ID: 927471250

View in Genome Browser
Species Human (GRCh38)
Location 2:23379348-23379370
Sequence CCCTGGAGATGGAAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927471250_927471257 8 Left 927471250 2:23379348-23379370 CCCCAACACTTCCATCTCCAGGG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471250_927471256 0 Left 927471250 2:23379348-23379370 CCCCAACACTTCCATCTCCAGGG No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927471250 Original CRISPR CCCTGGAGATGGAAGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr