ID: 927467967

View in Genome Browser
Species Human (GRCh38)
Location 2:23351156-23351178
Sequence GTGGAGCTGATGGGCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927467967_927467973 -4 Left 927467967 2:23351156-23351178 CCCACGGGGCCCATCAGCTCCAC 0: 1
1: 0
2: 1
3: 9
4: 180
Right 927467973 2:23351175-23351197 CCACTGGCCCATGTGTTTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927467967 Original CRISPR GTGGAGCTGATGGGCCCCGT GGG (reversed) Intergenic