ID: 927472356

View in Genome Browser
Species Human (GRCh38)
Location 2:23385716-23385738
Sequence CCGGGGTCGCGGGTGGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 535}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927472356_927472365 -6 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472365 2:23385733-23385755 CCCCGGGCTCTCTGCGCGTCGGG 0: 1
1: 0
2: 0
3: 6
4: 94
927472356_927472377 30 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472377 2:23385769-23385791 CGCGCGCCGGAGGTAAGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 39
927472356_927472368 -2 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472368 2:23385737-23385759 GGGCTCTCTGCGCGTCGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 103
927472356_927472374 20 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472374 2:23385759-23385781 GGGCCGGAGCCGCGCGCCGGAGG 0: 1
1: 0
2: 2
3: 38
4: 349
927472356_927472370 0 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472370 2:23385739-23385761 GCTCTCTGCGCGTCGGGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
927472356_927472369 -1 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472369 2:23385738-23385760 GGCTCTCTGCGCGTCGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 103
927472356_927472371 4 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472371 2:23385743-23385765 TCTGCGCGTCGGGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 196
927472356_927472363 -7 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472363 2:23385732-23385754 ACCCCGGGCTCTCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 3
4: 55
927472356_927472373 17 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472373 2:23385756-23385778 CCGGGGCCGGAGCCGCGCGCCGG 0: 1
1: 0
2: 3
3: 71
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927472356 Original CRISPR CCGGGGTCGCGGGTGGGCGC AGG (reversed) Exonic