ID: 927468242

View in Genome Browser
Species Human (GRCh38)
Location 2:23352527-23352549
Sequence AAGGGGAAAGAGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927468227_927468242 29 Left 927468227 2:23352475-23352497 CCAGAGTCCTGAAGAATGCTGAG No data
Right 927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG No data
927468228_927468242 22 Left 927468228 2:23352482-23352504 CCTGAAGAATGCTGAGAAACATT No data
Right 927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927468242 Original CRISPR AAGGGGAAAGAGAGGGAGGA TGG Intergenic
No off target data available for this crispr