ID: 927471257

View in Genome Browser
Species Human (GRCh38)
Location 2:23379379-23379401
Sequence GAATGTGTGTCTTGGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927471253_927471257 6 Left 927471253 2:23379350-23379372 CCAACACTTCCATCTCCAGGGAG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471255_927471257 -9 Left 927471255 2:23379365-23379387 CCAGGGAGAATAGAGAATGTGTG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471248_927471257 9 Left 927471248 2:23379347-23379369 CCCCCAACACTTCCATCTCCAGG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471252_927471257 7 Left 927471252 2:23379349-23379371 CCCAACACTTCCATCTCCAGGGA No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471250_927471257 8 Left 927471250 2:23379348-23379370 CCCCAACACTTCCATCTCCAGGG No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data
927471254_927471257 -3 Left 927471254 2:23379359-23379381 CCATCTCCAGGGAGAATAGAGAA No data
Right 927471257 2:23379379-23379401 GAATGTGTGTCTTGGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927471257 Original CRISPR GAATGTGTGTCTTGGAAGAC AGG Intergenic
No off target data available for this crispr