ID: 927479691

View in Genome Browser
Species Human (GRCh38)
Location 2:23442485-23442507
Sequence TTGTCTTTGAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2265
Summary {0: 3, 1: 33, 2: 268, 3: 657, 4: 1304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927479691 Original CRISPR TTGTCTTTGAAGATGGAGGA AGG Intronic
Too many off-targets to display for this crispr