ID: 927477209

View in Genome Browser
Species Human (GRCh38)
Location 2:23423138-23423160
Sequence CCTGGGAAGTTCCTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927477191_927477209 26 Left 927477191 2:23423089-23423111 CCGCAGGCCTCAGCGTGGACAGT 0: 1
1: 0
2: 1
3: 32
4: 180
Right 927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 234
927477204_927477209 -10 Left 927477204 2:23423125-23423147 CCCGCAGGTGGTCCCTGGGAAGT 0: 1
1: 0
2: 0
3: 20
4: 192
Right 927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 234
927477195_927477209 19 Left 927477195 2:23423096-23423118 CCTCAGCGTGGACAGTGGGGTTG 0: 1
1: 1
2: 0
3: 15
4: 137
Right 927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 234
927477203_927477209 -9 Left 927477203 2:23423124-23423146 CCCCGCAGGTGGTCCCTGGGAAG 0: 1
1: 0
2: 1
3: 14
4: 160
Right 927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927477209 Original CRISPR CCTGGGAAGTTCCTGGTCAC AGG Intronic
900270547 1:1785094-1785116 CCTGGGAAGCTCCACCTCACAGG - Intergenic
900983982 1:6062588-6062610 CCTGGGAAGAACATGGTCAGTGG + Intronic
901858836 1:12061705-12061727 GCTGGGAAGTTCCTGGTGGGAGG + Intergenic
902893633 1:19463571-19463593 CCTGGGCAGTTCCAGCTCACAGG - Intronic
904171185 1:28592947-28592969 CCAGGGATGTTCCTGGTCTCTGG - Intronic
905251223 1:36649919-36649941 CCTGGGAAGTTAGTGGCCACTGG - Intergenic
905734537 1:40316548-40316570 CCTGGGGAGGTCGTGGGCACCGG - Intronic
907701221 1:56789966-56789988 CCTGGAAAATTCCAGGACACAGG - Intronic
909189924 1:72538960-72538982 CCTGGGGAGTTCCTGCACACAGG + Intergenic
909760312 1:79277868-79277890 GCTGGGGAGTTCCAGGTCATAGG - Intergenic
909898494 1:81104210-81104232 ACTGTGAACTTCTTGGTCACAGG - Intergenic
912207469 1:107524300-107524322 CCTGGGAAGTCCCTGTCCTCAGG + Intergenic
912597872 1:110897376-110897398 CCAGGGCAGTTGCTGGTCAGTGG - Intronic
915147019 1:153801343-153801365 CCTGGGAAGTCCCTGGCCTCAGG + Intergenic
915476384 1:156155107-156155129 CCTGGCGAGCTCCGGGTCACCGG - Intronic
915723127 1:157998647-157998669 CTTGGGGAGATCCTGGTCTCAGG - Intronic
918545898 1:185683604-185683626 CCTGAGAAGTTCAAGGTCAAGGG + Intergenic
920504326 1:206506048-206506070 GCTGGGAATTCCCTGGCCACTGG + Intergenic
923318814 1:232807978-232808000 CCTGGGATGTTTGTGGTGACTGG - Exonic
923870993 1:237994083-237994105 CCTGGGAAATTACTGTTCCCTGG - Intergenic
1062935193 10:1380289-1380311 CCTGCTAAGTTCCAGGGCACTGG + Intronic
1063381169 10:5587249-5587271 CCTGAGAAGGGCCTGGGCACGGG + Intergenic
1063995109 10:11611604-11611626 CCGGGGAACTTCCTGGTTCCCGG - Intronic
1067055635 10:43048344-43048366 CCTGGGCAGCTGCTGGGCACAGG + Intergenic
1067222891 10:44356760-44356782 CCTGGGAAGTCACTGGGCTCAGG + Intergenic
1069566206 10:69465017-69465039 CCTGGGAGGGACCGGGTCACAGG + Intronic
1069997530 10:72351906-72351928 CCTGGTTTCTTCCTGGTCACAGG + Intronic
1070106591 10:73438226-73438248 CCTGGGAAGTAGTGGGTCACTGG + Exonic
1072476676 10:95768054-95768076 GCTGGGAAGTTCCAGATCAAGGG - Intronic
1072743454 10:97923971-97923993 CCTGGGAGGCCCCTGGTCCCAGG + Intronic
1075217343 10:120547783-120547805 AGTGGGAAGTTCCTAGGCACTGG + Intronic
1076048681 10:127315064-127315086 CCTGGGAGGCTCCTCGTCATAGG + Intronic
1076734642 10:132453198-132453220 CCTGGGAAGTCCCCGCGCACGGG - Intergenic
1077179150 11:1204417-1204439 CCTGGGAGGCTCCTGGCCATGGG + Intergenic
1083778560 11:64906487-64906509 ACTGGGAAGGTCCAGGTGACTGG + Exonic
1085360689 11:75882669-75882691 CTTGGGAAGATGCTGGTCAAAGG - Intronic
1085457462 11:76673077-76673099 CGTGTGAAGTTCCTGGTCGCGGG + Intergenic
1086576394 11:88342977-88342999 GCTAGGAAGTTCATGGTCAGGGG + Intergenic
1086776031 11:90833889-90833911 CCTGGGAAGTCCAAGGTCAAAGG - Intergenic
1089145559 11:116327406-116327428 CTGGGCAAGTTCCTGATCACTGG - Intergenic
1089190369 11:116649094-116649116 CCAGGGATGTTCTTGGCCACAGG - Intergenic
1089705199 11:120272684-120272706 CCTGTTAACTTCCTGGTCCCAGG + Intronic
1089899580 11:121966724-121966746 GCTGGGAAGGTCCTAGTCAGAGG - Intergenic
1090664326 11:128905074-128905096 CCTGGGAGGATCCTGTCCACCGG + Intronic
1090677101 11:129008566-129008588 CCTGGAAAGTTCCATGTCTCAGG - Intronic
1092124372 12:6065255-6065277 CCAGGGGAGTGCCTTGTCACAGG - Exonic
1094157783 12:27355610-27355632 CCTGGGAAGTTGCTGGCCTTGGG + Intronic
1096427992 12:51520624-51520646 CCTGGGAACTTGCTGGTACCAGG - Intergenic
1098311237 12:69151272-69151294 CCTGGGAGGTTCGTAGTCTCAGG - Intergenic
1098889702 12:75996962-75996984 CATGGGAAATTCCTGGTGAAAGG + Intergenic
1101519137 12:105465552-105465574 CCTGGGAAGTTTCTGGGAAGAGG + Intergenic
1102490227 12:113286115-113286137 CCTGGGGAGTTCCTGGGCTGTGG - Intronic
1103242860 12:119429397-119429419 CTTGGGATGTTCCAGGTCTCAGG - Intronic
1104014735 12:124954181-124954203 CCTGGTGAGCTCCTCGTCACTGG + Exonic
1104811818 12:131624004-131624026 CCTGGGAGGGCCCTGGACACAGG - Intergenic
1106510677 13:30409700-30409722 CCCGGGAAGTTCCTAGGAACTGG + Intergenic
1107469547 13:40679460-40679482 CCTGGGAGCAGCCTGGTCACTGG - Intergenic
1107611002 13:42112892-42112914 GCTGGGAAATTTCTGGACACGGG - Intronic
1107959824 13:45547970-45547992 ATTGGGAAGTTCCTGCTCAGGGG + Intronic
1110869347 13:80432245-80432267 CCTGGGAAGTTGCTTCTCCCTGG + Intergenic
1111494316 13:89028196-89028218 CCTGGGCTGTTCTTGGTTACTGG + Intergenic
1112035913 13:95496561-95496583 GCTGGGAAGTTCACGGTCAAGGG + Intronic
1114359784 14:21959007-21959029 CCAGGGCACTTCCTGGTGACTGG - Intergenic
1116961226 14:50970282-50970304 CGTGTGAATCTCCTGGTCACTGG + Intergenic
1117452974 14:55869579-55869601 CCTGTGGGTTTCCTGGTCACAGG - Intergenic
1117830516 14:59745223-59745245 GCTGGGAAGTCCCAGGTCAAAGG - Intronic
1118502924 14:66380026-66380048 CCTGGGAAGTTCCTGGGTTCTGG + Intergenic
1118873138 14:69760049-69760071 GCTGGGCCTTTCCTGGTCACTGG + Intronic
1119781087 14:77277333-77277355 CCTGGGAAGTTCCTGGACCCAGG + Exonic
1122099233 14:99394174-99394196 CCAGCGAAGATGCTGGTCACTGG - Intergenic
1122623909 14:103074571-103074593 CCTGGAGAGTGCCTGCTCACAGG + Intergenic
1122946564 14:105013534-105013556 CCTGGGTATACCCTGGTCACAGG - Intronic
1124053933 15:26224473-26224495 TCCTGGCAGTTCCTGGTCACAGG - Intergenic
1124187696 15:27544404-27544426 TCTGGGAAGTCCCTGGACATGGG - Intergenic
1126986570 15:54317864-54317886 GTTGGGAAGATCCTGGTCAAAGG - Intronic
1127821466 15:62659959-62659981 CCTGGGCTGTCCCTGGTGACTGG + Intronic
1132497457 16:270644-270666 CCTAGGCAGTTCCTGGCCCCCGG - Exonic
1135959450 16:26983646-26983668 CATGGGAAGCTCCTGGCCCCTGG - Intergenic
1137744695 16:50812215-50812237 CATGGGAAGTCCGTGTTCACGGG + Intergenic
1137991156 16:53157155-53157177 TCTGGGAAGTTCATGTGCACAGG - Exonic
1138723563 16:59110651-59110673 CCTGGGAAGTTGCTTCTCTCTGG + Intergenic
1142480742 17:216703-216725 CCTGGGAAGTCACTGGTCCAGGG + Intronic
1142644228 17:1301686-1301708 CCTGGGAGGCTCCTGGTTGCTGG - Intergenic
1143137345 17:4719279-4719301 GCTGGGAGATACCTGGTCACTGG - Exonic
1143683044 17:8491886-8491908 CCTGGGAAGAACCAGGTCAGAGG + Intronic
1144142695 17:12364964-12364986 CCAGGGAAGTCCCTGGAAACTGG - Intergenic
1145227542 17:21142708-21142730 CCTGGGGGCTTCCAGGTCACAGG + Intronic
1146030704 17:29363809-29363831 GCTGGGAAGTCCCAGATCACAGG + Intergenic
1147552492 17:41454003-41454025 GCAGGGATGTTCCTGGTCCCTGG + Intergenic
1147631987 17:41938180-41938202 CCTGGGAAATCACTGGGCACTGG + Intronic
1147633241 17:41946210-41946232 CCTGGGAAGTTGCTTCTCCCTGG + Intronic
1149494723 17:57109949-57109971 TTTGGGAAGTTCTTGGTTACTGG + Intronic
1151835427 17:76579830-76579852 GCTGGGAAGTCCCAGGTCATAGG - Intronic
1151934949 17:77255783-77255805 CTGGGAAAGTCCCTGGTCACAGG - Intergenic
1152604291 17:81281321-81281343 CCTGGGACCTTCCTGTTCCCTGG - Intronic
1153016256 18:584864-584886 CCTGAGAAGGGCCTGGTAACTGG - Intergenic
1153573261 18:6494897-6494919 CCTGGGAAGTTGCTTCTCCCTGG + Intergenic
1153733751 18:8043299-8043321 CCTGGGAGCTTCTTAGTCACTGG + Intronic
1153989194 18:10380379-10380401 CCTGGGTAACTCCTGGTAACAGG - Intergenic
1155910607 18:31500324-31500346 GCAGTGCAGTTCCTGGTCACAGG - Intronic
1157105615 18:44771766-44771788 CGTGGGTATTTCCTGCTCACAGG + Intronic
1158703388 18:59769855-59769877 CCTGGTATGTCCCTGTTCACTGG - Intergenic
1160520699 18:79506378-79506400 CCTGGGAGAGGCCTGGTCACCGG - Intronic
1161003886 19:1924883-1924905 CCTGGGGAGTTCCTGGTCCAGGG + Exonic
1161055136 19:2187167-2187189 CCTGGGAACTTCTAGGTGACAGG - Intronic
1161741354 19:6022835-6022857 CCTGGGAAGCTCCTGTTGACCGG + Intronic
1161912441 19:7204649-7204671 ACTGGGAAGTTCCAGGTATCTGG - Intronic
1163438985 19:17312127-17312149 GCTGGGAAGTCCCTCGTCCCAGG + Intronic
1163551941 19:17970175-17970197 GCTGTGAGGTGCCTGGTCACAGG + Intronic
1165894100 19:39131303-39131325 CCTGGGTAGTTTCTGGGCGCTGG + Intronic
1167260830 19:48456692-48456714 CCTGGGAAGTTCCCCACCACAGG + Exonic
1168213632 19:54909502-54909524 CCAGTGAAGCTCCTGGTCACAGG + Exonic
926086012 2:10020729-10020751 CCTGGCAGCTTCCTGGTCTCTGG + Intergenic
926402369 2:12510972-12510994 GCTGGGAAGTTCAAGGTCAAGGG - Intergenic
927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG + Intronic
928356041 2:30615540-30615562 CTTGGTAAATTCCTGATCACTGG - Intronic
929532394 2:42761334-42761356 CCTGGGTAGATGCTGGTCACAGG - Intergenic
931324735 2:61208275-61208297 TCTGGGGCCTTCCTGGTCACAGG - Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
932614047 2:73220717-73220739 CCTGGGAGGGGCCTGGGCACAGG - Exonic
933087076 2:78067549-78067571 CCTGGGAACTTCATGGACCCTGG - Intergenic
933721228 2:85398817-85398839 GCTGGGAAGTTCCAGGGCAGGGG - Intronic
934534772 2:95123789-95123811 CATGGTAAGTTGCTGGTCAATGG + Intronic
934665618 2:96167948-96167970 CCTGGGAAGTTACTTCTCCCTGG - Intergenic
935037850 2:99396391-99396413 CCTAGGCAGTACCTGGTGACAGG - Intronic
936877804 2:117213627-117213649 CCTGGGAAGTTGCTTTTCCCTGG - Intergenic
937103422 2:119289141-119289163 CCTGCAAAGGTCCTGGTAACTGG - Intergenic
938994247 2:136660704-136660726 CCTGGGCACTTCGTGGTCTCAGG - Intergenic
940330113 2:152465395-152465417 GCTGGGATGTTCCTGGTCAGTGG + Intronic
940982658 2:160020737-160020759 GCTGGGAAGTTCAAGGTCAAAGG - Intronic
943679110 2:190749169-190749191 CCTTGGAATTTCCTGGTGATAGG - Intergenic
945627645 2:212230840-212230862 CCTGGGAAGGTACTGCTCATTGG - Intronic
947280691 2:228450622-228450644 CAAGGGAAGTGCCTGGTCAGAGG + Intergenic
948783600 2:240339809-240339831 ACAGGGAAGGGCCTGGTCACTGG + Intergenic
1170552718 20:17491096-17491118 CCTGGGGAGTTCATGCTCCCGGG - Intergenic
1170552903 20:17492184-17492206 CCAGGCATGGTCCTGGTCACTGG - Intergenic
1171791686 20:29532054-29532076 CCTGGGAAGTTTCTCATTACAGG + Intergenic
1172692600 20:36800505-36800527 TCTGGAAAGTTCCTGGTCCTGGG - Intronic
1173637723 20:44575573-44575595 CCTGGGAAGCTGCTGGGTACTGG + Intronic
1175648225 20:60694174-60694196 CCTGGGACATTCCTAGTCCCTGG - Intergenic
1176070742 20:63224969-63224991 CCTGGGGAGTCCCTGGGCTCTGG + Intergenic
1176109239 20:63404048-63404070 CCTGGGAAGTCTCTGGGCCCTGG - Intergenic
1176657144 21:9597263-9597285 TCTGGGCAGTTCCTGTTCCCAGG - Intergenic
1178351548 21:31875205-31875227 CCTGTGAAACCCCTGGTCACAGG + Intronic
1180214474 21:46315675-46315697 CCTGGGAGGATCCTGGTCTTAGG + Intronic
1181795144 22:25302774-25302796 CTTGGGAAGGTCATGGTCACAGG + Intergenic
1181835688 22:25606294-25606316 CTTGGGAAGGTCATGGTCACAGG + Intronic
1184296930 22:43530742-43530764 CGTGGGAAGTTTCTGGCCGCTGG + Intronic
1185055712 22:48577332-48577354 CCTGGAAACTTCCTGGTTTCAGG + Intronic
950475830 3:13214335-13214357 CCTGGGCAGCTCCTGGACAAGGG - Intergenic
953179676 3:40583952-40583974 AATGGGAAGTGCCTGGTCAGAGG + Intergenic
953195232 3:40726066-40726088 CCTAGGAAGTACCTGGTTATGGG + Intergenic
953697964 3:45174483-45174505 CCTAGGAAGTTCCTGAGCCCTGG - Intergenic
956237530 3:67090859-67090881 GCTGGGAAGTTCAGGGTCAAGGG - Intergenic
956610604 3:71118614-71118636 ACTGGAAAGTTTCTAGTCACGGG + Intronic
956790869 3:72679080-72679102 CCAGGGAAACTCCTGGCCACTGG - Intergenic
959330227 3:104996204-104996226 TTTGGGAAGTTCCTGGGGACAGG + Intergenic
960907989 3:122620758-122620780 CCTAGGGAGTGCCTGGTCATGGG + Intronic
965003387 3:162986662-162986684 CCTGGGAAGGTCCTTGGCATAGG + Intergenic
965284865 3:166805713-166805735 TCTGAGGTGTTCCTGGTCACTGG - Intergenic
965461317 3:168967819-168967841 CCTAGGAAGTTCAAGGTCAAGGG + Intergenic
966306974 3:178547227-178547249 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
967774751 3:193374984-193375006 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
968565917 4:1312767-1312789 CATGTGGAGTTCCTTGTCACTGG + Intronic
968899247 4:3423184-3423206 CCAGGGCAGTCCCTGTTCACGGG - Intronic
968914691 4:3492315-3492337 CCTGGGAAGTTCTTGGGGAAGGG + Intronic
968963654 4:3758411-3758433 CTTGGGCAGTGCCTGGCCACAGG - Intergenic
969427200 4:7132125-7132147 GCTGGGCAGTGCCAGGTCACAGG + Intergenic
969485432 4:7470035-7470057 CCAGGGAAGTTCATGGCCAAGGG + Intronic
970207569 4:13670120-13670142 TCAGAGAAGTTCCAGGTCACAGG + Intergenic
971172844 4:24250937-24250959 CCTGGGAAGTTCTGGGACAGTGG - Intergenic
972907563 4:43769409-43769431 GCTGGGAAGTTCAAGGTCAAGGG + Intergenic
972943853 4:44229353-44229375 CCTGGGAAGTTGCTTCTCCCTGG - Intronic
973970059 4:56204369-56204391 GCTGGGAAGTTCGAGGTCAAGGG + Intronic
974095774 4:57362213-57362235 GCTGGGAAGTTCAAGGTCAAGGG + Intergenic
974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
978699817 4:111628601-111628623 CCAGGGAATTTCCTGGTCTGCGG + Intergenic
978931929 4:114324713-114324735 CCTGGGAAGTTACTTCTCCCTGG - Intergenic
979635466 4:122950866-122950888 CCTGGGGTGTTCCTGTGCACGGG + Intronic
981807517 4:148733804-148733826 CCTGGGAGGTTTCTGGCCAGAGG - Intergenic
984734608 4:183098439-183098461 CCCCGGAAGCTCCTGGTCCCTGG - Intergenic
987852211 5:23370728-23370750 TCTGGGATGTTCCTGTTCAGAGG + Intergenic
990724367 5:58736906-58736928 CCTGGGAAGATTCTGGGGACTGG - Intronic
991408989 5:66328431-66328453 CCTGGGAAGTCCCAGTTCAAAGG - Intergenic
992792947 5:80230051-80230073 CCTGGGAATTTCCTGAGCAGTGG - Intronic
993352946 5:86872450-86872472 CCTGGGAGGTGGCAGGTCACAGG + Intergenic
997782819 5:136676989-136677011 ACTGTGATGTTCCTGGTCCCTGG - Intergenic
999891846 5:155986529-155986551 CCTGGGTTGTTCCAGGGCACTGG - Intronic
1001745043 5:174086098-174086120 CCTGTCAAGTACCTGGCCACAGG + Intronic
1002373073 5:178769964-178769986 GCTGGGAAGGCCCTGGTCTCAGG + Intergenic
1003314335 6:4998051-4998073 CATGGGAAGTGTCTCGTCACTGG - Intronic
1003372684 6:5543995-5544017 CCTGGTAAGATCCTGATCAGGGG - Intronic
1006600751 6:35224021-35224043 CCTGGTGAGTTCCTGGTCCAAGG - Intronic
1007492124 6:42231272-42231294 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
1011259044 6:85453003-85453025 CCTTGGAAGTTCCTGCTCGAGGG - Intronic
1011310925 6:85978524-85978546 CCTGGGGGATTCCAGGTCACAGG + Intergenic
1013076106 6:106773138-106773160 ACTGGGAAGTCGCTGCTCACAGG + Intergenic
1015363752 6:132373583-132373605 CCTGGGAATTTCCTAGGGACTGG + Intronic
1017029446 6:150207888-150207910 CCTGGGAAGTTCAAGGTCGAGGG + Intronic
1018725681 6:166611887-166611909 CATGGCACTTTCCTGGTCACAGG - Intronic
1018997858 6:168724132-168724154 CCTGGGAGGTGCCTGGTAGCTGG - Intergenic
1019261347 7:83741-83763 CGTGGGCAGTTCCTGGCCTCTGG - Intergenic
1023038641 7:36153739-36153761 CCTGGGAAGTCCGTGCTCCCCGG - Intronic
1025039706 7:55630464-55630486 CCTGGGGGCTTCCAGGTCACAGG + Intergenic
1026984245 7:74544994-74545016 ACCAGGAAGTTCCTGGTCAAAGG + Intronic
1027219066 7:76202419-76202441 CCTGTGGAGATGCTGGTCACTGG + Intronic
1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG + Intronic
1031226132 7:119040521-119040543 GCTGGGAAGTTCAAGGTCAATGG - Intergenic
1034821258 7:154218296-154218318 CCTGGGCAGTTCAGGGTGACAGG - Intronic
1034933457 7:155182623-155182645 CCTGGGTAGCTCCTGGTCCAAGG + Intergenic
1035756360 8:2035940-2035962 CCTGGGACCTCCCTGGTCAGAGG + Intergenic
1036635511 8:10547592-10547614 CCTGGGTAGTGCCTGCTAACGGG - Intronic
1036789246 8:11707617-11707639 CCCGGGAAGCCCCTGGTCCCTGG + Intronic
1037571651 8:20163121-20163143 CCTGGGGAGTGCCTGGTTGCTGG + Intronic
1037934445 8:22905776-22905798 CCTGGGATGTTGCTGGTGAATGG + Intronic
1039926687 8:41940183-41940205 CCTGGGATGTTTCTGGTAAACGG + Intronic
1040014837 8:42691697-42691719 TCCGGGATCTTCCTGGTCACGGG + Intergenic
1041782683 8:61595253-61595275 ACTGTGAAGATCCTGGTCTCTGG + Intronic
1045675723 8:104606506-104606528 CCTGGGAGGGACCTGGTCAGAGG + Intronic
1047434999 8:124829035-124829057 CCTGGGAAATGCCAGGTCCCAGG + Intergenic
1049001719 8:139829924-139829946 CCTGGGAAGTGCGTGGTCTGTGG - Intronic
1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG + Intergenic
1049642441 8:143721730-143721752 CCTGGGAAGGGCCATGTCACAGG - Exonic
1049733753 8:144192449-144192471 CGTGGGAAGTTGCTGGACAAGGG + Intronic
1052134011 9:24888627-24888649 CCTGGGAAGTTCCAGGGGTCGGG + Intergenic
1052528340 9:29650446-29650468 CCTGGGAAGTTGCTTCTCCCTGG + Intergenic
1053379840 9:37639678-37639700 CCTGGGAAGTGCATAGACACTGG - Intronic
1057282114 9:93720499-93720521 CCTGGGAAGTACCTGGCAGCGGG + Intergenic
1057305559 9:93910227-93910249 CCGGGGAAGTTCCAGGGCAGAGG + Intergenic
1058137307 9:101321044-101321066 CAAGGGAAGTTCTTGCTCACAGG - Intronic
1058945271 9:109849930-109849952 TCAGGGAAGTTCCTGATCAGGGG - Intronic
1060211959 9:121716049-121716071 CCTGGGAGGGTCAGGGTCACAGG + Intronic
1060404881 9:123368245-123368267 CCTGGCAGGCTCCTGGGCACAGG + Intronic
1062073494 9:134571997-134572019 CCTGGGAACTTCCTGGAGAAAGG - Intergenic
1062321966 9:135994473-135994495 CATGGGACGTTATTGGTCACAGG - Intergenic
1062344545 9:136108908-136108930 CCTGGGAGGTCCGTGGTCAGAGG - Intergenic
1203634867 Un_KI270750v1:100837-100859 TCTGGGCAGTTCCTGTTCCCAGG - Intergenic
1185620116 X:1449006-1449028 CTTGGGATGTTTCTGGTCAGAGG - Intronic
1185730945 X:2461248-2461270 CCTGGGGTGTTCGAGGTCACCGG - Intronic
1185733884 X:2482792-2482814 CCTGGGGTGTTCGAGGTCACCGG - Intronic
1188441078 X:30215777-30215799 CCTGGAAAGTTCCAGGGCAGGGG + Intronic
1189252305 X:39610933-39610955 TCTGGGCTGTTCCTGGTGACAGG - Intergenic
1189629009 X:42931992-42932014 GCTGAGAATTTCCTGGTCAATGG + Intergenic
1191667880 X:63721974-63721996 CCTGGTAAGTTCCTGTACAGTGG + Intronic
1193870248 X:86788262-86788284 ACTGGGAAGCTGCTGATCACCGG + Intronic
1195320954 X:103721654-103721676 CCTGGGAAGTTCCTGAGAGCTGG + Intronic
1195697340 X:107676815-107676837 CCTGGTGAGTTCCGGGTGACTGG - Intergenic
1195802924 X:108733826-108733848 CCTGGAAAGTTCCTGGGGAGGGG - Exonic
1201951836 Y:19573781-19573803 CCTTGGAATTTCCTGGTGATAGG + Intergenic