ID: 927472356

View in Genome Browser
Species Human (GRCh38)
Location 2:23385716-23385738
Sequence CCGGGGTCGCGGGTGGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 535}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927472356_927472377 30 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472377 2:23385769-23385791 CGCGCGCCGGAGGTAAGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 39
927472356_927472374 20 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472374 2:23385759-23385781 GGGCCGGAGCCGCGCGCCGGAGG 0: 1
1: 0
2: 2
3: 38
4: 349
927472356_927472365 -6 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472365 2:23385733-23385755 CCCCGGGCTCTCTGCGCGTCGGG 0: 1
1: 0
2: 0
3: 6
4: 94
927472356_927472373 17 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472373 2:23385756-23385778 CCGGGGCCGGAGCCGCGCGCCGG 0: 1
1: 0
2: 3
3: 71
4: 559
927472356_927472370 0 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472370 2:23385739-23385761 GCTCTCTGCGCGTCGGGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
927472356_927472368 -2 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472368 2:23385737-23385759 GGGCTCTCTGCGCGTCGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 103
927472356_927472369 -1 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472369 2:23385738-23385760 GGCTCTCTGCGCGTCGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 103
927472356_927472371 4 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472371 2:23385743-23385765 TCTGCGCGTCGGGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 196
927472356_927472363 -7 Left 927472356 2:23385716-23385738 CCTGCGCCCACCCGCGACCCCGG 0: 1
1: 0
2: 5
3: 41
4: 535
Right 927472363 2:23385732-23385754 ACCCCGGGCTCTCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927472356 Original CRISPR CCGGGGTCGCGGGTGGGCGC AGG (reversed) Exonic
900120119 1:1045285-1045307 CCGGGGTCGGGGCTGAGCTCAGG - Intronic
900126725 1:1072034-1072056 GCAGGGTCCCGGGCGGGCGCGGG + Exonic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
900654306 1:3747388-3747410 GCGGGGTCGCGGCTGGGCGAGGG + Intergenic
900694604 1:4002064-4002086 CCGGGGTCTGGGGTGGTGGCAGG - Intergenic
901088416 1:6625697-6625719 GCAGGGTCGCGGGAGGACGCTGG + Intronic
901551248 1:9997546-9997568 ACAGGGGGGCGGGTGGGCGCGGG - Intronic
902142084 1:14365342-14365364 CGGGGGGAGGGGGTGGGCGCCGG - Intergenic
902217815 1:14945537-14945559 CCGGGGTGGGGGGAGGGGGCAGG - Intronic
902456410 1:16536645-16536667 CCGGGGTGGAGGTTGGTCGCCGG - Intergenic
902495753 1:16871266-16871288 CCGGGGTGGAGGTTGGTCGCCGG + Intronic
902501444 1:16914146-16914168 CCGGGGGCGCGCGCGTGCGCGGG + Intronic
902525426 1:17054157-17054179 CCGGTTTCCCGGGTGGGCGGAGG + Exonic
903007314 1:20307280-20307302 CCTGGGCCTCAGGTGGGCGCGGG - Intronic
903164167 1:21509338-21509360 CCGGGGGCGGGGGAGGGGGCGGG + Intergenic
903455412 1:23483964-23483986 GAGGGGTCGGGGGTCGGCGCCGG - Intronic
903502541 1:23809379-23809401 CCGGGGGTGGTGGTGGGCGCCGG - Intronic
903674475 1:25055452-25055474 CAGGAGGGGCGGGTGGGCGCTGG - Intergenic
904244984 1:29181484-29181506 TCGGGGGCGCGGGTAGGCCCCGG - Intronic
904500112 1:30908509-30908531 CCGGGGCCGCGGCCGGGCCCGGG - Exonic
905028949 1:34868790-34868812 CCAGGGCCGGGGGTGGGGGCGGG + Exonic
905456526 1:38092010-38092032 CTGGGGTCGGGGGTGGGGGTGGG - Intergenic
905599194 1:39234825-39234847 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
905912135 1:41662322-41662344 GCGGGCTGGCGGGCGGGCGCCGG + Intronic
905912207 1:41662558-41662580 CCGGGGTCGCAGATGGGCCCGGG + Intronic
907364380 1:53946586-53946608 CCCGGGTTGCGTGTGGGAGCGGG + Intronic
908534886 1:65067593-65067615 CCGGGGGCGCAGGTGGGTGTGGG - Intergenic
908738922 1:67307731-67307753 CGGGGGTCGGGGCTGGGCGGTGG - Exonic
911413435 1:97540318-97540340 CCGGGGTGGGGGGTGGGGGGTGG + Intronic
913661743 1:121010894-121010916 CCGGGGTGGAGGTTGGGCGCCGG - Intergenic
913958842 1:143324069-143324091 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
913996431 1:143654630-143654652 CCGGGGTGGAGGTTTGGCGCTGG - Intergenic
914013116 1:143794074-143794096 CCGGGGTGGAGGTTGGGCGCCGG - Intergenic
914053159 1:144149449-144149471 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
914126038 1:144817092-144817114 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
914164710 1:145167111-145167133 CCGGGGTGGAGGTTGGGCGCCGG + Intergenic
914376385 1:147077289-147077311 CCGGGGTGGAGGTTGGGCGCCGG + Intergenic
914651740 1:149702683-149702705 CCGGGGTGGAGGTTGGGCGCCGG - Exonic
914753145 1:150549300-150549322 CCGGGGCCGCCGAGGGGCGCGGG + Intergenic
915502315 1:156327924-156327946 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
918238797 1:182604127-182604149 CTGGGGACCTGGGTGGGCGCGGG - Intronic
919654614 1:200185348-200185370 CAGGGGACGGGGGTGGGAGCGGG + Intergenic
920184559 1:204151998-204152020 CCGGGGTCGGCGGTGGGCGGCGG - Exonic
920451490 1:206064068-206064090 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
920704736 1:208243161-208243183 CCGGGGTCCCTGGTGGCCGCCGG - Intronic
922436935 1:225615679-225615701 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
922472907 1:225887762-225887784 TGGGGGTCGCGGGGGCGCGCAGG - Intronic
922526495 1:226308682-226308704 CCGGGGCCGGGGGAGGGCTCGGG - Intronic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
922744867 1:228038100-228038122 CCGTGGCCGCGGTGGGGCGCGGG + Intronic
922757210 1:228103073-228103095 CCGGGATCCCGGGCGGGCGCTGG - Intronic
923008018 1:230067437-230067459 GCAGGGTGGGGGGTGGGCGCAGG - Intronic
923975286 1:239255816-239255838 CCTGGGTTCCGGGTGGGTGCAGG - Intergenic
924042604 1:239998051-239998073 CCCGGGTCGGCGGTGGCCGCGGG - Intergenic
924414986 1:243849868-243849890 CCGGGGGCGTGGGCGGGGGCTGG - Intronic
1062836750 10:640721-640743 GCGGGGAAGAGGGTGGGCGCCGG + Intronic
1063139382 10:3242986-3243008 CCGGGGTGGGGGGTGGGGGCGGG + Intergenic
1064109139 10:12523144-12523166 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1065128935 10:22601323-22601345 CTGGGGTCCCAGGTGGGGGCAGG + Intronic
1065520579 10:26567309-26567331 TCGGGGACGGGGGCGGGCGCGGG - Exonic
1066758846 10:38736550-38736572 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1066962792 10:42236218-42236240 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1067091356 10:43267107-43267129 GCGGGGGAGCGGGCGGGCGCGGG + Intergenic
1067096539 10:43305057-43305079 CCGGGGGCGGGGGCGGGGGCGGG - Intergenic
1067912055 10:50355870-50355892 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
1070257675 10:74825680-74825702 CCGGGGACCCGGGTGGCCGGAGG + Intronic
1070629707 10:78076063-78076085 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1070768663 10:79070139-79070161 CCGGGGTCGGGGGGGGGAGGCGG + Intronic
1072013479 10:91323609-91323631 ACGGGGTCGCGGCTGGGCCGAGG + Intergenic
1072190503 10:93073515-93073537 CCGGGGCAGCGGGTGGGACCGGG + Intronic
1072283815 10:93894248-93894270 CGGGGGTCCCGAGCGGGCGCCGG + Intronic
1072650621 10:97292399-97292421 CGGGGGTCGGGCCTGGGCGCTGG - Intronic
1072913496 10:99523050-99523072 CGGGGGTCGCGGGGGGAGGCGGG + Intergenic
1072994277 10:100229498-100229520 CCGGGGCTGCGGCCGGGCGCGGG - Exonic
1073491285 10:103855136-103855158 CCGAGGTCCCGGGAGGGCCCCGG - Intronic
1073491347 10:103855352-103855374 CCGGGGTGGCGGGCGGCCCCGGG - Exonic
1073544742 10:104338507-104338529 CCGGGGCCGCGGGTAGAGGCGGG - Intergenic
1073789793 10:106928405-106928427 CTGGAGTTCCGGGTGGGCGCGGG - Intronic
1073970335 10:109040800-109040822 CGAGGGTTCCGGGTGGGCGCGGG + Intergenic
1074977245 10:118591693-118591715 TCGGGGTGGGGGGTGGGGGCGGG - Exonic
1075693754 10:124418784-124418806 CGGGGGAGGCGGGCGGGCGCGGG - Intronic
1075885473 10:125896171-125896193 AAGGGGTCGGGGGTCGGCGCAGG - Intronic
1075902871 10:126057214-126057236 CCGGGGTCGGGGGAGGGGGGAGG + Intronic
1076146567 10:128126564-128126586 CCGGGCTCGCGGGGCGGGGCTGG + Intergenic
1076163377 10:128263149-128263171 CTGGGGTCGCAGGTGGGAGCTGG + Intergenic
1076675202 10:132144035-132144057 CCGGGGTGGGGGGTGGGCGAAGG - Intronic
1076683315 10:132186250-132186272 CGGGGGTGGGGGGTGGTCGCAGG - Intergenic
1076688689 10:132209661-132209683 CAGGGGTCGGGGGAGGGCGTGGG + Intronic
1076900762 10:133336359-133336381 CGGGGGTTGGGGGTGGGCGGTGG - Intronic
1076916399 10:133424758-133424780 CGGGGGTCGCGGGGGACCGCGGG - Intergenic
1076936506 10:133569553-133569575 CGGGGGTCGCGGGGGACCGCGGG - Intronic
1076985988 11:236390-236412 CCGGGGGCGGGGGTGGGAGGCGG - Exonic
1076998521 11:310951-310973 CTGGAGTCGCGGGTGGACGGCGG - Intronic
1077000222 11:318808-318830 CTGGAGTCGCGGGTGGACGGCGG + Intergenic
1077020888 11:416765-416787 CCCAGGGCGCAGGTGGGCGCGGG - Intronic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1077635890 11:3841070-3841092 CCGGGGGCGAGGCTGGGGGCGGG - Intergenic
1079361994 11:19777272-19777294 CCGGGGCCGCTGCTGCGCGCGGG - Intronic
1081420873 11:42873967-42873989 CTGGAGTTGCGGGTGGGCGTGGG + Intergenic
1081622691 11:44628294-44628316 CCTGGGTCAGGGGTGGGCTCTGG - Intergenic
1083042255 11:59699723-59699745 ACGGGGTCGCGGCTGGGCAGAGG - Intergenic
1083675727 11:64323664-64323686 CAGGGGTCCCAGGTGGGGGCAGG + Intergenic
1083882969 11:65557599-65557621 CCGGGGGCACGGCTGGGGGCAGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084444535 11:69196081-69196103 CCGGGGCCGGGGTTGGGGGCTGG - Intergenic
1084924846 11:72502861-72502883 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1084973049 11:72781736-72781758 CCGGGGCCGCGCGGGGGCTCTGG + Intronic
1085044003 11:73343091-73343113 CCGGGGTGGCGGCGGGGCGGGGG - Intronic
1085295379 11:75428739-75428761 CCGGGGGATCGGGTGGGCGGGGG - Intronic
1091730535 12:2877099-2877121 CCGGGGCCGGGGGTGGGGTCTGG + Intronic
1092097353 12:5853887-5853909 CCGGGGTGGGGGGTGGGGGGTGG - Intronic
1092999561 12:13981808-13981830 CCGGGGACGGGGGGAGGCGCGGG + Intergenic
1094704000 12:32896965-32896987 CCGGGGGCGGGGGCGGGGGCGGG + Intergenic
1096250976 12:50032570-50032592 GCGGGGTGGCGTGGGGGCGCGGG + Intronic
1097127143 12:56783996-56784018 ACGGGGTCGCGGCTGGGCCGAGG + Intronic
1097166457 12:57088959-57088981 CCGGGGGCGGGGGTGGGGGCGGG - Exonic
1097267742 12:57755599-57755621 CCGGGGTTGCGGCTCGGCCCGGG - Exonic
1097879608 12:64675047-64675069 CCGGGGTGGCGGGGGGGGGGGGG - Intronic
1100444854 12:94650685-94650707 CCCGGGTCGGGGGTGGGTGGGGG - Intergenic
1102068619 12:109999503-109999525 CCGGGGTCGCCGGCCGGCTCAGG - Exonic
1102186385 12:110951175-110951197 ACGGGGTCGCGGCCGGGCCCAGG + Intergenic
1102375694 12:112419230-112419252 CCCGGGTCGGGGTTGGGGGCCGG + Intronic
1103119820 12:118371929-118371951 CCGGGACAGCGGGTGGGAGCAGG - Intronic
1103364003 12:120369314-120369336 CCGGGCTCGCGGGCGAGCGCGGG - Intergenic
1104049444 12:125186153-125186175 CGGGGGTCGCGGGCGCTCGCGGG - Intergenic
1104049669 12:125186878-125186900 CCGGGGTCGGGGATGGGGTCCGG - Intronic
1104127477 12:125861651-125861673 CCGGGGTTGGGGCTGGGGGCGGG - Intergenic
1104929256 12:132329483-132329505 CCGGGGGCGCCGGGGGGCGGCGG + Intergenic
1104939846 12:132389988-132390010 GCGGGGGCGGGGGTGGGGGCAGG - Intergenic
1105847855 13:24308502-24308524 CCGTGGTCCCAGGTGGGCGGCGG - Intronic
1106649518 13:31674958-31674980 CCGGGGTCGGGGGAGGGGGGAGG + Intergenic
1109149251 13:58823859-58823881 CGGGGGTTACGGGTGGGCGTGGG - Intergenic
1111388565 13:87561650-87561672 ACGGGGTCGCGGCTGGGCAGAGG - Intergenic
1113082755 13:106535272-106535294 CGCGGCTGGCGGGTGGGCGCGGG + Intergenic
1113473282 13:110561768-110561790 CCGGGGGCGGGGGCGGGGGCGGG - Intergenic
1113697542 13:112356735-112356757 CTGGGGTCGCAGGTGGTCCCGGG - Intergenic
1113742681 13:112722286-112722308 CCGGGGAGGAGGGTGGGCCCGGG + Intronic
1114525693 14:23365920-23365942 CAGGGGCCGAGGGTGGGAGCGGG - Intergenic
1115688989 14:35824947-35824969 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1117131983 14:52695780-52695802 CCGGGGGCGGGGACGGGCGCGGG - Intronic
1117602601 14:57390734-57390756 CAGGGCTGGCGGGTGGGCCCGGG + Intronic
1118024075 14:61751198-61751220 CCGGGGCCGCGGGCGGGGCCCGG - Intergenic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118458170 14:65963585-65963607 CCAGGGTCGGTGGTGGGAGCGGG + Intronic
1118607605 14:67515096-67515118 CCGGGGCCGTGGGTAGGGGCTGG + Exonic
1120787963 14:88554551-88554573 CCGGGGCCGCGGGCGCGCTCCGG + Intronic
1121330500 14:93046587-93046609 CCGGGGGCGGGGGGGGGCGGCGG + Intronic
1121449075 14:93996409-93996431 CCAGGGTCGGGGCTGGGCTCAGG - Intergenic
1122183295 14:99971323-99971345 CCGGGGTGGGGGCGGGGCGCCGG - Intergenic
1122399432 14:101458325-101458347 CCGTGGTCGGGGGTCGGCGACGG + Intergenic
1122719626 14:103715141-103715163 CCGGGGCCCCCGGTGCGCGCGGG - Intronic
1122940398 14:104978535-104978557 CCGGGGGCGCGGGGTGGGGCGGG - Intergenic
1122971571 14:105154413-105154435 CCAGGGTCTGGGGTGGGCACGGG - Intronic
1123025068 14:105420326-105420348 CGGGGGTGGCGGGGGGGCGCGGG + Intronic
1202906121 14_GL000194v1_random:73296-73318 CCGGGGTCGGGGGAGGGGGTGGG + Intergenic
1202906140 14_GL000194v1_random:73342-73364 CCGGGGTCGGGGGAGGGGGGTGG + Intergenic
1202872585 14_GL000225v1_random:177746-177768 AAGGGGTCGGGGGTCGGCGCAGG + Intergenic
1202929570 14_KI270725v1_random:26121-26143 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1123412924 15:20074088-20074110 CCGGGGTGGCGGGAGGGCCGGGG + Intergenic
1123442274 15:20301247-20301269 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1123522266 15:21081201-21081223 CCGGGGTGGCGGGAGGGCCGGGG + Intergenic
1124648109 15:31454162-31454184 CCGGGGTCTCGGGTGGCGGCCGG - Intergenic
1125534618 15:40436139-40436161 CCGGGGTTGGGGGTGGGCGAGGG + Intergenic
1127984734 15:64060870-64060892 CCGGGGCTGCGGGTGGGAACCGG + Intronic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1128067874 15:64775634-64775656 CCGGGGGAGGGGGCGGGCGCCGG + Intergenic
1129457615 15:75684026-75684048 CCTGGGGCGGGGGTGGGGGCGGG - Intronic
1129791204 15:78341629-78341651 CCAGGGACCCGGGCGGGCGCGGG - Intronic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1130584334 15:85168777-85168799 CTGGGGGCGGGGGTGGGGGCGGG + Intergenic
1131431898 15:92394469-92394491 CCGGGGTCGAGGGAGGGCGCCGG + Intronic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1131969284 15:97875787-97875809 CGCGGGTTCCGGGTGGGCGCGGG + Intergenic
1132039099 15:98509905-98509927 CCGGGGTCTGGGGTGGGGGGAGG + Intronic
1132330386 15:101008559-101008581 CAGAGGGCGCCGGTGGGCGCGGG - Intronic
1132480596 16:164747-164769 GCGGGGTCGCGGGGCGGGGCGGG + Intronic
1132480617 16:164788-164810 GCGGGGTCGCGGGGCGGGGCGGG + Intronic
1132510992 16:341312-341334 CTGGAGTCCCGGGTGGGCGTGGG + Intronic
1132516913 16:370273-370295 CCGGGGTAGGGGGTGAGTGCCGG - Intronic
1132516925 16:370299-370321 CCGGGGTAGCGGGTGAGAGTCGG - Intronic
1132516936 16:370325-370347 CCGGGGTAGCGGGTGAGAGCCGG - Intronic
1132516947 16:370351-370373 CCGGGGTAGCGGGTGAGAGCCGG - Intronic
1132556834 16:576276-576298 CCGGTGTCCCGGGTGGGCGTGGG + Intronic
1132594146 16:740626-740648 CCGTGGTCGCGGGCTCGCGCCGG - Intronic
1132882947 16:2170450-2170472 CGGGGGCCGTGGGTGGGCGTGGG - Intronic
1132978408 16:2721551-2721573 CCCGGGTCGGGGGTGGGAGGCGG + Intergenic
1134321903 16:13171480-13171502 CAGGGGGCGGGGGTGGGGGCGGG + Intronic
1135135818 16:19884916-19884938 CCGGGGGCGGGGGCGGGGGCGGG - Exonic
1135321672 16:21501849-21501871 CCGGGGTCTCGGCTGAGCGGCGG - Intergenic
1135338974 16:21630287-21630309 CGTGGGTTCCGGGTGGGCGCAGG - Intronic
1135437296 16:22437416-22437438 CCGGGGTCTCGGCTGAGCGGCGG + Intergenic
1136005657 16:27327138-27327160 CAGGGGCCTCGGGTGGGGGCTGG - Intronic
1136554775 16:31001378-31001400 CCGGGGCTGCGGCTGGGCGGTGG + Intronic
1136772975 16:32857655-32857677 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1136842291 16:33548703-33548725 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1136858642 16:33681136-33681158 CCGGGGCCGGGGGTGGGGGGGGG + Intergenic
1136862019 16:33710239-33710261 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1136897639 16:34003864-34003886 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1138608999 16:58108125-58108147 CCTGGGTGGTGGGTGGGGGCGGG + Intergenic
1139088541 16:63617446-63617468 CACGGGTTCCGGGTGGGCGCAGG - Intergenic
1139403051 16:66696961-66696983 CGGGAGCCGCTGGTGGGCGCTGG + Intergenic
1139623249 16:68163721-68163743 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1139896229 16:70289752-70289774 CCGGGGGCGGGGGGGGGCGGGGG - Intronic
1140393385 16:74607198-74607220 CTGGGTTCGCGGGTCGGCGCCGG - Intergenic
1140476769 16:75242856-75242878 CCGGGGTGGCGGGAGGGCCGGGG + Exonic
1141961802 16:87413813-87413835 CTGGGGTGGGGGGTGGGCGCAGG + Intronic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1141989557 16:87602412-87602434 CCGGGGGCGGGGGCGGGGGCGGG + Intronic
1142153719 16:88523795-88523817 CCCGGGTCGGGGGCGGGTGCCGG + Intronic
1142219036 16:88843978-88844000 CCGGGGCTGGGGGTGGGTGCTGG + Intronic
1142271810 16:89093841-89093863 CCGGGGAAGCTGTTGGGCGCCGG + Exonic
1142361884 16:89631231-89631253 GCGAGGTCGGGGGTGGGGGCCGG - Intronic
1203075400 16_KI270728v1_random:1119765-1119787 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1203147491 16_KI270728v1_random:1810846-1810868 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1203152456 16_KI270728v1_random:1849000-1849022 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1143747233 17:9003465-9003487 CCGGGGTCGCGGCCCGGAGCAGG - Intergenic
1145158332 17:20557371-20557393 ACGGGGTCGCGGCTGGGCAGAGG - Intergenic
1145291719 17:21551682-21551704 CCGGGGTCGGGGCGGGGCGGAGG + Intronic
1146371090 17:32265998-32266020 CCGGGGTCGCGAGGAGGCGGCGG + Intergenic
1148111589 17:45147539-45147561 CCGGGGCCGGGGGCGGGCGGGGG - Intergenic
1148130850 17:45261963-45261985 CCGGGGGCGAGGGTTGGGGCAGG - Intronic
1148553505 17:48564426-48564448 CCGGGGGCGGGGGCGGGGGCGGG - Intronic
1148582423 17:48752922-48752944 CCGGGGTGCCGGGTGGGGGCAGG + Intergenic
1148681758 17:49478117-49478139 CTGGGGTCGTGGGTGGGAGAAGG - Intergenic
1148733450 17:49851425-49851447 CCAGGGCGCCGGGTGGGCGCAGG + Intergenic
1148759695 17:49993361-49993383 CCAGGGCCGCGGGGGCGCGCGGG - Intronic
1151608143 17:75153586-75153608 CGGGGGGCGGGGGCGGGCGCGGG - Intronic
1152352137 17:79789992-79790014 CGGGGGTAAGGGGTGGGCGCCGG + Intergenic
1152362528 17:79839315-79839337 CCGGGGCGGCAGCTGGGCGCCGG - Exonic
1152377738 17:79927459-79927481 GCGGGCTCCCGGGTGGGGGCGGG + Intergenic
1152406656 17:80101728-80101750 CCGGGGCCGCGGGTGGAGGTCGG + Intergenic
1152426278 17:80220376-80220398 CCGGGGTCGGGGCAGGGGGCGGG - Exonic
1152655959 17:81519334-81519356 CCGGGGCTTCGGGTGGGCCCAGG + Intronic
1152732240 17:81977934-81977956 CGGGGGTCCCGAGTGGGGGCGGG + Intronic
1152748465 17:82051808-82051830 CCGGAGCCGTGGGTGGGCGGCGG + Intronic
1155570340 18:27185362-27185384 GCGGGGGCGCGGGCGGGAGCGGG - Intergenic
1156118958 18:33820236-33820258 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156118970 18:33820264-33820286 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156118982 18:33820292-33820314 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156118994 18:33820320-33820342 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119006 18:33820348-33820370 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119018 18:33820376-33820398 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119030 18:33820404-33820426 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119042 18:33820432-33820454 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119054 18:33820460-33820482 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119066 18:33820488-33820510 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119078 18:33820516-33820538 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156119090 18:33820544-33820566 CGCGGGTTCCGGGTGGGCGCCGG - Intergenic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1156657803 18:39309142-39309164 CATGAGTTGCGGGTGGGCGCAGG + Intergenic
1157261009 18:46175117-46175139 CCGGGGACGGGGGTCGGGGCGGG - Intronic
1157973060 18:52293013-52293035 TCGGGGTCGGGGGTGGGGGTGGG + Intergenic
1158427442 18:57352655-57352677 CCGGGGCCGGGGGTTGGGGCTGG - Exonic
1158602034 18:58863825-58863847 CCAGGGGCGCGGGTGGGCGCCGG + Intronic
1158725175 18:59964714-59964736 CCGCGGTCGCTGGTGGGCTCCGG + Intergenic
1159346725 18:67215833-67215855 CGCGGGTTCCGGGTGGGCGCGGG - Intergenic
1159798487 18:72869163-72869185 GCGGGGTCGCCGGGGGGCGGGGG + Intergenic
1160164041 18:76495088-76495110 CAGGGGCCGCGGGCGGGCGGTGG - Intronic
1160613844 18:80109358-80109380 GCGGAGGCGCGGGCGGGCGCAGG + Exonic
1160706400 19:532136-532158 CCGAGGTCGCTCGTGGGCTCCGG - Intronic
1160718669 19:588342-588364 CAGGGCTCGCGGCTGGGAGCAGG - Intergenic
1160719188 19:590066-590088 CCGGGGCCCGGGGGGGGCGCGGG - Exonic
1160810744 19:1012017-1012039 GCGAGGGCGCGGGTGGGGGCGGG - Intronic
1160873052 19:1285761-1285783 CCGGGGCAGGGGGCGGGCGCAGG + Intergenic
1160903101 19:1438906-1438928 CGGGGGTCGCGGGCAGGGGCTGG + Intronic
1160912775 19:1482481-1482503 CAGGGGTCGCGGGTGGGCACAGG + Intronic
1160927805 19:1555508-1555530 CGGGGGCCAGGGGTGGGCGCGGG - Exonic
1160948027 19:1652397-1652419 CGAGGGTCGCGCGTGGGCGGCGG + Intronic
1160992388 19:1865009-1865031 CTGGGGTTGCAGGTGGGCGGGGG - Intergenic
1161051011 19:2164112-2164134 GCGGGGCCGCCGGTGGGCGGAGG - Intronic
1161138466 19:2634383-2634405 CCGGGGTTGGGGGTGGGGGGCGG + Intronic
1161154993 19:2727911-2727933 TCGGGGTCCCCGCTGGGCGCAGG - Intronic
1161175786 19:2841620-2841642 CCGCGGTCTCGGGCGGTCGCCGG - Intronic
1161203701 19:3029378-3029400 CCGGGGGCCGGGGGGGGCGCGGG - Intronic
1161241102 19:3224530-3224552 CCGGGGATGCGGGGAGGCGCCGG + Intergenic
1161461560 19:4400573-4400595 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161461569 19:4400592-4400614 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161550594 19:4910126-4910148 CCGGCGGCGGGGGTGGGCGTGGG + Intronic
1161560174 19:4968867-4968889 GCGGGCACGTGGGTGGGCGCCGG + Intergenic
1161684406 19:5695860-5695882 CAGGTGGCGCGAGTGGGCGCAGG - Intronic
1161721197 19:5903601-5903623 CCAGCGTCGCTGGTGAGCGCCGG - Exonic
1161779099 19:6279592-6279614 CCGGGGTCGCGGATGGGGGAGGG + Intronic
1162019606 19:7862660-7862682 GCGGGGCCGCGGGCGGGGGCGGG - Intronic
1162019619 19:7862690-7862712 GCGGGGTCGCGGGCAGGAGCAGG - Intronic
1162021389 19:7869994-7870016 CCGGGGTCGGGGGGCGGCGTGGG + Exonic
1162033008 19:7925471-7925493 ACGGGGCCCCCGGTGGGCGCGGG - Exonic
1162278942 19:9680017-9680039 ACGGGGTCGCGGCTGGGCAGAGG - Intergenic
1162430439 19:10625364-10625386 CAGGGTTCCCGGGTGGGGGCGGG + Exonic
1162481528 19:10929423-10929445 CGTGGGTCGCTGGTGGGTGCTGG + Exonic
1163413691 19:17172691-17172713 CCGGGGTCTTTGGTAGGCGCCGG + Intronic
1163547241 19:17947820-17947842 GCGGGGGCGGGGGTGGGGGCGGG - Intergenic
1163597073 19:18226381-18226403 CCGGGGACCGGGGCGGGCGCGGG + Intronic
1163845036 19:19633908-19633930 CGGGGGTGGCGGTTGGGAGCTGG + Exonic
1163909446 19:20176145-20176167 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1164168154 19:22700648-22700670 ACGGGGTCGCGGCTGGGCCGAGG + Intergenic
1165994222 19:39833249-39833271 CCCGGGTAGGGGGTGGGGGCTGG - Exonic
1166043822 19:40218029-40218051 CCGGGGCTGCTGGTGGGCCCGGG + Exonic
1166064331 19:40348337-40348359 CGGGCGGCGCGAGTGGGCGCGGG - Intronic
1166733000 19:45069145-45069167 CTGGGGTGACGGGTGGGTGCTGG + Intronic
1166994488 19:46713815-46713837 GCGGGGCCTCGGGTGGGGGCGGG - Intronic
1167258034 19:48442771-48442793 GCGGGGCCGCCGGGGGGCGCGGG + Exonic
1167368086 19:49065072-49065094 CCCGGGTCGGGGGCGGGGGCGGG + Intronic
1167575507 19:50315691-50315713 ACGGGGTCGGGGGTGGGGGGCGG + Exonic
1167648628 19:50718511-50718533 CAGGGCTCGCGGGAGGGAGCGGG + Intronic
1168072002 19:53958581-53958603 CTGGGGACGCGGGAGGGGGCGGG + Intergenic
1168367877 19:55805133-55805155 CCGGGGTTGGGGGTGAGGGCCGG - Intronic
1202692555 1_KI270712v1_random:101872-101894 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
924962376 2:46306-46328 TCGGGGTCCCGGGTAGCCGCGGG + Exonic
925156544 2:1652586-1652608 CTGGGGGCGGGGGTGGGGGCAGG - Intronic
925190235 2:1876512-1876534 CCGGGGTGAGGGGTAGGCGCGGG - Intronic
926140273 2:10364212-10364234 CTGGGGTCGAGTGTGGGAGCTGG + Intronic
927472356 2:23385716-23385738 CCGGGGTCGCGGGTGGGCGCAGG - Exonic
927811878 2:26185010-26185032 CCGGGGGCGCGGGCGAGCCCGGG - Exonic
928511976 2:32010699-32010721 CCGGGGGTGGGGGTGGGTGCGGG - Intronic
929681262 2:43995728-43995750 CCGGGGTCGTGGGTGCCGGCAGG - Intronic
932363617 2:71130787-71130809 CCGGGGTCTCACGTGGACGCGGG + Intronic
932625527 2:73293184-73293206 CCAGGGTAGCCGGTGGCCGCGGG + Exonic
933659494 2:84915889-84915911 CCGGGGTCGCGGGAGTGGACGGG + Intergenic
933953848 2:87352099-87352121 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
934238048 2:90248345-90248367 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
934275151 2:91568391-91568413 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
934460464 2:94211681-94211703 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
934500485 2:94857239-94857261 CCGGGGTCGGGGGAGGGGGGTGG - Intergenic
934539053 2:95159606-95159628 GCGGGGTGGCGGGCGGGGGCTGG - Exonic
934539064 2:95159630-95159652 GCGGGGTGGCGGGCGGGGGCTGG - Intronic
934539075 2:95159654-95159676 GCGGGGTGGCGGGCGGGGGCTGG - Intronic
935196498 2:100819810-100819832 GCAGGGTCGGGGTTGGGCGCCGG - Intergenic
938338952 2:130522926-130522948 GTGGGGACGGGGGTGGGCGCCGG + Intronic
938350886 2:130597824-130597846 GTGGGGACGGGGGTGGGCGCCGG - Intronic
938703331 2:133898629-133898651 GCGGGGTGGGGGGTGGGTGCAGG - Intergenic
940009418 2:149038645-149038667 CCTGGGGCGCGGGAGGGGGCCGG - Exonic
942021061 2:171866992-171867014 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
944722701 2:202440326-202440348 ACGGGGTCGCGGCCGGGCACAGG + Intronic
944955131 2:204799248-204799270 CCTGGGTCGCTGGTGGCTGCAGG + Intronic
945316694 2:208377732-208377754 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
946362823 2:219229349-219229371 ACGGGGGCGCGCGCGGGCGCCGG - Exonic
946371908 2:219286115-219286137 CCTGGGTGGCGGGTGGGGGCCGG + Exonic
946402530 2:219476022-219476044 CTGGGGTGGGGGGTGGGGGCTGG + Intronic
946843072 2:223837152-223837174 CCGGGCTCGGTGCTGGGCGCTGG - Intronic
947865980 2:233398073-233398095 CGGGGGTGGGGGGTGGGAGCTGG - Intronic
948420907 2:237859566-237859588 CCGGGGGCGGGAGCGGGCGCGGG - Exonic
948491674 2:238317093-238317115 GCGGGGTGGCGGGGGGGTGCAGG + Intergenic
948595288 2:239075876-239075898 CCGGGATAGCAGGTGGGTGCTGG + Intronic
948645144 2:239400196-239400218 GGGGGGTCGCGGGAGGGCGGGGG - Intronic
949079867 2:242088465-242088487 GCGGGGGCGCGGGGGGGCGGGGG - Intergenic
1169367169 20:5001211-5001233 CCAGGGTGGCCGGCGGGCGCGGG + Intronic
1169497035 20:6124980-6125002 CTGGGGTCGGGGGTAGGGGCAGG - Intergenic
1169718255 20:8644471-8644493 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
1169885654 20:10395138-10395160 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1171891702 20:30723922-30723944 CCGGGGTCGGGGGAGGGGGTTGG - Exonic
1172118003 20:32583402-32583424 CCGGGGACGGGGCTGAGCGCGGG + Intronic
1172349976 20:34230995-34231017 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1172379275 20:34474975-34474997 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1172702662 20:36862816-36862838 CCGGGGAGGCGGGCGGCCGCGGG + Exonic
1173453536 20:43186335-43186357 GGGGGGGCGAGGGTGGGCGCAGG - Intronic
1174287741 20:49484115-49484137 CGGGGGGCGCCGGCGGGCGCCGG + Intergenic
1175394735 20:58650497-58650519 CCCGGGGCACGGGGGGGCGCGGG + Intergenic
1175399520 20:58692711-58692733 CCCGGGGCGCGAGGGGGCGCCGG - Exonic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175572781 20:60036745-60036767 CCGAGGTCACGTGTGGGCTCTGG + Intergenic
1175819461 20:61900737-61900759 CAGGGGTTGGGGGTGGGCGCTGG + Intronic
1175859619 20:62143362-62143384 CGGGAGTCGCGGGTGCGCGCGGG - Exonic
1176026167 20:62986612-62986634 GCGGGGGTGCGGGTGGGCGGGGG + Intergenic
1176062777 20:63179494-63179516 CCGGGGCCTGGGATGGGCGCGGG - Intergenic
1176192038 20:63816110-63816132 CAGTGGGCGCAGGTGGGCGCAGG + Intronic
1176311715 21:5154257-5154279 GCGGGGACGCGGGCGCGCGCAGG - Intronic
1176625497 21:9088098-9088120 CCGGGGTCGGGGGAGGGGGGTGG + Intergenic
1176853176 21:13936887-13936909 ACGGGGTGGCGGGTGGGCAGAGG + Intergenic
1176882746 21:14216557-14216579 CCTGGGCCTCGGGTGTGCGCGGG + Intronic
1178561459 21:33642761-33642783 GCGGGGGCGGGGGTCGGCGCGGG + Intronic
1178610341 21:34073866-34073888 CCGGGGCGGCGGGCGGGCGGCGG + Intronic
1179209414 21:39313163-39313185 CGGGGGTCGCGGGTGGTGGGCGG - Intronic
1179720395 21:43313239-43313261 CTGGGGGCGGGGGTGGGCACTGG - Intergenic
1179809980 21:43864685-43864707 CCGGGGTCTCCTGCGGGCGCCGG - Intergenic
1179845335 21:44107778-44107800 GCGGGGACGCGGGCGCGCGCAGG + Intronic
1179951086 21:44709119-44709141 GCGGGGTCACTGGTGGGCTCTGG - Intronic
1179957398 21:44749267-44749289 CCTGGGTCGGGCCTGGGCGCCGG + Intergenic
1180182975 21:46126234-46126256 CCGGGTGAGCGTGTGGGCGCGGG + Exonic
1180201947 21:46229411-46229433 CCGGGGCCGGGGGTGGGGGCGGG + Intergenic
1180274442 22:10631832-10631854 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1180285514 22:10741730-10741752 AAGGGGTCGGGGGTCGGCGCAGG - Intergenic
1180548926 22:16526809-16526831 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1181165160 22:20979376-20979398 CCGGGGCCTCGGATGGGGGCGGG + Intronic
1181355783 22:22295074-22295096 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1181761656 22:25062809-25062831 CGGGGGGCGGGGGTGGGTGCCGG - Intronic
1184439206 22:44498258-44498280 CCGGGGTCGCGGCAGAGGGCGGG + Exonic
1184640509 22:45867704-45867726 CCGGGGCCGCGGATGCGTGCAGG - Intergenic
1185167441 22:49270257-49270279 CGGGGGTGGGTGGTGGGCGCAGG + Intergenic
1185289042 22:50014904-50014926 CCCGGGTCCCGGGCGGACGCTGG - Intergenic
1185397632 22:50600924-50600946 TCGGGGTCGGGGGGGTGCGCAGG - Intronic
1185409361 22:50674243-50674265 GCGGGGTCCCGGGTGGGGGCGGG - Intergenic
950021712 3:9792416-9792438 CAGGGGCCGCGGGAGGGGGCGGG + Exonic
951290513 3:20867111-20867133 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
951881301 3:27483877-27483899 CCTGGGGCGCGGGTGGGAGGGGG - Intronic
952795221 3:37233053-37233075 CCGGAGTTCCGGGTGGGCGTGGG + Intergenic
953100533 3:39821307-39821329 CAGGGGTCGGGGGTGGGCAGTGG - Intronic
954288256 3:49634936-49634958 CAGGGGTAGCGGGTGGGCTCTGG + Intronic
954300700 3:49699388-49699410 CCGGGGTGGGGGGTGGGCAGTGG + Intronic
954469028 3:50675460-50675482 GCGGGTGCGGGGGTGGGCGCGGG + Intronic
955755822 3:62224162-62224184 CTGGGGTTGCGGGTGGGAGTGGG - Intronic
958453860 3:94306074-94306096 GCGGGGTGGCGGGGGGGCGGGGG + Intergenic
959500376 3:107099867-107099889 CCTGGGTGGCAGGTGGGTGCAGG - Intergenic
961515018 3:127426951-127426973 ACGGGGTGGGGGGTGGGAGCAGG - Intergenic
962301905 3:134250701-134250723 TCGGGGCCGGGGGTGGGCGGCGG - Exonic
964862905 3:161221544-161221566 CCGGGGTTGGGGGTCGGCGTGGG + Exonic
966375399 3:179291027-179291049 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
966886342 3:184379892-184379914 CCCGGATCGCGGGTGGGGGAGGG - Intronic
967903941 3:194486332-194486354 CCGGGGGCGAGCGTGGGGGCCGG - Intronic
968503129 4:960357-960379 CCCGTGTCCCGGGTGGGCGCAGG - Exonic
968518368 4:1024177-1024199 GCGGGGGCGCTGGTGGGCGGGGG + Intronic
969138779 4:5051575-5051597 CCGGGTTCCCGGGCGGGCACTGG + Exonic
969344832 4:6563931-6563953 CGGGCGCCGAGGGTGGGCGCGGG + Intergenic
969423371 4:7109817-7109839 CCGGGGATGGGGGTGGGGGCAGG + Intergenic
969532925 4:7739742-7739764 CGGGTGTCCCGGGTGGGGGCTGG - Intronic
970188193 4:13484396-13484418 GCGGGGCCGCCGGTCGGCGCGGG - Intergenic
970394856 4:15655424-15655446 GCGGGGACGCGGGGGCGCGCAGG + Intronic
972654088 4:41049222-41049244 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
972740402 4:41881890-41881912 CAGGGGGCGGGGGCGGGCGCTGG - Intergenic
976597013 4:86904220-86904242 CGCGGGTTCCGGGTGGGCGCAGG - Intronic
977205090 4:94157950-94157972 ACGGGGTCGCGGCTGGGCAGAGG - Intergenic
977370301 4:96126394-96126416 CTCGGGTTCCGGGTGGGCGCAGG - Intergenic
978998071 4:115179727-115179749 CTGGGGTTCCGGGTGGGCGTGGG - Intergenic
980234737 4:130090624-130090646 CAGGGGTTCCGGGTGGGCACAGG + Intergenic
980987558 4:139710536-139710558 CCGGGGTGGAGGGAGGGCACAGG - Intronic
981550457 4:145937220-145937242 CCGGGGGCGCGGGTGGAGGAGGG + Intronic
981942414 4:150296903-150296925 CCGGCGGTGGGGGTGGGCGCGGG - Intronic
983249283 4:165326891-165326913 CCGGGGGCGGGGGCGGGGGCGGG - Intergenic
984095472 4:175427984-175428006 CGTGGGTTCCGGGTGGGCGCGGG + Intergenic
985719395 5:1481363-1481385 CCGGGGTCCCGGGTGCACACTGG - Intronic
986737878 5:10681417-10681439 GCAGGGACGCTGGTGGGCGCTGG - Intronic
986737936 5:10681653-10681675 GCAGGGACGCTGGTGGGCGCTGG - Intronic
986738127 5:10682528-10682550 GCAGGGACGCTGGTGGGCGCTGG - Intronic
986748096 5:10761385-10761407 CCGGGGGCGGGGGCGGGGGCGGG + Intergenic
987301766 5:16603852-16603874 CCAGGGTGGCGGGTGGGGGGTGG - Intronic
987315271 5:16718001-16718023 CTGGAGTTGCGGGTGGGCGTGGG + Intronic
989103429 5:37840068-37840090 CCGGGGTCCGGGGTGGGGGAGGG + Intergenic
989983098 5:50666613-50666635 CCGCGGGCGCGAGTGTGCGCGGG + Intronic
990557700 5:56952026-56952048 CGGGGGTCGCGGGGAGCCGCCGG + Intronic
990617032 5:57518790-57518812 ACGGGGTGGCGGGTGGGCAGAGG + Intergenic
991346235 5:65671637-65671659 CCGGGGGCGGGGGTGGGGGTGGG + Intronic
992365450 5:76084695-76084717 CGGGGGTGGCGGGCGGGGGCAGG + Intronic
992852432 5:80824298-80824320 ACGGGGTGGCGGCTGGGCGGAGG + Intronic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
994353067 5:98769017-98769039 CTGGTGCCGCGGGTGGGCGAAGG + Intronic
994411361 5:99410608-99410630 CCGCGTTCGCGGGCAGGCGCGGG - Intergenic
996681165 5:126229153-126229175 CGTGGGTTCCGGGTGGGCGCAGG + Intergenic
997714052 5:136029100-136029122 CCAGGGTCGCGGCGGGGCCCAGG - Exonic
998134672 5:139668416-139668438 CCTGGGACCCGGGCGGGCGCCGG - Intronic
998138694 5:139688102-139688124 CCAGGGCTGCGGGTGGGCGGGGG - Intergenic
998156113 5:139788174-139788196 ACGGGTTCGGGGGGGGGCGCGGG - Intergenic
1000296397 5:159916613-159916635 CCGGGCTCGCGGGGGAGCGGCGG - Intergenic
1001381903 5:171311028-171311050 CCGGGGTCGCTGGGGTCCGCGGG - Intronic
1002688300 5:181032527-181032549 CGGGGGTTCCGGGTGGGAGCGGG + Intergenic
1002927102 6:1611042-1611064 CCGGCGGCGCGGGCGGGGGCTGG - Exonic
1003545191 6:7052450-7052472 CCGGGGGTGGGGGTGGGGGCGGG + Intergenic
1003907998 6:10720218-10720240 CCCGGGTTCCAGGTGGGCGCAGG - Intergenic
1004665550 6:17745617-17745639 CTGGAGTTCCGGGTGGGCGCGGG - Intergenic
1004874596 6:19940099-19940121 ACGGGGTGGCTGGTGGGCGGAGG - Intergenic
1005235491 6:23757389-23757411 CTGGGGTGGGGGGTGGGAGCGGG - Intergenic
1006004805 6:30993419-30993441 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1006014190 6:31067371-31067393 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1006318485 6:33304943-33304965 CAGGGGTAGAGGGTGGGCACTGG - Intronic
1007230117 6:40342397-40342419 CGGGGGTTGGGGGTGGGCGATGG - Intergenic
1007347132 6:41239695-41239717 CCGGGCTCCCGCGGGGGCGCAGG + Intergenic
1007390370 6:41546886-41546908 CCAGGGACGTGGGTGGGGGCTGG + Intronic
1008381871 6:50845965-50845987 CCGGCGCCCCGGGTGGCCGCTGG - Exonic
1008624789 6:53305560-53305582 ACGGGGTCGCGGCTGGGCCGAGG + Intronic
1009431738 6:63572932-63572954 GCGGGGTGGCGGTTGGCCGCCGG + Intronic
1010428188 6:75749207-75749229 CCGGGGACTCGGCGGGGCGCCGG + Intronic
1011426870 6:87239711-87239733 ACGGGGTCGCGGCTGGGCAGAGG + Intronic
1011517010 6:88166142-88166164 TCGCTGTCGCGGGCGGGCGCTGG - Exonic
1013803283 6:113970776-113970798 CTGCCGTCGCGAGTGGGCGCCGG - Intronic
1014156720 6:118119489-118119511 GCGGGGTGGAGGGGGGGCGCCGG - Intronic
1016936372 6:149451518-149451540 CCGGGGGCGCGGAGGGGCGGTGG + Intronic
1016982232 6:149864074-149864096 GCGGGGACGCGGGCGAGCGCGGG + Intergenic
1018371013 6:163168399-163168421 CCGGGGTTGCGGGTTGGGGGTGG + Intronic
1018696704 6:166396580-166396602 CTGGGGGCGGGGGTGGGGGCGGG + Intergenic
1019395759 7:816840-816862 CCGGGGTAGCTGCGGGGCGCGGG - Intronic
1019457523 7:1138188-1138210 ACGTGGGCGCAGGTGGGCGCAGG - Exonic
1019711519 7:2520157-2520179 CAGGGGGCGCGGGTGGCCGTCGG - Exonic
1020035004 7:4959289-4959311 GCGGGGTCGCGGGAGGGAGGGGG - Intergenic
1020066258 7:5190500-5190522 CCGGGGTCGGGGGTCGGAGTCGG + Intronic
1020122664 7:5513762-5513784 CCGGGGTCTCGGTTGAGCGGTGG - Exonic
1020224835 7:6272253-6272275 CCGGGGTCGCCGTTCGGCGCTGG - Intronic
1021998561 7:26202367-26202389 CCGCGCTCCCGGGTGGGGGCGGG + Intronic
1022285929 7:28956407-28956429 CAGGGGTCGCCGGCGGGCGATGG + Exonic
1022528429 7:31052740-31052762 CCGAGGTCCCGGCTGGGCGAAGG - Intronic
1023954334 7:44872194-44872216 ACGGGGTGGCGGGTGGGCAGAGG + Intergenic
1023995429 7:45156611-45156633 CAGGGGTGGTGGGTGGGCCCTGG + Intergenic
1025777383 7:64570564-64570586 CCGGGGTCGGGGGAGGGGGCTGG + Intergenic
1027111308 7:75442248-75442270 CCGGGCGGGCGGGTGGGCGGCGG + Intronic
1027171983 7:75879047-75879069 CCGGCGTCGAGGCGGGGCGCGGG + Exonic
1027260557 7:76461882-76461904 CCAGGGGCGCGGGGTGGCGCGGG + Intronic
1027311936 7:76959995-76960017 CCAGGGGCGCGGGGGGGCGCGGG + Intergenic
1030304148 7:108002595-108002617 CGGGGGCCGCGGGAGGCCGCAGG + Intronic
1034244760 7:149635932-149635954 CCGGGGACCGGGGTGGGCGGGGG - Intergenic
1034446069 7:151114969-151114991 CCGCGGGCGCCGGTGGGCGGCGG - Intronic
1034455467 7:151167659-151167681 CCGAGGTGGCGGCGGGGCGCGGG + Intronic
1034466427 7:151232633-151232655 CCGGCGTCCCGGGAGGGGGCGGG - Exonic
1035125832 7:156607419-156607441 GCTCGGGCGCGGGTGGGCGCGGG - Intergenic
1035569852 8:665342-665364 CCGGGCTCACGGGTGGACACTGG + Intronic
1036756742 8:11476278-11476300 CGGGGGGCGGGGGTGGGCACTGG - Intergenic
1037297192 8:17413493-17413515 GCGGCGGCGCAGGTGGGCGCAGG - Intronic
1038727591 8:30095360-30095382 TCGGGCTCGCGCGGGGGCGCGGG - Intergenic
1039902294 8:41761876-41761898 CTGGGGTTGTGGGTGGGGGCTGG - Intronic
1039921406 8:41896621-41896643 GCGGGGTCGCGGGAAGGCGAAGG + Exonic
1040981746 8:53251684-53251706 GCCGGGACGCGGCTGGGCGCTGG + Exonic
1041968185 8:63705087-63705109 TCCGGGGCGCGGGTGGGGGCGGG + Intergenic
1042133980 8:65616769-65616791 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
1042555859 8:70033315-70033337 CCGGGGTCGGGGATGGGGGGTGG - Intergenic
1043958635 8:86390286-86390308 ACGGGGTGGCGGCTGGGCACAGG + Intronic
1045547443 8:103141081-103141103 CCGGGGTAGCGGGCGGGCGAGGG - Intronic
1047393722 8:124475032-124475054 CCGGGGCCGCGGCCGGGGGCGGG - Exonic
1048073157 8:131041597-131041619 CCGGGGGCGTGGCTTGGCGCGGG - Exonic
1048447795 8:134504947-134504969 CCTGGGTCTGGGGTGGGGGCAGG - Intronic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049645480 8:143733923-143733945 CCGGGGGCGCGGGCTGGGGCTGG - Intergenic
1049687206 8:143943788-143943810 CAGGGGACGTCGGTGGGCGCAGG - Intronic
1049708082 8:144051857-144051879 CCAGGGGCGGGGGTGGGGGCGGG + Intronic
1049844491 8:144793269-144793291 CCGAGGCCGCGGGTGGGGGATGG + Intergenic
1051170219 9:14313950-14313972 AGGGGGGCGCGGGAGGGCGCAGG + Intronic
1051629319 9:19127614-19127636 CCGGCGTTGGGGGAGGGCGCCGG - Intronic
1053690961 9:40587378-40587400 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1054273843 9:63050113-63050135 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1054302221 9:63388349-63388371 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1054357132 9:64071820-64071842 CCGGGGTCGCGGGAGGGGGGTGG + Intergenic
1054400997 9:64714855-64714877 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1054434604 9:65199169-65199191 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1054495786 9:65822512-65822534 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic
1055090945 9:72364664-72364686 ACGGGGCTGCGGGTGGGAGCCGG - Intronic
1055557605 9:77490693-77490715 CTGGGGTTCCGGGTGGGCGTGGG - Intronic
1056163491 9:83921134-83921156 CTGGGGTCGGGGCTGGGAGCCGG - Intronic
1056350334 9:85742347-85742369 GCGGGGGAGGGGGTGGGCGCGGG - Intergenic
1056710894 9:88991333-88991355 CCGGGTTCGCGGGCGGGGGACGG + Intronic
1057547265 9:96027625-96027647 CCGGGGGGACGGGTGGGCGCTGG - Intergenic
1057630513 9:96715839-96715861 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1057757788 9:97851936-97851958 CCGGGGTGGGGGGGGGGGGCGGG - Intergenic
1058049534 9:100392602-100392624 ACGGGGTGGCGGGTGGGCAGAGG - Intergenic
1058778149 9:108305841-108305863 GCGGGGTCGGGGGGGGGCGGGGG - Intergenic
1059414896 9:114156266-114156288 CGGGGGTCGGGGGTGGGGGTGGG + Intronic
1060080133 9:120636706-120636728 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
1060405986 9:123373370-123373392 CCGGGGCCGCGCGTGGCCGATGG + Exonic
1060555372 9:124504975-124504997 CCGGCGCGGCGGGTTGGCGCAGG - Intronic
1060770068 9:126326511-126326533 CTGGGGTCGCCGGCGGGCTCGGG + Intergenic
1061508408 9:131045819-131045841 TGGGGGTCGCAGGTGGGCACTGG - Intronic
1061589851 9:131591294-131591316 GCGGGGGCGCGGGTGGACTCAGG + Intronic
1061680950 9:132242155-132242177 CCGGGGTCCCGGGGCGGGGCCGG + Exonic
1061851341 9:133417868-133417890 CCGGGGTCTCGGGTGGCCGCCGG - Exonic
1061853272 9:133428569-133428591 GCGGGGGCGGGGGTGGGGGCGGG - Intronic
1061984006 9:134118702-134118724 ACGGGGTCGCGGCTGGGCAGAGG + Intergenic
1062306000 9:135907420-135907442 CCGGGGGCGGGGGCGGGCGCGGG + Intergenic
1062341450 9:136095417-136095439 CCGGGGTCGGGGCTGGGGTCCGG + Intergenic
1062507702 9:136886565-136886587 GCGGGGTCGGGCGCGGGCGCGGG + Intronic
1203731870 Un_GL000216v2:98796-98818 AAGGGGTCGGGGGTCGGCGCAGG - Intergenic
1203748662 Un_GL000218v1:58559-58581 CCGGGGTCGGGGGAGGGGGGTGG + Intergenic
1203621619 Un_KI270749v1:133484-133506 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1185503185 X:614339-614361 CAGGGGTCCCAGGTGGGGGCAGG - Intergenic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1185641767 X:1592410-1592432 CCGGGGTGGTCGGAGGGCGCTGG + Intronic
1185736596 X:2500765-2500787 CCGGGGACCCGGGTGGGCGCGGG - Intronic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1186821340 X:13291168-13291190 GGGGGGGCGCGGGGGGGCGCGGG - Intergenic
1187172991 X:16869988-16870010 CCGGGGCCGCGGGGGGCGGCGGG - Intronic
1188834814 X:34943395-34943417 CCGGAGTCTCGGGAGGCCGCGGG - Exonic
1189267633 X:39729229-39729251 CCGGGGTGGGGGGTGGGGGTGGG - Intergenic
1190870823 X:54423292-54423314 CAGGGGTCGGGGGTGGGGGGTGG + Intergenic
1195156035 X:102125663-102125685 GCGGGCTGGCGGGCGGGCGCGGG - Intergenic
1195888929 X:109671261-109671283 ACGGGGTCGCGGCTGGGCAGAGG - Intronic
1196889480 X:120278125-120278147 TCGGGGTCGGGGGTGGGTGGGGG - Intronic
1197214399 X:123854774-123854796 GCGGGGTGGGGGGTGGGGGCGGG - Intergenic
1197692995 X:129522981-129523003 ACGGGGGCGGGGCTGGGCGCGGG - Intronic
1199772581 X:150983991-150984013 CCGGTGGCCCGGGGGGGCGCGGG + Intronic
1200003275 X:153072730-153072752 CCGGGGTCCGGGGGCGGCGCGGG + Intronic
1200004448 X:153077279-153077301 CCGGGGTCCGGGGGCGGCGCGGG - Intergenic
1200173626 X:154097221-154097243 CCGGGGCCGCGGGCGCGCGACGG + Intronic
1200824326 Y:7622528-7622550 CTGGGGTTCCGGGTGGGCGTGGG - Intergenic
1201161999 Y:11173483-11173505 CCGGGGTCGGGGGAGGGGGTGGG + Intergenic
1201189662 Y:11436075-11436097 CTGGGGTCTGGGGTGGGTGCTGG - Intergenic
1202235729 Y:22708559-22708581 CTGGGGTTCCGGGTGGGCGTGGG + Intergenic
1202563371 Y:26182977-26182999 CTGGGGTTCCGGGTGGGCGTGGG + Intergenic
1202583982 Y:26405900-26405922 CTGGGGTCTGGGGTGGGTGCTGG + Intergenic