ID: 927471256

View in Genome Browser
Species Human (GRCh38)
Location 2:23379371-23379393
Sequence AGAATAGAGAATGTGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927471248_927471256 1 Left 927471248 2:23379347-23379369 CCCCCAACACTTCCATCTCCAGG No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data
927471253_927471256 -2 Left 927471253 2:23379350-23379372 CCAACACTTCCATCTCCAGGGAG No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data
927471250_927471256 0 Left 927471250 2:23379348-23379370 CCCCAACACTTCCATCTCCAGGG No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data
927471252_927471256 -1 Left 927471252 2:23379349-23379371 CCCAACACTTCCATCTCCAGGGA No data
Right 927471256 2:23379371-23379393 AGAATAGAGAATGTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927471256 Original CRISPR AGAATAGAGAATGTGTGTCT TGG Intergenic
No off target data available for this crispr