ID: 927471248

View in Genome Browser
Species Human (GRCh38)
Location 2:23379347-23379369
Sequence CCTGGAGATGGAAGTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927471248_927471257 9 Left 927471248 2:23379347-23379369 CCCCCAACACTTCCATCTCCAGG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471248_927471256 1 Left 927471248 2:23379347-23379369 CCCCCAACACTTCCATCTCCAGG No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927471248 Original CRISPR CCTGGAGATGGAAGTGTTGG GGG (reversed) Intergenic
No off target data available for this crispr