ID: 927477586

View in Genome Browser
Species Human (GRCh38)
Location 2:23425807-23425829
Sequence CAGTGCTCACAAATGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927477586_927477592 6 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477592 2:23425836-23425858 CCACAGGACAATAGTGATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 90
927477586_927477590 -10 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477590 2:23425820-23425842 GTGAGCACTGGAAGGACCACAGG 0: 1
1: 0
2: 3
3: 9
4: 166
927477586_927477594 11 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477594 2:23425841-23425863 GGACAATAGTGATCCAGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 117
927477586_927477596 27 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477596 2:23425857-23425879 GGCTGGGTCTCTTTCTTCATAGG 0: 1
1: 0
2: 2
3: 18
4: 177
927477586_927477597 28 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477597 2:23425858-23425880 GCTGGGTCTCTTTCTTCATAGGG 0: 1
1: 0
2: 3
3: 27
4: 206
927477586_927477593 10 Left 927477586 2:23425807-23425829 CCTTGTACCATTTGTGAGCACTG 0: 1
1: 0
2: 1
3: 13
4: 135
Right 927477593 2:23425840-23425862 AGGACAATAGTGATCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927477586 Original CRISPR CAGTGCTCACAAATGGTACA AGG (reversed) Intronic
904224243 1:29001516-29001538 TACTCCTCAGAAATGGTACATGG + Intronic
906733300 1:48101570-48101592 CTGTGCTCACAACAGGTGCACGG - Intergenic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
907363659 1:53943043-53943065 TGGTGCTCACAAATGGAAAAAGG + Intronic
908685641 1:66716140-66716162 AAGTGCTCAGAAATGGCACATGG - Intronic
909303889 1:74047634-74047656 GTGTGCTCACAGATGGTAGAGGG - Intronic
909750170 1:79149542-79149564 CTGTGCTCAAAAATGACACAGGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911315834 1:96355696-96355718 CAGTGATCCCAAATAGAACAGGG + Intergenic
915442690 1:155955420-155955442 CAGTGCTAAGAAATGGGAGAAGG - Intronic
918398197 1:184137357-184137379 CAGTGCTCAAAAATGGTGGATGG - Intergenic
918588441 1:186214340-186214362 CAGGGCGCACACATGGTCCAGGG - Intergenic
1063156953 10:3388721-3388743 CAGTCTTCTCAAATGGTATATGG + Intergenic
1063400107 10:5735388-5735410 CAGTGCCAACAAATGCTAAAAGG + Exonic
1070511319 10:77163668-77163690 GAGAGCTAAGAAATGGTACATGG + Intronic
1073111327 10:101064634-101064656 CAGTGCTCACACCTGGTAAGGGG + Exonic
1075494825 10:122911043-122911065 CAGGGCTCAGAAATGGGACGTGG - Intronic
1079079323 11:17402913-17402935 CAGTGCTCACAAAAGCTCAATGG - Intronic
1081194055 11:40139720-40139742 CATTGCTCACAAATGATCTATGG - Intronic
1081377127 11:42373428-42373450 CAGTGTTCACAAATATTTCAGGG + Intergenic
1084341383 11:68504644-68504666 CAGGGCTCTCAAATTGTACCAGG - Intronic
1084375262 11:68772537-68772559 CAGTGCTCAGAAAAGGGAGATGG + Intronic
1085865949 11:80292441-80292463 CAGTGCTCACAAGTGGTGAGGGG + Intergenic
1087959277 11:104327633-104327655 CATTGCACACATATGGTACTTGG + Intergenic
1088102059 11:106166556-106166578 CAGTGCTTACAAATGTGAGATGG - Intergenic
1088365783 11:109038583-109038605 CACTGCTCACAACTGGCTCAGGG - Intergenic
1090269407 11:125375434-125375456 AACTGCTCACAAGTAGTACATGG + Intronic
1090334987 11:125956041-125956063 CAGTCTTCACAACTGGTACAAGG + Exonic
1090345815 11:126069560-126069582 CAGTGCCTAGAAATGGTGCAAGG - Intergenic
1090346641 11:126076912-126076934 CTGTGCTCACAAATGCCAGAGGG + Intergenic
1090825840 11:130385183-130385205 CAATAATGACAAATGGTACAAGG - Intergenic
1092011435 12:5116161-5116183 CAGTGCTCCCTAAGGGTCCATGG + Intergenic
1093177416 12:15928476-15928498 CTGTGCTCACAATTTGCACATGG - Intronic
1094067081 12:26372787-26372809 TAGTGCTTCCAAATGGTACTGGG + Intronic
1102678813 12:114676285-114676307 CAGTGATCACAAAGGTGACATGG + Intronic
1103478290 12:121234191-121234213 CTGTGCTCAGAAAAGGTCCATGG + Intergenic
1104494044 12:129219888-129219910 CTGTGCTCCCAAAAGGTGCAAGG - Intronic
1105061476 12:133155300-133155322 CAGTACTCACAAAGGGCAAAAGG - Intronic
1110177158 13:72570518-72570540 CAGGGATCATAAATAGTACAGGG + Intergenic
1113207918 13:107940130-107940152 CAGAGCTCACACAAGGTAAAAGG - Intergenic
1113580854 13:111427662-111427684 CAGTTCTTACAAATGGTGAAAGG - Intergenic
1114049960 14:18914359-18914381 CAGTGGGCACACATGGTCCAGGG + Intergenic
1114112597 14:19487571-19487593 CAGTGGGCACACATGGTCCAGGG - Intergenic
1121894116 14:97629387-97629409 CAGTGCCCAAAAATGTTTCAAGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1123775886 15:23579474-23579496 CAGTGCTCTCAGCTGCTACAAGG - Intronic
1124090467 15:26595180-26595202 CAGTGCTCATTAAGGCTACAGGG - Intronic
1124878916 15:33623278-33623300 TATTAATCACAAATGGTACATGG - Intronic
1127704578 15:61534445-61534467 CAGTGCTGAGAAATGCTGCACGG - Intergenic
1130388333 15:83432767-83432789 TACTACTCAGAAATGGTACATGG - Intergenic
1130872424 15:87982026-87982048 CAGGGCCCACAAATGCTGCATGG - Intronic
1133841579 16:9415035-9415057 CAGTGCTCATTAACTGTACATGG + Intergenic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1135960790 16:26993120-26993142 CAGAGCTCATCAATGGTGCATGG + Intergenic
1140914971 16:79484676-79484698 CAGTTCTCACAAAAGGGCCAGGG + Intergenic
1141441058 16:84029904-84029926 CAGTGATCCCAAATAGCACAAGG + Intronic
1145854792 17:28144503-28144525 CAGTGCTCCCAACTGTTAGAGGG + Intronic
1146593300 17:34147548-34147570 CAATGCTCAGAAATACTACATGG - Intronic
1147403590 17:40195182-40195204 CAATGTTCACATATGATACAAGG - Exonic
1147780657 17:42939069-42939091 AAGAGCATACAAATGGTACATGG - Intergenic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1154207028 18:12346229-12346251 CAGTGCTCACATTTGGTAAGAGG - Intronic
1159760778 18:72422939-72422961 CAGTGCTCACGAGTAGTATAGGG - Intergenic
1162255540 19:9486352-9486374 CAGCCTTCCCAAATGGTACAGGG + Intronic
1164141383 19:22468529-22468551 CAGTGCTCACAAAAGCTAAAAGG - Intronic
1164444392 19:28304780-28304802 AAGTGCTCAAATACGGTACAGGG - Intergenic
1167026470 19:46922998-46923020 TAGGGATCACAAATGGTGCAGGG + Intronic
925818563 2:7777192-7777214 CAGTGCTCACAAATGGCTGGTGG + Intergenic
926563800 2:14446692-14446714 CTGTGCTCATCAATGTTACATGG - Intergenic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
929762575 2:44818200-44818222 CACTACTCACAAATGGTGCTAGG - Intergenic
931116374 2:59171118-59171140 TAGTGCTCACAAATAGTACTAGG - Intergenic
932021602 2:68093259-68093281 CTGTGCTAAGAAATTGTACATGG - Intronic
933112150 2:78416441-78416463 CTGAGCTCACACATGGAACAGGG + Intergenic
935452950 2:103231941-103231963 TACTGCTCACAAATGTTTCAGGG - Intergenic
940242946 2:151582872-151582894 CAGGGCTCACAAGTGGCACTTGG + Intronic
940243901 2:151593424-151593446 CAGGGCTCACAAGTGGCACTTGG + Intronic
940244860 2:151603977-151603999 CAGGGCTCACAAGTGGCACTTGG + Intronic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
946118758 2:217490153-217490175 CAGTGCCTGCAAATGGTAAATGG - Intronic
1169661266 20:7980819-7980841 CCGTGCTCACAATTAATACAAGG + Exonic
1170192048 20:13654163-13654185 CAGGGCACAGAAATGGTAAAAGG - Intergenic
1170972666 20:21130882-21130904 AAGAGCTCACAAATGGAGCATGG + Intronic
1173051308 20:39564629-39564651 TAGAGCTCACATATGGTCCATGG - Intergenic
1173148596 20:40546647-40546669 CAGTGCTCATCCATGGTTCAGGG + Intergenic
1173778537 20:45733601-45733623 CTGTGCTCTCACATGGTAGAAGG + Intergenic
1174765227 20:53247333-53247355 CTGTGCTCAGGAATGGTGCAAGG + Intronic
1179183583 21:39065416-39065438 CACTGCTCACAACTGGAAGATGG + Intergenic
1180468442 22:15636735-15636757 CAGTGGGCACACATGGTCCAGGG + Intergenic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1184146151 22:42612426-42612448 CAGTGCTCACCTATGCTCCAGGG + Intronic
952224924 3:31365655-31365677 CACTACTCAAAAATGGAACAAGG + Intergenic
960611028 3:119554782-119554804 CAGTCCTCACTAATTTTACATGG + Intronic
961055189 3:123781485-123781507 AAGTGCTGACAAATGGGAGAGGG + Intronic
962104734 3:132379039-132379061 CCCTGCTCACAAACGCTACAGGG - Intergenic
962267693 3:133955310-133955332 CTGTGCTAGCAAATGGGACATGG + Intronic
964165083 3:153694596-153694618 CAGTATTCACAAATAATACATGG + Intergenic
965281690 3:166763473-166763495 CAGTGTTCCCTATTGGTACAGGG - Intergenic
966619404 3:181947372-181947394 CAGTGCTCAAAAATGTTTCAAGG - Intergenic
967826880 3:193884075-193884097 CAGTGGTCACAGATGGCTCACGG - Intergenic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
976656058 4:87489770-87489792 CAGTGCTCACTAATGTTTCCGGG - Intronic
978365251 4:107974559-107974581 GCTTGCTCACATATGGTACATGG - Intergenic
983261201 4:165459011-165459033 CAATGTTCCCAAATGGTAAAAGG - Intronic
990444227 5:55879078-55879100 CACTGCTCATAAAAGCTACAGGG - Intronic
991283920 5:64948071-64948093 AATGGCTCACAAATGGTCCAGGG - Intronic
991631787 5:68664041-68664063 CATTGGACACAAATGGTAAATGG + Intergenic
993412009 5:87586002-87586024 CAGAGGTCAGAAATGGTACAAGG - Intergenic
995991407 5:118244367-118244389 CAGTGCTCACAATTGTTTAAAGG - Intergenic
998154725 5:139778208-139778230 CAGTGCACACAAGATGTACAAGG + Intergenic
999932179 5:156445611-156445633 CAGAGGTCACAAATAGTACGGGG - Intronic
1000657392 5:163896723-163896745 CAGTCATTACAAAGGGTACATGG + Intergenic
1001288254 5:170438949-170438971 GAGTGCTCAGAAATGGTGAAAGG - Intronic
1002107992 5:176889617-176889639 CTGTCATCACAAATGGTCCATGG + Intronic
1002283526 5:178147419-178147441 CAGGGCTCTAAAATGGTGCACGG - Intronic
1008414398 6:51223062-51223084 GAATACACACAAATGGTACAGGG - Intergenic
1009039604 6:58160314-58160336 CAGTGCTCCCCCATGATACATGG + Intergenic
1009552021 6:65109692-65109714 CAGTGCTCACAGTTGTGACAGGG - Intronic
1013045971 6:106485562-106485584 CAGTGATCACAAATAAGACAAGG - Intergenic
1015148945 6:130018604-130018626 TAGTCCTGACAAATGGTCCAGGG - Exonic
1018697930 6:166405332-166405354 CAGTGCCCATAAATGGTGCTTGG + Intergenic
1018801162 6:167223324-167223346 CAGGGCTCACAGATGGTAAAAGG - Intergenic
1019431354 7:1001274-1001296 CAGCGCTCACAACAGGCACAGGG - Intronic
1020720066 7:11732907-11732929 CAATGCTAATAAGTGGTACAGGG - Intronic
1023547898 7:41338563-41338585 CTGTGCTCAGATACGGTACAGGG + Intergenic
1027228668 7:76260276-76260298 CGGGGCTCACAAATGCTGCATGG - Intronic
1029047797 7:97649327-97649349 TAGTGCTCCCAAATGGTACTGGG + Intergenic
1035830348 8:2688571-2688593 GAGTCCTCACAAATGGGACTAGG - Intergenic
1040597123 8:48849178-48849200 AACTGCTAACAAATGGTACTTGG - Intergenic
1043417486 8:80066040-80066062 CAGTTCTCAGAAATGGTCCTGGG - Intronic
1044532608 8:93324794-93324816 CAGTGCCCACAAGTGTTACAAGG - Intergenic
1046734268 8:117759693-117759715 CAGTGCCCCCAAATGGTAGTAGG + Intergenic
1048442091 8:134467526-134467548 CAGTGCTCAAAAATGGTCACTGG + Intergenic
1048536081 8:135295838-135295860 CAGGGCTCACAAATGCTCCAGGG + Intergenic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1050033748 9:1413597-1413619 GAGGTCTCACAAGTGGTACATGG + Intergenic
1051575603 9:18611943-18611965 CGGAGCTCACAAAAGGTAAAGGG + Intronic
1054874356 9:70079589-70079611 CAGTGCTCACAAATAACTCATGG - Intronic
1056465134 9:86846483-86846505 CAGTGCTCAGTAATGGTCAATGG - Intergenic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1059230019 9:112711700-112711722 CAGAGCACACAAATCGCACATGG + Intronic
1059413560 9:114149386-114149408 CAGTGCTCACATCTGGAAAATGG + Intergenic
1061508473 9:131046131-131046153 CAGTGCTCACAACTGTTATGTGG - Intronic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1185855846 X:3534306-3534328 CAATGCTCAAAAAGGGTACCTGG + Intergenic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1194467541 X:94252412-94252434 CAAAGTTCACAAATGGTAAATGG - Intergenic
1199078827 X:143553935-143553957 CAGTCATCACTAGTGGTACATGG - Intergenic