ID: 927472637

View in Genome Browser
Species Human (GRCh38)
Location 2:23386702-23386724
Sequence CGCCGCGCGGGTGCCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927472626_927472637 28 Left 927472626 2:23386651-23386673 CCCGGTCTCCGTGGCCTGGAGCG 0: 1
1: 0
2: 2
3: 26
4: 128
Right 927472637 2:23386702-23386724 CGCCGCGCGGGTGCCCGCGCTGG 0: 1
1: 0
2: 2
3: 23
4: 202
927472630_927472637 20 Left 927472630 2:23386659-23386681 CCGTGGCCTGGAGCGGGCTGAGA 0: 1
1: 0
2: 2
3: 23
4: 226
Right 927472637 2:23386702-23386724 CGCCGCGCGGGTGCCCGCGCTGG 0: 1
1: 0
2: 2
3: 23
4: 202
927472627_927472637 27 Left 927472627 2:23386652-23386674 CCGGTCTCCGTGGCCTGGAGCGG 0: 1
1: 0
2: 0
3: 26
4: 183
Right 927472637 2:23386702-23386724 CGCCGCGCGGGTGCCCGCGCTGG 0: 1
1: 0
2: 2
3: 23
4: 202
927472631_927472637 14 Left 927472631 2:23386665-23386687 CCTGGAGCGGGCTGAGAGCGCTA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 927472637 2:23386702-23386724 CGCCGCGCGGGTGCCCGCGCTGG 0: 1
1: 0
2: 2
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927472637 Original CRISPR CGCCGCGCGGGTGCCCGCGC TGG Intronic