCCCTTGG + Intergenic
925778241 2:7355947-7355969 GTGGGGCAGGTGGGCCCCGCAGG + Intergenic
927467967 2:23351156-23351178 GTGGAGCTGATGGGCCCCGTGGG - Intergenic
929614374 2:43296864-43296886 GAGGAGCGGACGGGCCCCGCGGG + Intronic
935703612 2:105836780-105836802 GTGGAGATGCTGGGGCCCCTAGG + Intronic
936545987 2:113393806-113393828 GAGGAGCGGACGGGCCCCGCAGG + Intergenic
937919690 2:127120509-127120531 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1169195654 20:3680959-3680981 GGGGAGGTGATGGGACCCCTGGG - Intronic
1170425169 20:16228419-16228441 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1172350060 20:34231346-34231368 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1175479572 20:59301611-59301633 GTGGTGCTCAGGGGCCCCCTCGG - Exonic
1175730852 20:61353015-61353037 GGGGAGGAGATGGGGCCCGTGGG - Intronic
1177178637 21:17721123-17721145 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1178789108 21:35682276-35682298 GTGGAGCTGGTGGACCCCAGGGG - Intronic
1182269792 22:29146089-29146111 GTGGAGCTGCCCGGCTCCGTGGG - Intronic
1182776097 22:32832043-32832065 GTGCAGCTGATGGACCAGGTGGG + Intronic
1183425201 22:37735377-37735399 CTGGAGCAGACGGGCCCCCTGGG + Exonic
1183845107 22:40536429-40536451 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1185044621 22:48522846-48522868 CTGGAGCTGGAGGGCCCTGTAGG - Intronic
1185067455 22:48639286-48639308 GTGCAGCTGAGGGGCCCCGCAGG - Intronic
951013736 3:17705917-17705939 GAGGAGCGGACGGGCCCCGCGGG - Intronic
953476470 3:43209737-43209759 GGGGAGCTGATGTGCCCAGAAGG + Intergenic
954080522 3:48210853-48210875 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
954693798 3:52409956-52409978 GTGGGACTGAGGGGCCCCGGGGG - Exonic
954698494 3:52439931-52439953 GTGTAGCTGCTGGGCCAGGTGGG + Exonic
954801653 3:53190516-53190538 GTGGGTCTGAGAGGCCCCGTTGG + Intronic
955297222 3:57746947-57746969 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
956270211 3:67443376-67443398 GAGGAGCGGACGGGCCCCGCGGG + Intronic
957470425 3:80652254-80652276 CTGGAGCTGATAGGCCACTTAGG + Intergenic
959042497 3:101438858-101438880 GAGGAGCGGACGGGCCCCGCGGG + Intronic
959419591 3:106112644-106112666 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
961336042 3:126180333-126180355 GCGAAGTTGATGGGCCCCGCAGG + Intronic
962108488 3:132417625-132417647 GCGGAGCTGCAGGGCCCCGGCGG + Exonic
966359451 3:179119482-179119504 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
969388946 4:6876295-6876317 GTGGAGAGCATGGGCCCTGTGGG + Intronic
969596438 4:8151817-8151839 GTGGAACAGATGGGCCCTGGGGG + Intronic
981348222 4:143699849-143699871 GTGGAGCTGCTGGGGCCTGAGGG - Exonic
985281961 4:188296147-188296169 GTTGAGCTGATTGGCCCCCGGGG - Intergenic
992373716 5:76171065-76171087 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1000985243 5:167858835-167858857 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1002341416 5:178518813-178518835 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1004387944 6:15188452-15188474 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1005380675 6:25231469-25231491 GTGCAGCTGATGGAGCCCCTGGG - Intergenic
1005682224 6:28218475-28218497 GAGGAGATGGTGGACCCCGTTGG - Intergenic
1006029799 6:31170549-31170571 GTGGAGGTGATGGGCCAGGGGGG - Exonic
1006040232 6:31246452-31246474 GAGGAGCTGAAGGGCCCGGGTGG + Intergenic
1006048643 6:31321866-31321888 GAGGAGCTGAAGGGCCCAGGTGG + Intronic
1006492126 6:34396985-34397007 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1006899832 6:37492905-37492927 GTGGGGATAATGGGCCCCTTGGG - Intronic
1007674432 6:43581563-43581585 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1011405427 6:87010818-87010840 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1012509882 6:99991176-99991198 GTGGAGGTCCTGGGCCCCATAGG - Intronic
1015476535 6:133664295-133664317 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1017858440 6:158372695-158372717 CTGGAGCTCATGGCCCCCATTGG + Intronic
1019656312 7:2197960-2197982 GAGGGGCTGATGGGCCCTGTGGG - Intronic
1019970220 7:4534776-4534798 GTGGTGCTGTTGGGCCCCCTAGG - Intergenic
1020616632 7:10466438-10466460 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1021872144 7:25017960-25017982 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1023057325 7:36300671-36300693 CTGGAGCTGATGGGCCGTGAAGG + Exonic
1032463540 7:132129120-132129142 GTCGAGCTGATGGGCCTGGCTGG - Exonic
1034273942 7:149815950-149815972 GTGGAGCTCTTGGGGCCCTTGGG + Intergenic
1034274784 7:149819352-149819374 CTGGACCTCCTGGGCCCCGTGGG + Intergenic
1034557407 7:151858891-151858913 ATGGAGCTGACGGGCACCCTAGG + Intronic
1035508109 8:150600-150622 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1036536874 8:9658311-9658333 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1038239983 8:25799355-25799377 GTGGAAATGATGAGCCCTGTTGG + Intergenic
1039744582 8:40412878-40412900 GTGGAGCTGATGATCCCTGAGGG - Intergenic
1042048815 8:64685190-64685212 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1044660466 8:94590220-94590242 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1047687120 8:127315886-127315908 GAGGAGCGGAAGGGCCCCGCGGG + Intergenic
1047848271 8:128827137-128827159 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1049344059 8:142129088-142129110 GAGGAGCTGATGGACCCCTGAGG - Intergenic
1053256037 9:36616025-36616047 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1053457069 9:38241556-38241578 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1055468764 9:76591136-76591158 GTGGAGCTGATGGGGTCTTTGGG + Intergenic
1059210861 9:112513716-112513738 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1059726960 9:117018246-117018268 GTGAAGCTGGTGGGTCCTGTAGG - Intronic
1060064780 9:120495069-120495091 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1061610869 9:131744821-131744843 GAGGAGCTGATTGGCCCAGCTGG + Intergenic
1061662849 9:132141754-132141776 GTGGAGCTGACGGGCTCCTGGGG - Intergenic
1061984090 9:134119053-134119075 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1062446983 9:136599248-136599270 GTGGTGCTGAGGAGCTCCGTGGG - Intergenic
1191618311 X:63190326-63190348 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1192621081 X:72680850-72680872 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1195036320 X:100973384-100973406 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1196178720 X:112667814-112667836 GTGGAGCAAATGGGACCCATGGG + Intronic
1196404614 X:115348260-115348282 GAGGAGCGGACGGGCCCCGCGGG - Intergenic