ID: 927476971

View in Genome Browser
Species Human (GRCh38)
Location 2:23420904-23420926
Sequence TCACACCCTCCCAGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 364}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927476965_927476971 15 Left 927476965 2:23420866-23420888 CCCAAATTATACCCAACCTTCAA 0: 1
1: 0
2: 6
3: 31
4: 261
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476970_927476971 -10 Left 927476970 2:23420891-23420913 CCGAGCATCAATCTCACACCCTC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476958_927476971 26 Left 927476958 2:23420855-23420877 CCACCCCCCCACCCAAATTATAC 0: 2
1: 0
2: 3
3: 46
4: 477
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476966_927476971 14 Left 927476966 2:23420867-23420889 CCAAATTATACCCAACCTTCAAA 0: 1
1: 0
2: 4
3: 59
4: 379
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476964_927476971 18 Left 927476964 2:23420863-23420885 CCACCCAAATTATACCCAACCTT 0: 1
1: 0
2: 0
3: 14
4: 145
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476961_927476971 21 Left 927476961 2:23420860-23420882 CCCCCACCCAAATTATACCCAAC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476959_927476971 23 Left 927476959 2:23420858-23420880 CCCCCCCACCCAAATTATACCCA 0: 1
1: 0
2: 5
3: 19
4: 222
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476960_927476971 22 Left 927476960 2:23420859-23420881 CCCCCCACCCAAATTATACCCAA 0: 1
1: 0
2: 0
3: 15
4: 192
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476967_927476971 4 Left 927476967 2:23420877-23420899 CCCAACCTTCAAAGCCGAGCATC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476962_927476971 20 Left 927476962 2:23420861-23420883 CCCCACCCAAATTATACCCAACC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476969_927476971 -1 Left 927476969 2:23420882-23420904 CCTTCAAAGCCGAGCATCAATCT 0: 1
1: 0
2: 0
3: 5
4: 53
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476957_927476971 29 Left 927476957 2:23420852-23420874 CCGCCACCCCCCCACCCAAATTA 0: 1
1: 0
2: 7
3: 137
4: 1152
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476968_927476971 3 Left 927476968 2:23420878-23420900 CCAACCTTCAAAGCCGAGCATCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364
927476963_927476971 19 Left 927476963 2:23420862-23420884 CCCACCCAAATTATACCCAACCT 0: 1
1: 0
2: 0
3: 6
4: 162
Right 927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927476971 Original CRISPR TCACACCCTCCCAGAAGCCC TGG Intronic
900091329 1:922027-922049 CCACACCCAGCCAGAAACCCAGG + Intergenic
900200757 1:1404971-1404993 TCAAACCCTCCCATCAGACCTGG - Intronic
900881221 1:5382724-5382746 TCTCACTTTCCCAGAATCCCTGG + Intergenic
900926577 1:5709874-5709896 TCCCACACTCCCAGGAGCACCGG - Intergenic
901058942 1:6462824-6462846 ACACACGCACCCAGAAGCCTGGG - Intronic
901152599 1:7113862-7113884 TCTGACCCTCCCAGTAGCCTTGG - Intronic
902362444 1:15949594-15949616 TCTCACCTGCCCAGAAGCCGGGG - Intronic
902704537 1:18195519-18195541 TAACACCTTCCCAGATTCCCCGG + Intronic
903004172 1:20287702-20287724 TCACCCCCACCCACAGGCCCTGG + Intergenic
903326142 1:22569688-22569710 TCCCTCCCTCCCAGCTGCCCTGG + Intronic
903337878 1:22636889-22636911 TCTCACCCTCCCCCAAGCCCTGG - Intronic
905473028 1:38207323-38207345 TCGCTCCCTGCCAGAGGCCCAGG - Intergenic
905863840 1:41366384-41366406 TCACACCCACCCACGAGCGCTGG + Intronic
906408995 1:45564216-45564238 TCACAGCCTCGGAGAAGTCCAGG + Intronic
907838951 1:58137936-58137958 TCAGACCTTCCCATAATCCCTGG - Intronic
910432215 1:87169976-87169998 TCACATCCTCACAGAATCCTAGG - Intergenic
911317827 1:96376333-96376355 TCACACCCTCCCCCAAGCTCAGG - Intergenic
911852439 1:102836419-102836441 CCCCACCCTGCCACAAGCCCCGG - Intergenic
912708682 1:111934038-111934060 TCTCTCCCTCCCAAAGGCCCTGG + Intronic
912749211 1:112271684-112271706 TCATACCCACCCAGAACCTCTGG - Intergenic
915019364 1:152764815-152764837 TCACTCCCACCCAGAGGCCTGGG - Intronic
915089691 1:153415786-153415808 TCAGCCCCTCACAGAAGCCCTGG - Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915095818 1:153461354-153461376 TCAGCCCCTCACAGAAGCCCTGG + Intergenic
915658607 1:157382217-157382239 CCACACCCCCCAACAAGCCCTGG + Intergenic
916214269 1:162382512-162382534 TCTAACCCTCCCAGCAGCCCTGG + Intronic
916985354 1:170185386-170185408 TCACACCCTCTGACAGGCCCTGG + Intergenic
919612654 1:199764688-199764710 TCACACCCTGCAAGAAACTCAGG - Intergenic
919915103 1:202134196-202134218 TGCCTCCCTCCCAGCAGCCCTGG - Exonic
920499439 1:206477022-206477044 TCACAGACTCCCATCAGCCCTGG - Intronic
921093729 1:211868622-211868644 CCCCTCCCTACCAGAAGCCCAGG + Intergenic
921179992 1:212624696-212624718 TCAGAGCCTCCCAGAGGCCGGGG - Exonic
921266253 1:213423230-213423252 TCACAGCCTCCCAGCATCCAGGG - Intergenic
921742867 1:218706553-218706575 TCACTCCCTTCCAGAAGCTCTGG + Intergenic
924814095 1:247427458-247427480 GCACACTCTCACTGAAGCCCCGG + Intronic
1063162103 10:3425933-3425955 TCAGACCCTGCCAGGAGCCCAGG - Intergenic
1063486954 10:6429114-6429136 TCCCACCCTCCAAGGGGCCCTGG + Intronic
1066331174 10:34424974-34424996 TCACAGCCTCCTAGAAACCTGGG + Intronic
1066375741 10:34856502-34856524 TCACACCCTGCCAGAAGACAGGG - Intergenic
1067085649 10:43236919-43236941 TGAGACCCTCCCACAAGGCCAGG - Intronic
1067217778 10:44316804-44316826 TCAGCCCCTCCCACCAGCCCTGG + Intergenic
1067531311 10:47075881-47075903 TTTCAACATCCCAGAAGCCCGGG + Intergenic
1069325219 10:67224877-67224899 TCACACCCTCCCTCAAGTTCTGG - Intronic
1069553861 10:69383817-69383839 TCAAAGCCTCCTGGAAGCCCAGG + Intronic
1069931809 10:71887907-71887929 GCAGAGGCTCCCAGAAGCCCAGG - Intergenic
1071342334 10:84660465-84660487 ACTCACCCTCCCAGAGGGCCAGG - Intergenic
1071501641 10:86208316-86208338 TCACAGTCCCCCAGATGCCCTGG + Intronic
1071851332 10:89573407-89573429 TCTCACACTCACAGAAGCTCTGG + Intergenic
1072105866 10:92273134-92273156 TTACACACTCCCAGAATCCTAGG - Intronic
1072620407 10:97075531-97075553 TCCCATCCTCCCAGCATCCCTGG - Intronic
1073347887 10:102798404-102798426 TTGGGCCCTCCCAGAAGCCCAGG + Intronic
1076666361 10:132095213-132095235 TCACACCCTCCCCCAAGTTCTGG + Intergenic
1077227613 11:1445227-1445249 TCCCACCCTCGCAGCCGCCCAGG + Intronic
1077414632 11:2419084-2419106 TCACTCCCTCACAGAAGACAGGG - Intronic
1078315444 11:10289817-10289839 TCACACCCTCCCCGCAGCATTGG + Intronic
1079183434 11:18214700-18214722 TATCACCCTCCCCTAAGCCCAGG + Intronic
1080151783 11:29059549-29059571 GCTCAGCCTCCCAGAAGCGCTGG - Intergenic
1080382693 11:31790616-31790638 ACACGCCCTCCCATAAGACCAGG + Intronic
1081794425 11:45809808-45809830 TCCCATGCTCCCAGAAGCCAGGG - Intronic
1083747318 11:64743431-64743453 TCGCCCCCTCCCGGGAGCCCAGG + Intronic
1083936294 11:65871766-65871788 TCATCCTCTCCCAGAAACCCAGG - Intronic
1084161933 11:67354855-67354877 CCCCACCCTCCCAGTATCCCTGG - Intronic
1084647116 11:70464995-70465017 TCACCCCCTCCCACATCCCCAGG - Intergenic
1085122601 11:73976817-73976839 ACACACCTTTCCAGAGGCCCCGG + Exonic
1085301491 11:75461528-75461550 CCACAGCCTGTCAGAAGCCCAGG + Intronic
1085426368 11:76408460-76408482 TCCCATGCTCCCTGAAGCCCAGG + Intronic
1088130280 11:106480508-106480530 TCACGCCCTTCCAGGAGTCCTGG - Intergenic
1088625056 11:111723986-111724008 CCAGACTGTCCCAGAAGCCCAGG + Exonic
1089171620 11:116515724-116515746 TCACACCCACCCAGCACTCCTGG - Intergenic
1089780572 11:120870563-120870585 TCCCTCCCTCCGAGAAGCCTAGG - Intronic
1093372392 12:18380230-18380252 TCTCACCCTCCCAAATTCCCAGG + Intronic
1094449726 12:30571924-30571946 CCTCACCCTCCCAGGAGCACAGG + Intergenic
1095981629 12:47977717-47977739 CCAGCCCCTCTCAGAAGCCCAGG + Intronic
1096194599 12:49641910-49641932 TCACCTCCACGCAGAAGCCCCGG - Exonic
1096637732 12:52971765-52971787 TCACAACCACGCAGCAGCCCAGG + Intergenic
1099288127 12:80740368-80740390 TCCCACCCTCCAAAATGCCCCGG - Intergenic
1099516776 12:83606385-83606407 TTAAACCATCCCTGAAGCCCTGG - Intergenic
1100203658 12:92325740-92325762 TCACACCCTCCCCCAAGTTCTGG + Intergenic
1100983984 12:100187752-100187774 TGACACCCTCCCAGATCCTCAGG - Intergenic
1101090598 12:101280805-101280827 TCATACCCTCCCATAAGCATGGG - Intronic
1101675543 12:106913591-106913613 TCTCACCTGCCAAGAAGCCCCGG + Intergenic
1102678852 12:114676563-114676585 TCACACCCTGCCTGCTGCCCAGG + Intronic
1103853152 12:123946468-123946490 TTACTTCCTCCCGGAAGCCCTGG + Intronic
1104015673 12:124960150-124960172 TCACAGGAGCCCAGAAGCCCTGG + Intronic
1104814118 12:131636337-131636359 GCACACCCTCCCAGCCCCCCTGG - Intergenic
1104845911 12:131846745-131846767 TCACATCCACCCAGAATCTCAGG - Intronic
1105699090 13:22922425-22922447 ACACACATTCCCAGAAGCCAGGG + Intergenic
1105786989 13:23759553-23759575 TCACACCCTCCAGGAAGCAAGGG + Intronic
1105850835 13:24335272-24335294 ACACACATTCCCAGAAGCCAGGG + Intergenic
1106637985 13:31551640-31551662 CCACCCCCTGCCAGAAGCACAGG + Intergenic
1108098905 13:46934592-46934614 TACCACCCTCCCTGAACCCCAGG + Intergenic
1109021137 13:57094546-57094568 TCACTCCATTCCAGTAGCCCAGG - Intergenic
1109591176 13:64484620-64484642 TCCCACCCTCCAACAGGCCCTGG - Intergenic
1109693992 13:65929591-65929613 TCACATCCACCCAGAACCTCAGG - Intergenic
1111842090 13:93462403-93462425 TCACAGACCTCCAGAAGCCCTGG + Intronic
1112177381 13:97039990-97040012 GCACACCCTCCAACAGGCCCAGG + Intergenic
1112504241 13:99966021-99966043 TGACAGCCTCTCAGGAGCCCAGG - Intronic
1113140726 13:107146416-107146438 CGACACCCTCACAGATGCCCGGG - Intergenic
1113937476 13:114002012-114002034 GAACACCCTCCCGGCAGCCCAGG + Intronic
1116930819 14:50688804-50688826 TCACGCCCTCTCAAAACCCCAGG - Intergenic
1117317014 14:54581037-54581059 TCAGACCCTTACAGAAGACCTGG + Intronic
1118316762 14:64730468-64730490 TCCCATCCACCCAGCAGCCCTGG - Intronic
1119181933 14:72611167-72611189 ACACACCTTCCCCCAAGCCCAGG + Intergenic
1119605435 14:76012217-76012239 TCACACACTCTCAGAAGTCCTGG - Intronic
1119703880 14:76772363-76772385 TTACACCCTCTCCGAGGCCCTGG + Intronic
1119721748 14:76896408-76896430 TCTAATCATCCCAGAAGCCCTGG - Intergenic
1121530531 14:94649641-94649663 TCATCCCCTCACAGAGGCCCAGG - Intergenic
1121657563 14:95608562-95608584 TCTTCCCCTCCCCGAAGCCCTGG + Intergenic
1121674267 14:95739709-95739731 TGACACCCTGAGAGAAGCCCAGG + Intergenic
1121916500 14:97840635-97840657 TCATAGGCTCCCAGAAGTCCAGG - Intergenic
1122133648 14:99620399-99620421 GCACTCCCTGCAAGAAGCCCAGG - Intergenic
1122864499 14:104597370-104597392 TCACACCTTCCCAAAGACCCAGG + Intronic
1122894357 14:104748931-104748953 TCACCTCCTCCCAGTTGCCCAGG + Intergenic
1125508008 15:40278151-40278173 TCACACCCTGACAGGTGCCCTGG + Intergenic
1125732481 15:41900971-41900993 TGGCACCCTCCCCGTAGCCCTGG + Exonic
1126577439 15:50210640-50210662 TCACACCCTCCCTGGAGTTCTGG - Intronic
1128081735 15:64861080-64861102 TGCCACCCTCCCAGGACCCCTGG - Intronic
1128706666 15:69841880-69841902 TCAACCCCTAACAGAAGCCCAGG - Intergenic
1128806242 15:70533132-70533154 TCCCACCCTTCCTGAAGGCCAGG + Intergenic
1129367032 15:75062438-75062460 TCACGCCTTCCTGGAAGCCCAGG - Intronic
1130869074 15:87956036-87956058 ACACACCTTCCCAGTACCCCAGG - Intronic
1131168847 15:90162171-90162193 TCAAAACCTGCCACAAGCCCTGG + Intronic
1131970910 15:97891925-97891947 TCACAGCCTGCCTTAAGCCCTGG + Intergenic
1132011447 15:98280157-98280179 TCATTCCCTACCAGAAACCCAGG + Intergenic
1132044865 15:98555058-98555080 TCACATCCACCCAGATGCCTGGG - Intergenic
1132210882 15:100021210-100021232 GCACACCCACCCAGAACCACAGG - Intronic
1132405736 15:101541060-101541082 TCCCACACCCCCAGCAGCCCAGG - Intergenic
1132502874 16:292385-292407 TCACAGCCTGGCAGAAGCTCAGG + Intronic
1132642266 16:983288-983310 TCCCAGACACCCAGAAGCCCTGG - Intronic
1132806343 16:1776855-1776877 TCGCAGCCTCCCACAAGACCTGG + Exonic
1132987442 16:2775116-2775138 TCTCATCCTCTCAGTAGCCCTGG - Intronic
1133207509 16:4242163-4242185 TCACACCCTCCTAGTTGCCCTGG - Intergenic
1134081076 16:11325407-11325429 TCACACACACCCAAGAGCCCAGG - Intronic
1135635361 16:24071093-24071115 TCACATCCTCACATCAGCCCTGG - Intronic
1136376925 16:29871319-29871341 TGCCCCCCTCCCAGATGCCCTGG - Exonic
1137466069 16:48710953-48710975 TCAAACCCTCCCAGGGGCCAGGG + Intergenic
1138343704 16:56307244-56307266 TCCCTCCTTCCCAGAATCCCGGG + Intronic
1138454977 16:57115954-57115976 TCAAAGACTCCCAGAAGCCAGGG + Intronic
1138460572 16:57145460-57145482 TCCCACACTCCTGGAAGCCCTGG + Intronic
1139953686 16:70683665-70683687 TCAGGGCCTCCCAGAGGCCCAGG + Intronic
1140641513 16:76978659-76978681 TCCCACCCTCCAACAGGCCCCGG + Intergenic
1140863837 16:79042239-79042261 TTACACCCTCCCAAAAGCTGAGG + Intronic
1140995203 16:80252394-80252416 TCCCACCAACCCAGAAGACCTGG + Intergenic
1141187515 16:81798444-81798466 CCCCAGCCTCCCAGAAGCACTGG - Intronic
1141491115 16:84373647-84373669 TCACTCCCTCCCAGTACCCATGG - Intronic
1142358199 16:89613908-89613930 TCCCAGCCTCCTAGAATCCCAGG - Intronic
1142614248 17:1125569-1125591 TCCCCGCCTCCCAGCAGCCCCGG - Intronic
1142687186 17:1584244-1584266 TCACACCCACGCAGACACCCTGG + Intronic
1143618462 17:8067553-8067575 ACACCCCATCCCAGTAGCCCAGG - Intergenic
1145322293 17:21773634-21773656 TCAGTTCCTCCCAGATGCCCTGG + Intergenic
1145747857 17:27333212-27333234 CCAGCCCCTCCCAGACGCCCCGG + Intergenic
1145840543 17:27990492-27990514 TGAGACCTTCCCAGAAGCCAAGG + Intergenic
1146269995 17:31478625-31478647 TCCCTCCCTCCCTGGAGCCCTGG + Intronic
1147188761 17:38726728-38726750 TTACGCCCTCCCCCAAGCCCTGG - Exonic
1148325562 17:46781578-46781600 TCCCTCCCTTCCAGAACCCCTGG - Intronic
1148386585 17:47238617-47238639 CCACACCCTCCCCGCAGCCGCGG + Intergenic
1148432104 17:47650504-47650526 TCCCGCCCTCCCGGAGGCCCAGG + Intronic
1148457272 17:47817794-47817816 TCAGACCCTCCCAGGAAACCAGG - Intronic
1149597805 17:57874532-57874554 ACACACCCTCCCTGACCCCCAGG + Intronic
1150064381 17:62096654-62096676 GAACACTGTCCCAGAAGCCCAGG - Intergenic
1150287453 17:63962125-63962147 CCACCCCCTGCCAGAGGCCCAGG + Intronic
1151426308 17:74033039-74033061 CAACACCTTCCCAGAGGCCCAGG + Intergenic
1151544792 17:74786168-74786190 ACCCACCCTCCCTGAAGCACCGG - Intronic
1151783127 17:76260855-76260877 TCACACACTCCCTGAAGGCTCGG - Intergenic
1152031465 17:77845958-77845980 TGACACCTTCCCTGCAGCCCCGG - Intergenic
1152105225 17:78324760-78324782 GCACTTCCTCCCCGAAGCCCGGG - Intergenic
1152168825 17:78729528-78729550 TTACACTCTCCCAGCAGCACGGG - Intronic
1152559479 17:81070780-81070802 TCACACACTCCCAGCGTCCCAGG - Intronic
1152923370 17:83076917-83076939 GCAGACCCTCCCAGAGGACCAGG + Intergenic
1155041555 18:22069370-22069392 TCCGACCCTCCCAACAGCCCAGG - Intergenic
1156155760 18:34300367-34300389 TTGCACCCTTCCACAAGCCCAGG + Intergenic
1156253886 18:35377122-35377144 TTACACCGTCCCAGATCCCCAGG - Intronic
1157332889 18:46716413-46716435 ACACTCCATCCCAGAAGCCCAGG + Intronic
1157700614 18:49759745-49759767 TCACATGCTCCGAGAAGGCCTGG - Intergenic
1157801185 18:50622540-50622562 TGACAGCCTCCCAGCAGCCAGGG + Intronic
1158403162 18:57139363-57139385 TCCCAAGCTCCCTGAAGCCCAGG - Intergenic
1159536096 18:69717140-69717162 TCACACCCTTCCTGCAGCACAGG + Intronic
1159906480 18:74097234-74097256 TCACACCCTCCCCCAAGTTCTGG - Intronic
1160225783 18:77009709-77009731 TCACGGCCTCACAGATGCCCCGG + Intronic
1160475868 18:79187268-79187290 TTTCACCCTCACAGTAGCCCAGG + Intronic
1160505434 18:79423877-79423899 TCCAACCCTCCCTGAAGCCAAGG - Intronic
1160700060 19:501836-501858 ACACACACCCCCAGGAGCCCAGG + Exonic
1161376737 19:3943118-3943140 TCAGACCCTCCCTGTGGCCCTGG - Intergenic
1161398913 19:4059090-4059112 TCACACGCTCCCCGCGGCCCAGG - Intronic
1161486720 19:4539794-4539816 ACACACCCCTACAGAAGCCCAGG - Intronic
1161632706 19:5366794-5366816 TCATACCCTCCCTGGAGACCTGG - Intergenic
1162035675 19:7937424-7937446 TCACACCCTCCCAAACTGCCAGG - Intronic
1162490396 19:10987861-10987883 TCACCCCCATCCAGAAGCCGCGG + Exonic
1162732015 19:12723998-12724020 CCCCACCCTCCGATAAGCCCTGG + Intronic
1162793256 19:13073813-13073835 GAACAGCTTCCCAGAAGCCCAGG - Intronic
1162937222 19:13987227-13987249 TCAGACTCTCCCAGAACCCAAGG - Intronic
1163118436 19:15201279-15201301 ACACAGCCTCCCAGAAACTCTGG + Intergenic
1165096929 19:33414497-33414519 TCACCCCCTCCCTGAGGCCTCGG + Intronic
1165869177 19:38958610-38958632 ACACACTCTCCCAAAAACCCTGG - Intronic
1166604320 19:44127026-44127048 TCACACCCTCCCCCAAGTTCTGG + Intronic
1167389213 19:49182904-49182926 TTACGCTCTCCCCGAAGCCCTGG - Exonic
1167679417 19:50909955-50909977 TGACTCCGCCCCAGAAGCCCTGG - Intronic
1168386258 19:55965809-55965831 CCCCACCCCCCCAGAGGCCCCGG + Intronic
925141685 2:1554868-1554890 TTACACCCTCCCCTGAGCCCTGG + Intergenic
926451140 2:13005790-13005812 TCACGCCCTTCCAGAAACACTGG + Intergenic
927402091 2:22723065-22723087 TCACAGTCTCTCAGAAACCCAGG - Intergenic
927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG + Intronic
927929232 2:27033443-27033465 ACACACTCTCCCAGCTGCCCAGG + Intronic
927946290 2:27137154-27137176 TCACTACCTCCCTGAAGCCCAGG - Exonic
930301462 2:49621147-49621169 TCACTCCCTCTCAGAATCCCAGG + Intergenic
932297224 2:70636342-70636364 TCCCACCCTCTCAGAAGACTGGG + Intronic
933395333 2:81723921-81723943 TCACAATCTCCCTTAAGCCCTGG - Intergenic
933764144 2:85695632-85695654 TCTCACCCTCCAAGGAGCCTGGG + Intronic
935375878 2:102397072-102397094 TCACGTGCTCCCAGAAGACCTGG + Exonic
935673167 2:105572552-105572574 TCAGACCCACCCACAAGCCAAGG - Intergenic
935722171 2:105989387-105989409 ACACTCCCTCCCAGAAACCCAGG - Intergenic
936037977 2:109128250-109128272 TCTGACGCTCCCAGAAGCCGGGG + Intergenic
936073244 2:109385015-109385037 TCACACCCTCCCTGCATGCCTGG + Intronic
937264355 2:120606700-120606722 TCACCCCCTCCCTCATGCCCTGG - Intergenic
937916317 2:127100755-127100777 TGGCAGCCTCTCAGAAGCCCGGG + Intronic
939133570 2:138267270-138267292 TCACAAGGTCCCAGAAGCCTGGG - Intergenic
941510887 2:166407875-166407897 CCCCACCCTCCAACAAGCCCTGG + Intronic
944612878 2:201429523-201429545 TCACACAGTCCCATATGCCCTGG + Intronic
946308578 2:218870427-218870449 TCACACCCTCTCCATAGCCCAGG - Intronic
947270267 2:228326835-228326857 TCACACCCTCCCCTAAGTTCTGG - Intergenic
948025068 2:234770239-234770261 CCACAGCCTCCCTGAGGCCCTGG + Intergenic
948243886 2:236462064-236462086 TGAGACCCTAGCAGAAGCCCTGG + Intronic
948624005 2:239256487-239256509 CCAGCCCCTCCCAGAAGGCCAGG + Intronic
948692856 2:239717873-239717895 TCACTGCCTCCCAGAGGCGCAGG + Intergenic
948802311 2:240438459-240438481 GCAGATCCTCCCAGGAGCCCTGG + Intronic
948873879 2:240817462-240817484 TCACAGCCACCCAGAGACCCAGG + Intronic
1168808110 20:684763-684785 TCAACCCCTCTCAGCAGCCCCGG + Intergenic
1168814384 20:726973-726995 TCACAGGTTCCCAGGAGCCCAGG + Intergenic
1169084840 20:2820443-2820465 ACACATCCACCCAGCAGCCCAGG - Intergenic
1169500076 20:6151109-6151131 TCACTCACTCCCTCAAGCCCAGG + Intergenic
1169781348 20:9314052-9314074 TCATGCCCTTGCAGAAGCCCTGG - Intronic
1170766078 20:19291095-19291117 TCCCACCCACTCAGAAGCCAGGG + Intronic
1171513116 20:25703869-25703891 ACACAACGTACCAGAAGCCCTGG - Intergenic
1171571855 20:26259881-26259903 CCACACCCTCCAACAGGCCCTGG + Intergenic
1172898623 20:38317984-38318006 GCCCATGCTCCCAGAAGCCCAGG + Intronic
1172941822 20:38659400-38659422 TCCCACCCTCTCAGCAGCCCTGG - Intergenic
1173618490 20:44418535-44418557 GCATACCCTCCCTGGAGCCCTGG - Intronic
1174006722 20:47416782-47416804 TCACACCCTCCCACCAGCACTGG + Intergenic
1174427305 20:50440917-50440939 TCACACCTTTCCAGGAGCACTGG - Intergenic
1174806535 20:53608531-53608553 CCACACCCTCCCACAGGGCCCGG + Intronic
1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG + Intergenic
1175908198 20:62392129-62392151 CCAGACCCTCGCAGCAGCCCAGG - Intronic
1176906405 21:14506865-14506887 TTAAACCCTCCCAGCATCCCTGG - Intronic
1178985399 21:37298729-37298751 TCAAGGCCTCCCTGAAGCCCAGG - Intergenic
1179308591 21:40176857-40176879 TCTCTCCCTGCCAGAAGGCCAGG - Intronic
1179781308 21:43702620-43702642 TCAGCCCCTGCCAGAAGCCCGGG - Intergenic
1181590883 22:23884147-23884169 CCATTCCCTCCCAGAAGCCCCGG - Intronic
1182895649 22:33857165-33857187 TCTCAGCCTCCCAGAAGTGCTGG + Intronic
1183347248 22:37314729-37314751 TCACCCCCTCACACAGGCCCAGG + Exonic
1183505961 22:38208982-38209004 ACCCACCCTCCCAGCACCCCAGG - Intronic
1184116811 22:42427053-42427075 TCAGACCTTACCAGGAGCCCAGG + Intronic
1184348365 22:43926498-43926520 TCTCCCACTTCCAGAAGCCCAGG - Intronic
1184553152 22:45216317-45216339 TGCCACCCTCCCAGAATCCAAGG + Intronic
1184727180 22:46353959-46353981 TCACAGCCTCCAGGAAGCCACGG - Intronic
1185012467 22:48322166-48322188 ACTCACCCTCCCAGACACCCAGG - Intergenic
1185012561 22:48322502-48322524 TCACAGGCACCCAGACGCCCAGG - Intergenic
1185102677 22:48850113-48850135 CCACACCCTCCCCAGAGCCCAGG - Intronic
1185367882 22:50445344-50445366 GCTCCCCCTCCCAGAAGCCTGGG + Exonic
949846681 3:8378172-8378194 TAACACCCTCACAGACACCCAGG - Intergenic
950114030 3:10438925-10438947 TCTCTAGCTCCCAGAAGCCCAGG - Intronic
950435366 3:12976215-12976237 TCACTCCCTTCCAGAGGGCCAGG - Intronic
951887458 3:27538367-27538389 ACTCACCATCCCAGAAGCCTGGG - Intergenic
952213959 3:31257013-31257035 TCACACACTCCTAGAATACCAGG - Intergenic
952969389 3:38641356-38641378 ACACACCCACCCTGAAGCCAGGG + Intronic
954441487 3:50524700-50524722 CCACACCCTCCAAGAAACTCAGG + Intergenic
954695095 3:52419918-52419940 TCTAACCTTCCTAGAAGCCCGGG - Exonic
955110092 3:55940375-55940397 TCTCACCCACTCAGAAGCTCAGG + Intronic
956772044 3:72535047-72535069 TCAGACCCTCCCAGGGGCCTGGG - Intergenic
956886338 3:73564006-73564028 TCACAGCAGCCCAGAAGCCCAGG - Intronic
958136731 3:89503634-89503656 TACCACCCTCCAAGAGGCCCCGG - Intergenic
960516492 3:118607985-118608007 TCACACCCTTCCCCAAGTCCTGG - Intergenic
961518083 3:127450907-127450929 GCACACCGGCCCAGAGGCCCAGG + Intergenic
961771092 3:129250457-129250479 TCACAATCTCCCAGCAGCCCTGG - Intronic
962101119 3:132343881-132343903 TCTCAGCCTCCCAGAAGTGCTGG - Intronic
962668795 3:137684117-137684139 TCACACTCTGCCAGCAGCACAGG + Intergenic
964197339 3:154079977-154079999 TCACCTCCTCCAAGAAGTCCTGG + Intergenic
965597815 3:170425238-170425260 TCACATTCTCACAGAAGCCCCGG + Intronic
966747076 3:183287442-183287464 TGACATTCTCCCAGAAGTCCAGG + Intronic
966962134 3:184950721-184950743 TCCCACCCTCCAACAGGCCCTGG + Intronic
968130278 3:196189079-196189101 TCGGGCCCTCCCAGCAGCCCAGG - Intergenic
968500666 4:948354-948376 TCCCACCCTCCCAGGAGGCCAGG - Intronic
968909325 4:3469540-3469562 CCACACCCTCCCAGGAGGCCTGG - Intronic
969396812 4:6927103-6927125 CCACAGCCTCCCAGAAGCGCAGG + Intronic
969604597 4:8196236-8196258 TCACTTCCTCCAAGTAGCCCTGG - Intronic
969612120 4:8233203-8233225 CCCCACCCTCTCAGCAGCCCGGG + Intronic
970159613 4:13175708-13175730 TCACACCTTCCCTGACTCCCAGG + Intergenic
971455703 4:26841659-26841681 TCAGACTCTCCCAGATGCTCTGG - Intergenic
972825486 4:42754287-42754309 TCCCACACTCCCAACAGCCCTGG + Intergenic
974096383 4:57369165-57369187 AAACTCCCTCCCAGGAGCCCAGG - Intergenic
975033752 4:69656877-69656899 TCACACCCTCCTTGAAGTACTGG - Intergenic
976325081 4:83762168-83762190 TCACACCTTGCCAGGAGTCCAGG - Intergenic
976325202 4:83763293-83763315 TGATACTCTCCCAGAAGCCAAGG - Intergenic
984438640 4:179736852-179736874 TCCCACCCCACCACAAGCCCCGG + Intergenic
985530972 5:433682-433704 TCTAACCCCCCCAGCAGCCCAGG - Intronic
985609998 5:882150-882172 CCACATTCTCCAAGAAGCCCTGG - Intronic
985717351 5:1470134-1470156 TCACACCCTGTGAGAAGCCTTGG + Intronic
985752155 5:1686819-1686841 CCACACCCTCCCTGATGCTCAGG + Intergenic
986045597 5:4034517-4034539 TCCCAGTCTCCCAGAAGCCCTGG - Intergenic
987303658 5:16618025-16618047 CCACACTCACCCAGAAGCACCGG - Intergenic
987379396 5:17270893-17270915 GCACACCCACCCAGAATCCTTGG - Intronic
988362680 5:30255754-30255776 TCACACAGGCCCAGAAGCCTGGG - Intergenic
991445870 5:66699319-66699341 GCACACCCTCCCCCAAGCCCTGG + Intronic
992039577 5:72816724-72816746 CCACACCATCCCAGACGCCTCGG - Exonic
993622039 5:90179881-90179903 CCACACCCCCCAAGAGGCCCTGG - Intergenic
997630435 5:135364227-135364249 CCACACCCTCCCACAGGCCCTGG - Intronic
999475997 5:151899483-151899505 CCACCTCTTCCCAGAAGCCCAGG - Intronic
1000151185 5:158502795-158502817 TCACCACCTCCCAGCAGTCCTGG + Intergenic
1001031476 5:168266432-168266454 TCACACCAGGCCAGAAGCCGGGG + Intergenic
1001573768 5:172748517-172748539 TCAGTGCCTCCCAGCAGCCCCGG + Intergenic
1002536851 5:179880482-179880504 TCACACCCTCCCACTGGCTCTGG + Intronic
1002556562 5:180046232-180046254 TCACACCCACGCAGAACTCCAGG + Intronic
1002863670 6:1102256-1102278 TTACAGCCTCCCTGATGCCCTGG + Intergenic
1003431030 6:6037657-6037679 TCACACCCCCCAACAGGCCCTGG + Intergenic
1003711980 6:8602684-8602706 TCACACCCTCCCTGGAGTTCTGG + Intergenic
1003868034 6:10381366-10381388 TTCCACCCTCCCCAAAGCCCAGG + Intergenic
1004617260 6:17302369-17302391 TCACAACCTCACAGCAGGCCTGG + Intergenic
1005517513 6:26569141-26569163 TCCAACCCTCTTAGAAGCCCTGG + Intergenic
1006442081 6:34059214-34059236 TCCCTCACCCCCAGAAGCCCAGG + Intronic
1006582032 6:35082826-35082848 TCCCACCCTCCCAGCAGGGCCGG + Intronic
1006981449 6:38151354-38151376 TCTTTCCCTCCCAGAAGCGCAGG - Intronic
1007499044 6:42281275-42281297 TCACACTCTCCCTGCAGCCCAGG - Intronic
1007727215 6:43923792-43923814 TCACACCCACCCGGCTGCCCAGG - Intergenic
1007867185 6:44985086-44985108 TCACAGCCTCCCAGAACACGAGG - Intronic
1007926000 6:45650312-45650334 ACACACCCTCTGAGAGGCCCAGG - Intronic
1008135657 6:47773840-47773862 GCAAACCCAGCCAGAAGCCCAGG + Intergenic
1008308318 6:49933655-49933677 CCACACCTTCCCGCAAGCCCAGG - Intergenic
1010076426 6:71803700-71803722 TCACACCCTCCCCAAAGTTCTGG + Intergenic
1012127769 6:95452930-95452952 TCTCACCCTCCAACAGGCCCTGG + Intergenic
1013010165 6:106113230-106113252 TCAGACCCTTCCAGAAGCCCTGG - Intergenic
1017705875 6:157122583-157122605 TCATACCCTCACACAAGCTCTGG + Intronic
1019303490 7:321515-321537 TCCCACCCTCCCTGCAGGCCTGG - Intergenic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1021591540 7:22268955-22268977 TCTCACCCTCCCAAGTGCCCCGG - Intronic
1021846308 7:24766457-24766479 TCACACCCACCGACAGGCCCCGG + Intergenic
1023877572 7:44295666-44295688 CCTCCCCCTGCCAGAAGCCCTGG - Intronic
1024885260 7:54134905-54134927 CCCCACCCTCCCATAGGCCCCGG + Intergenic
1025004363 7:55343237-55343259 TCTGAGCCTCCCCGAAGCCCAGG - Intergenic
1025246504 7:57321576-57321598 TCACACCTTTCCAGGAGCACTGG + Intergenic
1026447183 7:70495156-70495178 TCACTCTCTCCCAGGTGCCCTGG - Intronic
1026847842 7:73707565-73707587 TCCCTCGCTCCCAGAAGCCCAGG + Intronic
1027190330 7:75992642-75992664 CGAAACCCTCCCAGCAGCCCTGG - Intronic
1028273932 7:88827766-88827788 ACACACCCTGCCAGAAGCGTAGG + Intronic
1028856728 7:95601402-95601424 TCACCTCCTCCCAGCAGCACAGG - Intergenic
1030376547 7:108758976-108758998 ACACAGCATCCCAGAATCCCTGG + Intergenic
1032015617 7:128378774-128378796 TCACCCCCTCCCAGTGGCCCTGG + Intergenic
1033448526 7:141442225-141442247 ACACACCCTCCCACACTCCCTGG + Intronic
1034280202 7:149848226-149848248 TCAAATCCTCCCAGAGGCCCTGG - Exonic
1034411546 7:150944936-150944958 TTACACCCTCCCAGCACCACTGG + Intergenic
1035106118 7:156442737-156442759 TCACAGCCTTCCAGAACGCCTGG + Intergenic
1035436399 7:158863389-158863411 CCCCACCCACCCAGAAGCCCAGG + Intronic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036093108 8:5690900-5690922 TCCCACCCCCCAACAAGCCCCGG + Intergenic
1038963764 8:32549065-32549087 CCGCACCCTCCCAGAGTCCCGGG + Intronic
1039383377 8:37106927-37106949 GCAGACCCTCCCAGGTGCCCAGG - Intergenic
1040532113 8:48274504-48274526 CCTCGCCCTCCCTGAAGCCCTGG + Intergenic
1041521695 8:58764018-58764040 TTGCACCCCCCCAGATGCCCTGG + Intergenic
1042317109 8:67435981-67436003 TTACGCCCTCCCCCAAGCCCTGG - Intronic
1043040733 8:75259338-75259360 TCACACCCTCCCCCAAGTTCTGG - Intergenic
1047903635 8:129449869-129449891 TCACACAGTCCCTGAAGCCTGGG - Intergenic
1048295632 8:133211681-133211703 TCCCAGCCCCACAGAAGCCCTGG + Intronic
1048809351 8:138271089-138271111 TCACATCATCCAAGAAGCCCTGG - Intronic
1049236139 8:141513329-141513351 CCACACCCTCTGAGCAGCCCAGG - Intergenic
1049271279 8:141697549-141697571 TCACTCCAGCCCAGCAGCCCAGG - Intergenic
1049793488 8:144484409-144484431 TCACACCTTTCTAGAAGCCAGGG - Intronic
1050388643 9:5114070-5114092 TCACCCTCACCCAGAAGCGCTGG + Intronic
1052093922 9:24362060-24362082 TCACCCCCTCCCCCAAACCCAGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056411659 9:86334271-86334293 TCTCATCCTGCCAGAAGCACTGG + Intronic
1057026312 9:91736434-91736456 CCACACTCTCCCAGGAGCGCAGG + Intronic
1058918362 9:109589110-109589132 TCACTCCCCCCCTCAAGCCCTGG - Intergenic
1059442001 9:114313212-114313234 TCCCACCCTCCCCCAACCCCTGG + Intergenic
1060302883 9:122386042-122386064 CCTCAGCCTCCCAAAAGCCCTGG - Intronic
1060724102 9:125995976-125995998 ACTCTCCCTCCGAGAAGCCCTGG + Intergenic
1061133220 9:128719849-128719871 CCACCCCCACCCAGAGGCCCAGG - Intronic
1061138903 9:128752635-128752657 TGACACCCTACCAGTAGCCATGG + Intronic
1061195171 9:129103460-129103482 TCACACCACCCCAGGGGCCCGGG - Intronic
1061227897 9:129291338-129291360 TCACACCTTTCCACAGGCCCTGG - Intergenic
1061665823 9:132160859-132160881 GGAAACTCTCCCAGAAGCCCTGG + Intergenic
1061900463 9:133669570-133669592 CCAAACTCTCCCAGTAGCCCAGG + Intronic
1062096926 9:134708314-134708336 ACACTGCCTCCGAGAAGCCCTGG - Intronic
1062124080 9:134849911-134849933 TCACACCTTCCAGGAAGCACAGG + Intergenic
1062124287 9:134850824-134850846 TCACACCTTCCAGGAAGCACAGG + Intergenic
1062318252 9:135978517-135978539 TCAATCCCCCCCAGCAGCCCTGG + Intergenic
1062351933 9:136143627-136143649 CCTCACCCTCCCGGAAGCACAGG - Intergenic
1062568226 9:137172642-137172664 CCAGACCCTCCCAGAAGCAGTGG - Intergenic
1062580393 9:137226870-137226892 CCACCTCCTCCCGGAAGCCCAGG - Intergenic
1062606493 9:137350946-137350968 CCACACCTTCCCAGCGGCCCTGG - Intronic
1202777433 9_KI270717v1_random:3576-3598 TCCCACCCCCCGACAAGCCCCGG + Intergenic
1185663742 X:1747705-1747727 TCACTTCCTCCCAGAAGCCTGGG + Intergenic
1185779272 X:2830369-2830391 TCACCCCCTCCCAGCAGCTGAGG - Intronic
1190632180 X:52398843-52398865 TCACACCCTCCCCCAAGTTCTGG + Intergenic
1191138565 X:57092527-57092549 TCACACCCTCCCCCAAGTTCTGG - Intergenic
1191779924 X:64854272-64854294 TCACACCCTCCCCCAAGTTCTGG + Intergenic
1194237151 X:91398931-91398953 TCACGCCCTCCCACAAGTTCTGG - Intergenic
1194521355 X:94922060-94922082 TCACACCCTCCAGCAGGCCCTGG - Intergenic
1195419548 X:104658452-104658474 TCCCACCCCACCAGAAGCCCTGG - Intronic
1196290142 X:113930126-113930148 CACCACCCTCCCCGAAGCCCAGG - Intergenic
1197098696 X:122625768-122625790 TTACATCCTCCAAGAAGCCCTGG - Intergenic
1197151789 X:123228358-123228380 TGAGGCCCTCCCAGAAACCCTGG - Intronic
1198275927 X:135096801-135096823 TCCCCCCCTCCCCGAAGCCTCGG + Intergenic
1200056278 X:153463083-153463105 TATCACCCTGCCAGCAGCCCTGG + Intronic
1200127271 X:153821787-153821809 TCCTTCCCTCCCCGAAGCCCAGG + Intronic
1201290775 Y:12420120-12420142 TCACCCCCTCCCAGCAGCTGAGG + Intergenic
1202036142 Y:20638430-20638452 ACACAACCTCTCAAAAGCCCTGG - Intergenic