ID: 927482085

View in Genome Browser
Species Human (GRCh38)
Location 2:23462081-23462103
Sequence TCTCAGCTGCTGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 508}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927482079_927482085 6 Left 927482079 2:23462052-23462074 CCACCCATGAGAAGAGATTTTTG 0: 1
1: 1
2: 0
3: 13
4: 170
Right 927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 62
4: 508
927482080_927482085 3 Left 927482080 2:23462055-23462077 CCCATGAGAAGAGATTTTTGTCT 0: 1
1: 0
2: 5
3: 24
4: 363
Right 927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 62
4: 508
927482077_927482085 18 Left 927482077 2:23462040-23462062 CCTGTGTTCCTTCCACCCATGAG 0: 1
1: 0
2: 1
3: 20
4: 201
Right 927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 62
4: 508
927482081_927482085 2 Left 927482081 2:23462056-23462078 CCATGAGAAGAGATTTTTGTCTG 0: 1
1: 0
2: 5
3: 28
4: 319
Right 927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 62
4: 508
927482078_927482085 10 Left 927482078 2:23462048-23462070 CCTTCCACCCATGAGAAGAGATT 0: 1
1: 1
2: 0
3: 18
4: 134
Right 927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 62
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927482085 Original CRISPR TCTCAGCTGCTGAGGGAGGC AGG Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900607527 1:3530536-3530558 TCCCAGCTGCAGAGAGAGGCAGG + Intronic
900819941 1:4878963-4878985 TCCCAGCAGCTGATGGAGGATGG + Intergenic
901600382 1:10419124-10419146 TCCCAGCTACTTAGGAAGGCTGG - Intronic
902114000 1:14106322-14106344 TCACAGCTGTGGTGGGAGGCAGG + Intergenic
902942756 1:19812507-19812529 AGTCAGCTGCTCAGAGAGGCCGG - Intergenic
903164464 1:21510452-21510474 GCCCAGCTGCCCAGGGAGGCAGG + Intronic
903377726 1:22876976-22876998 ACTCAGCTGCTGGTGGAGGCAGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904423332 1:30408047-30408069 TCTCTGTCGCTGAGGAAGGCTGG + Intergenic
904656141 1:32049170-32049192 TCCCAGCTACTCAGGAAGGCAGG - Intronic
904932928 1:34104746-34104768 TGTCCGCTGATGAGAGAGGCAGG + Intronic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
905919491 1:41709981-41710003 TCTCAGCTGCTGGTGGAAGTGGG - Intronic
907307597 1:53521956-53521978 TCTCAGCTGCTGTGTGATGTGGG - Intronic
907520112 1:55018384-55018406 TCCAACCTTCTGAGGGAGGCAGG + Intergenic
907573234 1:55503352-55503374 TTTCAACTGCTGAGGGAGAGGGG + Intergenic
907663840 1:56417165-56417187 TCCCAGCTACTGAGTGGGGCTGG + Intergenic
907874707 1:58474277-58474299 TCACAGCTGGTAAGGAAGGCAGG + Intronic
908444383 1:64187737-64187759 TTGCAGCTGCTGATGGAGGGAGG - Intergenic
908967407 1:69782543-69782565 ACACAGCTGCTGAGTGTGGCTGG + Intronic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910163317 1:84297726-84297748 TCCCAGCTGCTAAGAGAGGCTGG + Intergenic
911882008 1:103251747-103251769 TCCCAGCTTCTGATGGTGGCTGG + Intergenic
912227131 1:107746658-107746680 CCGCACCTGCCGAGGGAGGCTGG - Intronic
912460329 1:109826616-109826638 TCATAGCTGCTGAGGGACACAGG - Intergenic
912747094 1:112253969-112253991 CCTCAGCTGGTGATGGAGTCAGG - Intergenic
912948275 1:114102820-114102842 TCTGAGCTGATGAGGGAAGGAGG + Intronic
913371383 1:118103435-118103457 CCTCTGCTGCTGAGGAAGGCTGG - Intronic
913937124 1:125065377-125065399 CCTCATCTGTTGAGGCAGGCAGG + Intergenic
914698128 1:150104705-150104727 TCTCAGCTACTTGGTGAGGCTGG - Intronic
915650524 1:157307299-157307321 CCTCAGCTCTTGAGGGAGGAAGG - Intergenic
916252594 1:162753496-162753518 TGTGAGCTGCTGCAGGAGGCAGG + Intronic
918409101 1:184240143-184240165 ACTCAGCTGCTGATGCAGGAAGG + Intergenic
919085651 1:192917624-192917646 TCTCAGAGACTGAGGGAGGTAGG - Intergenic
919629549 1:199946813-199946835 TCCCAGCAGCTCAGGGAGTCAGG + Intergenic
920315670 1:205074321-205074343 TCTCAGCCGCTTGGGCAGGCAGG - Exonic
920709904 1:208285343-208285365 TCAAAGCTGGGGAGGGAGGCAGG + Intergenic
921906782 1:220503617-220503639 TCCCAGCTGCTTTGGGGGGCTGG - Intergenic
922119132 1:222644720-222644742 TCTATGCTGTTTAGGGAGGCAGG + Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922671116 1:227509352-227509374 CCGCAGCTTCTCAGGGAGGCTGG + Intergenic
922887141 1:229028719-229028741 TCTGAGCTGCTGGGGGAGGTGGG - Intergenic
924436838 1:244049338-244049360 TCTCGGGTGCGGAGGGCGGCGGG + Intronic
924438536 1:244067482-244067504 GTTCTGCTGCTGTGGGAGGCAGG + Intergenic
1064690930 10:17917878-17917900 TCCCAGCTACTCTGGGAGGCTGG - Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1065147057 10:22780342-22780364 TCTTAGCTGCTGTGGGATGTGGG + Intergenic
1066123207 10:32311543-32311565 TTTCAGCTGTTGAGGAAGGAAGG - Intronic
1067450378 10:46378387-46378409 GCTCAGCTTCTGAGTCAGGCTGG + Intronic
1067586867 10:47481376-47481398 GCTCAGCTTCTGAGTCAGGCTGG - Intronic
1067633922 10:47989143-47989165 GCTCAGCTTCTGAGTCAGGCTGG - Intergenic
1067750935 10:48970421-48970443 TCCTAGCTTCTGAGGGTGGCAGG - Intronic
1067836349 10:49644023-49644045 GCTCAGGTGCTGTGTGAGGCTGG + Intronic
1069864499 10:71493258-71493280 TCTCTGCTTCTAAGGGTGGCAGG - Intronic
1070761657 10:79027865-79027887 GCTCAGCTTCTGAGGCAGGCAGG - Intergenic
1071562892 10:86657047-86657069 TCTCAGCCACTGAGCCAGGCAGG - Intronic
1071875029 10:89836292-89836314 TATCAGCTGAAGAGGGAGTCTGG + Intergenic
1072803555 10:98409833-98409855 TTTCAGAGGCTGAGGCAGGCGGG + Intronic
1072915012 10:99532585-99532607 TTTCAGCTGCTGCGCGGGGCAGG - Intergenic
1072963971 10:99955514-99955536 TCTGCTGTGCTGAGGGAGGCAGG + Exonic
1074124258 10:110515748-110515770 TCTCAGAGTCTGAGCGAGGCAGG - Intergenic
1075323477 10:121511132-121511154 TCTCAGCTGCTGATATAGGTAGG - Intronic
1075395334 10:122122976-122122998 CCTCTGCTGCTGAGAGAGGTTGG + Intronic
1075656226 10:124162970-124162992 ACTCTGCTGCGGAGGGAGGGAGG + Intergenic
1075957290 10:126534945-126534967 TCTCAGCTCCTGAAGGAGTGAGG - Intronic
1076446484 10:130517803-130517825 GCTCTGCTGGTGGGGGAGGCCGG + Intergenic
1076472145 10:130726657-130726679 TTTCAGCTCCTGAGGCAGGTGGG + Intergenic
1076616584 10:131759151-131759173 AGCCAGCTGCTGAGGGAAGCTGG - Intergenic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1077494546 11:2880560-2880582 TCTCAGCTGCTGGGTGAGGAAGG - Intergenic
1077532736 11:3104756-3104778 TCACAGCTGCCAGGGGAGGCAGG + Intronic
1077918287 11:6625107-6625129 TAGCAGCTGCTGAGGTGGGCTGG - Intronic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1079117123 11:17646974-17646996 TCACAAGTGCTCAGGGAGGCTGG - Intronic
1082824236 11:57566682-57566704 TCTCAGAGGCTGAGGGTAGCAGG + Intronic
1083625987 11:64072207-64072229 CCTCAGCTGCTGTGGGATGGAGG + Intronic
1084751479 11:71206967-71206989 TCCCAGCTCCTCAGGAAGGCGGG + Intronic
1084900317 11:72305156-72305178 TCTCAGCTGCTCTAGGAAGCTGG - Intronic
1085309756 11:75509209-75509231 TCTCGGCCTCTGAGGAAGGCTGG - Intronic
1085349237 11:75787964-75787986 ACTCTGCTGCTGAGGCAGCCTGG - Intronic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086544746 11:87954659-87954681 GATCAGCTGCTCAGGAAGGCAGG + Intergenic
1086569282 11:88263773-88263795 TGTCAGCTACTGGGGGTGGCTGG + Intergenic
1086911123 11:92473963-92473985 TCTCAGCTCCATAGGAAGGCTGG - Intronic
1087766618 11:102162298-102162320 TGTCTGTTGCAGAGGGAGGCTGG + Intronic
1088323874 11:108582346-108582368 TCCCAGCTACTTAGGGAGGCTGG + Intronic
1088928884 11:114329094-114329116 TCTGAGCTGGTAAGGAAGGCAGG + Intergenic
1089137738 11:116263154-116263176 TGAATGCTGCTGAGGGAGGCTGG + Intergenic
1089582625 11:119490880-119490902 TCTGGGCTGCTGCAGGAGGCTGG + Intergenic
1089648717 11:119897662-119897684 TCTCTGCTGCTCATGGGGGCCGG - Intergenic
1090551385 11:127823935-127823957 GCTCAGCTACTGAGGGAGTCAGG + Intergenic
1090714600 11:129419144-129419166 TCTCAGCAGCTCAGGGTGCCAGG - Intronic
1091847212 12:3666581-3666603 TCACAGTTCCTGTGGGAGGCTGG - Intronic
1092132661 12:6123506-6123528 TCCCAGCTGCTTCAGGAGGCAGG - Intronic
1093704798 12:22262605-22262627 TCTGAGCTGGTCTGGGAGGCAGG + Intronic
1094420944 12:30270800-30270822 TCTGAGCTGCTGAGCAAGGGTGG - Intergenic
1094442716 12:30497156-30497178 TCTCTGTTACTGAGGGATGCTGG - Intergenic
1095756899 12:45778087-45778109 TCTCAGCTTCTCAGGGGGGCCGG + Intronic
1096240232 12:49955879-49955901 ACTGAGCTGGGGAGGGAGGCAGG + Exonic
1096366853 12:51035443-51035465 TCCCAGCTACTCAGGGAGGCAGG - Intergenic
1096830442 12:54309741-54309763 TCTCAGCTACTTTGGGAGGCTGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098682017 12:73367924-73367946 TCCCAGCTGCTGGGGGAGTGGGG + Intergenic
1099573594 12:84356237-84356259 ACTCAGTTCCTGAGGGATGCAGG + Intergenic
1100545061 12:95593720-95593742 TCTCTGCTTCTGAGGCAAGCTGG + Intergenic
1101448049 12:104752170-104752192 TCCCAGCTGCTGGTGGTGGCCGG + Intronic
1102459346 12:113090605-113090627 ACACAGCTCCCGAGGGAGGCAGG - Intronic
1103088928 12:118083630-118083652 TCCCAGCTGCTGGGGGCGCCTGG - Intronic
1103212453 12:119176654-119176676 TCTCAGCTGGGGAGGAGGGCAGG + Intergenic
1103214593 12:119191781-119191803 TGTCTGGTGCTGGGGGAGGCAGG + Intronic
1103406571 12:120680053-120680075 TCCCAGCTACTCAAGGAGGCTGG + Intergenic
1103415101 12:120738171-120738193 CCTGAGCTTCTGAGGGAGGTGGG + Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105966665 13:25390811-25390833 TCCCAGCTACTCAGGGAGACAGG + Intronic
1106236174 13:27862410-27862432 GCTCAGCTGCTGAAACAGGCTGG - Intergenic
1106328236 13:28715332-28715354 TCTCAGCAGCTGGGCCAGGCTGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1109068692 13:57735384-57735406 TCTCAGCTGCAGGGAGATGCTGG - Intergenic
1110466963 13:75813397-75813419 TCTCACCTGCTAAGTGAGGAAGG - Intronic
1111032513 13:82622585-82622607 TCTCACCCGCTGAGAGAGGAGGG + Intergenic
1111644240 13:91010249-91010271 TCCCAGCTACTGGGGGAGGCTGG - Intergenic
1112318993 13:98390169-98390191 TCACAGCGGCTGTGAGAGGCGGG - Intronic
1112601408 13:100859056-100859078 TCCCAGCTTCTGAGGGTGGCTGG - Intergenic
1114732365 14:25006982-25007004 AGTCAGCTGCTTTGGGAGGCTGG - Intronic
1114752304 14:25218712-25218734 TCTAAGCTGCTGAGGGATAATGG - Intergenic
1116012455 14:39367053-39367075 GCCCTGCTGCTGATGGAGGCAGG + Intronic
1116957888 14:50943423-50943445 CCAGAGCTGCTGAGGAAGGCTGG - Intronic
1118715743 14:68558527-68558549 TCTCAGCTTCTGGTGGTGGCCGG + Intronic
1118761932 14:68885350-68885372 TCTCAGCTGCTGGGGGAGGTGGG - Intronic
1118787142 14:69055260-69055282 ACTCATCTACTGTGGGAGGCGGG + Exonic
1118817784 14:69325024-69325046 TGTCAGGAGCTGAGGGAGGCCGG + Intronic
1118992017 14:70805807-70805829 TCCCAGCTTCTTTGGGAGGCTGG + Intronic
1119186330 14:72645435-72645457 TCCCAGCTACTGGGGGAGGCAGG - Intronic
1119303173 14:73586827-73586849 TCTCAGCTACTCAGGGAGGCTGG - Intergenic
1119489299 14:75016957-75016979 TCTAAGCTGCTCAGGGACACTGG + Exonic
1120079645 14:80201452-80201474 TCTCAGCTGCTGCGGGAGGTAGG - Intronic
1120822543 14:88926230-88926252 TCCCAGGTCCTGAGGGAGGAGGG + Intergenic
1122016901 14:98803910-98803932 TCACAGCTGCTCTGGGAGGAGGG + Intergenic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1122307378 14:100774261-100774283 GCTCAGCCTCTGGGGGAGGCAGG + Intergenic
1122775246 14:104114069-104114091 CCTCAGGAGCTGAGGGAAGCAGG - Exonic
1122806354 14:104261602-104261624 TCTGTGCTGCTGGGGGAGGCAGG + Intergenic
1124101456 15:26697984-26698006 TCTAAGATGATGAGGGAGGTGGG - Intronic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1125515742 15:40319904-40319926 ACTCAGCTTCTCAGGGATGCTGG + Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1128072146 15:64804429-64804451 TAGGAGCTGCTGATGGAGGCAGG + Intergenic
1128345974 15:66852634-66852656 CCAGAGCTGCTGGGGGAGGCTGG - Intergenic
1128522841 15:68386886-68386908 TGGCAGCTGCTGAGAGAAGCAGG + Intronic
1128525237 15:68407875-68407897 TCCCAGGTGCTGAGGGCTGCTGG + Intronic
1129115978 15:73365686-73365708 TGCTTGCTGCTGAGGGAGGCTGG + Intronic
1129318209 15:74759009-74759031 TCGTACCTGCTGTGGGAGGCAGG - Intergenic
1129693660 15:77728400-77728422 TCTCGGCTGCTGAGGGCTGGGGG + Intronic
1130149170 15:81298364-81298386 TCCCAGGGGCAGAGGGAGGCTGG - Intronic
1131187093 15:90283937-90283959 TCTCAGCGGCTGGAGGAGCCTGG + Intronic
1131222621 15:90597812-90597834 TCTCATTTGCTGAGGGAAACAGG + Intronic
1131288986 15:91088437-91088459 TCACAGTTGCTGAGAGAGACTGG + Intergenic
1131446334 15:92500663-92500685 TCTCAGCTTCTGGTGAAGGCTGG - Exonic
1131723329 15:95195708-95195730 TCTGAACTCCTGAGAGAGGCTGG - Intergenic
1132021203 15:98364103-98364125 TCTGGGCTGCTGGGAGAGGCAGG + Intergenic
1133413392 16:5587038-5587060 TCTCAGCCCCAGAGGGAGCCAGG + Intergenic
1133670974 16:8020051-8020073 TCTCTACTGCTGCAGGAGGCTGG - Intergenic
1133785614 16:8970880-8970902 TCCCAGCTACTCGGGGAGGCAGG - Intergenic
1133977727 16:10612046-10612068 CCTCTGCTCCTGAGGGAGACGGG - Intergenic
1134665666 16:16016721-16016743 TATCAGGGGTTGAGGGAGGCTGG - Intronic
1134751434 16:16628432-16628454 TCCCAGCTACTCAGGAAGGCTGG - Intergenic
1134994026 16:18725175-18725197 TCCCAGCTACTCAGGAAGGCTGG + Intergenic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1136024354 16:27460450-27460472 TCTCACCTGCTGGCTGAGGCTGG + Intronic
1136230747 16:28883858-28883880 TCTGAGCATCTCAGGGAGGCAGG - Intronic
1136236905 16:28919925-28919947 TCATAGCTGCTGATGGAGTCTGG + Exonic
1136291197 16:29272477-29272499 TTCCAGCTGCTGAGCCAGGCAGG - Intergenic
1136343969 16:29663473-29663495 TCTAAGCTGCTGAGGCTGGAGGG + Intronic
1136573792 16:31111587-31111609 CCTCAGCTGCTGACAGAGGCAGG - Intronic
1136683777 16:31982515-31982537 TCTCAGCAGGCGAGGAAGGCAGG + Intergenic
1136784405 16:32926071-32926093 TCTCAGCAGGCGAGGAAGGCAGG + Intergenic
1136885378 16:33927735-33927757 TCTCAGCAGGCGAGGAAGGCAGG - Intergenic
1137307358 16:47216308-47216330 TCCCAGCTACTTCGGGAGGCTGG - Intronic
1137546955 16:49411210-49411232 TCTCAGCTGGGGTGGGTGGCAGG - Intergenic
1138273359 16:55712136-55712158 TCTCAGCAGATGAGGGAACCTGG - Intergenic
1139138640 16:64234305-64234327 TGTCAGCTGCTGTGGGGGGCAGG - Intergenic
1139513004 16:67437898-67437920 TCTCGGCTGCTGACTGAGGGAGG + Intergenic
1139582965 16:67884135-67884157 GCTTAGCAGCTAAGGGAGGCTGG - Exonic
1139625925 16:68188211-68188233 TCTGAGCTGTTGCGGGAGGGGGG + Intronic
1139871532 16:70112431-70112453 TCCCAGCTACTTTGGGAGGCTGG - Intergenic
1140906728 16:79415524-79415546 GCTCAGGTTGTGAGGGAGGCTGG + Intergenic
1140989187 16:80191784-80191806 CCTCAGCATCTGAGAGAGGCAGG - Intergenic
1141166901 16:81666957-81666979 TCTCAGCTGGTGTGGGGGGGGGG + Intronic
1141389139 16:83649775-83649797 GGTCTGCTGCTGAGAGAGGCAGG + Intronic
1141897940 16:86970646-86970668 TCTCTGCTTCTGAGGAATGCCGG - Intergenic
1142096972 16:88245425-88245447 TCACAGCGGCTGCGGGAGGACGG - Intergenic
1142097066 16:88245938-88245960 TTCCAGCTGCTGAGCCAGGCAGG - Intergenic
1142172809 16:88631668-88631690 TCTCAGCTCAGGAGGGAGCCTGG - Exonic
1142305536 16:89282507-89282529 TTTCAGCTTCTCAGGGAGGCAGG + Exonic
1203087064 16_KI270728v1_random:1190077-1190099 TCTCAGCAGGCGAGGAAGGCAGG + Intergenic
1142715946 17:1747076-1747098 GCTCAGCAGATGGGGGAGGCAGG - Exonic
1143078106 17:4362741-4362763 TCTCAGCTACTGGGGGCCGCAGG + Intronic
1143107291 17:4536130-4536152 TCCCACCTGCTGGGGGACGCCGG + Exonic
1143503325 17:7351281-7351303 TCTCATCTCCTGGGGGAGGGAGG - Exonic
1143739024 17:8939061-8939083 TGTCAGCTGCTGGAAGAGGCAGG + Intronic
1144366794 17:14552421-14552443 TGTCTGTTTCTGAGGGAGGCAGG + Intergenic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1145302648 17:21652112-21652134 TCCAAACTCCTGAGGGAGGCGGG + Intergenic
1145347654 17:22051076-22051098 TCCAAACTCCTGAGGGAGGCGGG - Intergenic
1145378947 17:22376633-22376655 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379426 17:22379003-22379025 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379904 17:22381373-22381395 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380384 17:22383748-22383770 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380863 17:22386095-22386117 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145381342 17:22388470-22388492 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382075 17:22392244-22392266 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382550 17:22394609-22394631 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382830 17:22395972-22395994 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383403 17:22398795-22398817 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383917 17:22401263-22401285 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384355 17:22403465-22403487 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384674 17:22404927-22404949 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1146266980 17:31459232-31459254 TCTCAGCTGTTCAGGGATCCTGG + Intronic
1146401400 17:32502887-32502909 GGACAGCTGCCGAGGGAGGCTGG + Intronic
1147144699 17:38478222-38478244 TCTCAGCAGGCGAGGAAGGCAGG + Intronic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1148643750 17:49207143-49207165 TCTCCTGTGCTCAGGGAGGCTGG + Intronic
1148996182 17:51711929-51711951 TCACAGCTGCTGGGGGAGAGGGG + Intronic
1149651454 17:58278896-58278918 TCCCAGACGCTGAGGAAGGCTGG - Intronic
1149863803 17:60139335-60139357 TCTCAGCAGCCGAGGAAGGTAGG - Intergenic
1150509445 17:65734319-65734341 TGGCAGCTGATGAGGGAGACTGG + Intronic
1151320434 17:73349361-73349383 TGTGAGCTCCTGAGAGAGGCTGG + Intronic
1151324627 17:73371432-73371454 ACACAGCTGCTGAGTCAGGCAGG + Intronic
1151820597 17:76494775-76494797 ACAAAGCTGCTGATGGAGGCAGG + Intronic
1151842838 17:76629897-76629919 TCTCAGCTACTCAGGGGGGTGGG - Intronic
1151945640 17:77318546-77318568 TCTCAGCCGAGGTGGGAGGCTGG - Intronic
1152331333 17:79675024-79675046 TGTCTGCTGCTCAGGGAAGCAGG - Intergenic
1152613085 17:81325066-81325088 TCTCAGCTCCTGGGGGCGGCTGG + Intronic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1153246674 18:3078921-3078943 TCCCAGTTACTGTGGGAGGCAGG - Intronic
1153940012 18:9969296-9969318 TCTCAGCTTCTGTTGGAGCCTGG - Intergenic
1154329084 18:13415105-13415127 TCTCAGCTACTCTGGGAGGCTGG + Intronic
1155144666 18:23073214-23073236 ACCCAGCTACTGAGGGAGACGGG + Intergenic
1156144616 18:34159883-34159905 TCTCAGCGGGAGAGGGATGCGGG + Intronic
1157242775 18:46026768-46026790 TCCCAGCTACTGGGGGAGGATGG + Intronic
1159374627 18:67577218-67577240 TTTCAACTTGTGAGGGAGGCTGG - Intergenic
1159739808 18:72153215-72153237 TCCCTGCCGCTCAGGGAGGCCGG + Intergenic
1159770042 18:72538556-72538578 TCTCTGAGGCTGAGGGAGACAGG - Intronic
1160067598 18:75590863-75590885 TCCCAGGGCCTGAGGGAGGCAGG - Intergenic
1160386549 18:78500431-78500453 TCTCAGCAGGTGAGGTAGGGAGG - Intergenic
1160678340 19:402097-402119 TCTCAGCTCCTGGGGGTGGGAGG - Intergenic
1160854039 19:1207965-1207987 TCCCAGCTGGTGGGGGTGGCCGG + Intronic
1161040481 19:2108517-2108539 TCTGTGCTGCTGAGTGGGGCTGG + Intronic
1161399848 19:4062372-4062394 TCGGAGCAGCTGGGGGAGGCTGG + Intronic
1161893757 19:7064315-7064337 TCTCAGCAGCTGGGGGATGGAGG - Intergenic
1162042004 19:7976554-7976576 TCACAGCTTCTGGTGGAGGCTGG - Intronic
1162319132 19:9960409-9960431 TCTCAGCTGCTGAAGCAGACGGG + Exonic
1162335229 19:10056011-10056033 ACTCAGTTCCTGAGGGAGGAGGG - Intergenic
1163685538 19:18709874-18709896 TCACCGCTGCTGGAGGAGGCAGG - Intronic
1164825873 19:31284530-31284552 TCTCAGAAGCTGAGAGGGGCTGG - Intronic
1164840823 19:31390909-31390931 TCACAGATGCTGAGGGTGGCAGG + Intergenic
1165027065 19:32969783-32969805 TCTCTGCTCCTGGGGGAGCCGGG - Intronic
1165222707 19:34330198-34330220 TTACAGCTGATGAAGGAGGCAGG + Exonic
1165595661 19:37009744-37009766 CCTCATCTGGTGAGGCAGGCAGG - Intronic
1165845180 19:38813321-38813343 TCACAGTTGCTGGGAGAGGCAGG - Exonic
1166046940 19:40235374-40235396 ACCCAGCTGCTCCGGGAGGCAGG - Intronic
1166316230 19:41991708-41991730 TCTCAGATACTGAGAGAGGCTGG + Intronic
1166404123 19:42507078-42507100 TCCCAGCTACTTGGGGAGGCTGG + Intergenic
1166887463 19:45970960-45970982 TCCCCGCTGTGGAGGGAGGCAGG + Intronic
1167622109 19:50566354-50566376 TCCCAGCTGGAGAGGGGGGCGGG + Intronic
1167721714 19:51184339-51184361 TTGCAGCTGCTGAGGGAGGGAGG + Intergenic
1167739992 19:51318811-51318833 ACTCAGCTGCTGATTGAAGCAGG - Intronic
1167769021 19:51502185-51502207 TCACGGCCGCTGAGGGAGGAAGG - Intergenic
1168060606 19:53889983-53890005 TCTCATCTGCTGTGGGAGCCCGG - Exonic
1168310647 19:55458479-55458501 TCTGGGAAGCTGAGGGAGGCAGG + Intronic
925253943 2:2466296-2466318 TCTCAGCTCCTGCAGGAGGCTGG + Intergenic
925351164 2:3201475-3201497 TTCCAGCTGGTGCGGGAGGCGGG + Intronic
925519405 2:4725178-4725200 TCCCAGCTACTCAGGGAGGCAGG - Intergenic
925925384 2:8666399-8666421 TCTCATCTTCCGAGGGGGGCAGG + Intergenic
926010109 2:9400462-9400484 TCTCAGAGGCCGAGGGAGGAGGG - Intronic
926042436 2:9684428-9684450 TCCCAGCTACTTGGGGAGGCTGG - Intergenic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
927465129 2:23331126-23331148 TCTCCGCTGCTGACGGATACAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927495469 2:23548985-23549007 TCCCAGCAGCTTGGGGAGGCAGG - Intronic
927706097 2:25297386-25297408 TCTCAGCAGCCCTGGGAGGCGGG - Intronic
927855978 2:26528241-26528263 TCCCAGCTCCTGAGGGGGGTTGG + Intronic
929314441 2:40460686-40460708 TCCCAGCTACTCGGGGAGGCTGG - Intronic
929388793 2:41443249-41443271 CCACAGCTGTTGAGGGTGGCGGG + Intergenic
929522251 2:42664596-42664618 TCTCAGCTACTGGCTGAGGCAGG - Intronic
931331961 2:61296139-61296161 TCTCAGCTACTGGGGAAGGTTGG + Intronic
932156133 2:69419195-69419217 TCCCAGCTACTCAGGGTGGCGGG + Intronic
933354918 2:81198201-81198223 TTTCAGCTTCTCCGGGAGGCAGG + Intergenic
933398834 2:81765663-81765685 TCTCAGCTGATGGGGGAGCCAGG - Intergenic
933431456 2:82185133-82185155 TCCCAGCTACTTGGGGAGGCTGG + Intergenic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
935593385 2:104861819-104861841 TCTCAGCTCCTCAGGGCTGCTGG + Intergenic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
937067669 2:119030196-119030218 TCTCAGAAGCTGAGGGAGGGAGG - Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937319849 2:120954645-120954667 TCAGAGCATCTGAGGGAGGCTGG - Intronic
937402608 2:121597943-121597965 TCTCACCTGATGAGGGAAGAAGG + Intronic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
937860080 2:126701087-126701109 TCACATCTGTTGAGTGAGGCAGG - Intergenic
938162283 2:128996785-128996807 TTTCAGCTGCTTACGGAAGCAGG + Intergenic
938337442 2:130511980-130512002 CCTCCTCTGCTGAGGGAGCCAGG - Intergenic
938352396 2:130608755-130608777 CCTCCTCTGCTGAGGGAGCCAGG + Intergenic
938451531 2:131425274-131425296 TCTGAGCGTCTGAGCGAGGCCGG - Intergenic
940913646 2:159230395-159230417 CCTGAGCTGGTGAGGGAAGCTGG - Exonic
944044449 2:195392645-195392667 ACTCAGCTAGTGAGTGAGGCAGG + Intergenic
945178469 2:207067213-207067235 GCTCAGCTGCTGAGGGGAGAAGG - Intergenic
946226153 2:218265143-218265165 GTGCAGCTGCTGTGGGAGGCAGG - Exonic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
947605716 2:231483978-231484000 TCTCAGCGTCTGCGGGTGGCAGG - Intergenic
947787212 2:232834016-232834038 TCTCTGGAGCTGAGGGAGGAAGG + Intronic
947840082 2:233202171-233202193 TCTCAGCCCCTGAGAGAGGGTGG + Intronic
948127344 2:235574035-235574057 TGTTAGCTGGTCAGGGAGGCAGG + Intronic
948379389 2:237542138-237542160 CCCCAGCTGCTGTGGGAGGAGGG + Intronic
948801165 2:240434327-240434349 TCTCAGCCGCTGTGTGGGGCTGG - Intergenic
948996022 2:241579431-241579453 ATTCGGCTGCTGAGGGGGGCAGG + Intergenic
949040146 2:241844222-241844244 CCGCAGCTGCTGTGCGAGGCCGG + Intergenic
1168849388 20:966119-966141 GATCAGCTGCTCAGGGAGGCTGG + Intronic
1169201597 20:3712853-3712875 TCTGAGCCCCTTAGGGAGGCTGG + Intergenic
1169318063 20:4609482-4609504 TCTCAGCTGCTAGGGATGGCTGG - Intergenic
1171519245 20:25763643-25763665 TCCAAACTTCTGAGGGAGGCGGG + Intronic
1171524178 20:25796650-25796672 CCACATCTGCTGAGGCAGGCAGG + Intronic
1171552649 20:26059233-26059255 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1171557682 20:26092848-26092870 TCCAAACTCCTGAGGGAGGCGGG - Intergenic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172368303 20:34366338-34366360 TCCCAGCTACTCAGGGAGGCTGG - Intronic
1172626470 20:36350297-36350319 GCCCAGCAGCTGTGGGAGGCGGG + Intronic
1172941815 20:38659392-38659414 TCTCAGCAGCCCTGGGAGGCAGG - Intergenic
1173037327 20:39424847-39424869 TTTCAGCTACTGACTGAGGCTGG + Intergenic
1173317766 20:41960398-41960420 TCACAGCTGTTGAGCGAGGCTGG + Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173661172 20:44734736-44734758 TCTCAGAGACTGAGAGAGGCAGG - Intergenic
1173854987 20:46244467-46244489 TCTCAGCTGCGAGTGGAGGCTGG + Intronic
1174039452 20:47688617-47688639 TGCCGGCTGCTGGGGGAGGCTGG + Intronic
1174298107 20:49562983-49563005 TCTCAGCAACTCTGGGAGGCAGG - Intronic
1174486909 20:50866876-50866898 TCACAGCGGCTGAGAGAGGCAGG - Intronic
1175327548 20:58140237-58140259 CCTCAGCTCCTGGGGGAGGTCGG + Intergenic
1175644397 20:60658776-60658798 TGGCAGCTGCTGAGGGAGGGGGG - Intergenic
1176157596 20:63629736-63629758 TGACAGCAGATGAGGGAGGCAGG - Intergenic
1176653386 21:9569924-9569946 TCCAAACTCCTGAGGGAGGCGGG + Intergenic
1178515201 21:33240697-33240719 TCTCAGCTACTTAGGGGGACAGG + Intronic
1178747647 21:35268401-35268423 TCCCTGTTGCTCAGGGAGGCTGG + Intronic
1179246561 21:39638501-39638523 TCTCAGCAGATGGGGGAGCCAGG - Intronic
1179366781 21:40765998-40766020 TCACAGCCGCGGAGGCAGGCAGG + Intronic
1179481696 21:41682495-41682517 CCTCAGCTGCTCGGCGAGGCTGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179828381 21:43981268-43981290 TCACAGTGGCTGTGGGAGGCAGG + Intronic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1182006054 22:26960567-26960589 TCTCAGCAGCTGAGGATAGCAGG + Intergenic
1182080699 22:27526823-27526845 TTCCAGCTGGTGAGGCAGGCAGG + Intergenic
1182274906 22:29181901-29181923 TCCCAGCTACTTTGGGAGGCTGG + Intergenic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1184021318 22:41823658-41823680 TCTGAGTTGCTGGGAGAGGCTGG - Intronic
1184146679 22:42615712-42615734 ACTGAGCTGCTGTGTGAGGCCGG - Intergenic
1184355563 22:43977231-43977253 TCTCTGCTGGTGTTGGAGGCGGG + Intronic
1184399928 22:44267854-44267876 TCCCAGCTGCCCAGAGAGGCAGG + Intronic
1184768889 22:46586672-46586694 TCTCAGCTTCTCAGGGCGACTGG + Intronic
949528749 3:4932629-4932651 TCCCAGCTGCTCGGGGTGGCGGG + Intergenic
949817778 3:8078410-8078432 TCTCAGGTATTGAGGGAGGGTGG - Intergenic
949851926 3:8428618-8428640 TGCCAACTGCTAAGGGAGGCTGG - Intergenic
950097398 3:10338062-10338084 GCTCTGGTGCTGAGGGAGGGTGG - Intronic
950334180 3:12180618-12180640 TCTCAGGGGCTACGGGAGGCGGG - Intronic
950406720 3:12809538-12809560 TAGAAGCTGCTGAGGCAGGCAGG + Intronic
951662085 3:25078646-25078668 TCCCAGCTACTGGGTGAGGCAGG - Intergenic
952357286 3:32596302-32596324 TTTCAGAGGCTGAGGCAGGCGGG - Intergenic
952851451 3:37732899-37732921 CCCCAGCTGCTATGGGAGGCAGG - Intronic
953636762 3:44670919-44670941 TATCAGCTCCTTAGGGAGGCAGG - Intergenic
953642482 3:44722160-44722182 TCTCATATGCTGAGTGAGGCAGG - Exonic
953740475 3:45534315-45534337 CCTCAGATGCTGGGAGAGGCAGG - Intronic
953877324 3:46673742-46673764 ACTGAGGTGGTGAGGGAGGCGGG + Intronic
954076448 3:48185296-48185318 TCCCAGCTACTTGGGGAGGCTGG + Intronic
954304337 3:49717537-49717559 TCTCAGCCCCTGAGGGTGGACGG + Exonic
954322926 3:49844229-49844251 GCTCAGCTGCTGAGTTTGGCTGG - Intronic
954900526 3:54015230-54015252 AATCAGCTGCGAAGGGAGGCTGG + Intergenic
955780856 3:62483103-62483125 TCTCAGATGCAGAGTTAGGCTGG - Intronic
955963966 3:64368978-64369000 TATCAGCTGGGGAGGGTGGCAGG + Intronic
958915303 3:100043505-100043527 TCTCATTTGCTGTGGGAGACAGG + Intronic
960884034 3:122376131-122376153 TCTCTGCTGCCCAGGCAGGCTGG - Intronic
960950868 3:122997663-122997685 TCTTTGCTGCAGAGGGAGGGAGG - Intronic
961157003 3:124688193-124688215 TCGCAGCTCCTCAGGGAGTCTGG + Intronic
961259048 3:125584882-125584904 ACTCAGATGCTGAGGTAGGAGGG - Intronic
961504950 3:127363750-127363772 TCCCAGGGGCTGAGGGAGGGCGG - Intergenic
962845182 3:139267616-139267638 TCTCACCTGCTCAGAGATGCTGG + Intronic
962870111 3:139481199-139481221 TCTCAACTGTTGGGGGAGGTTGG - Intergenic
963064322 3:141251683-141251705 TCCAAGCTGCTCAGGGAGGCTGG - Intronic
964188103 3:153971128-153971150 TCTCAGCAGCTAAGAGAGACAGG + Intergenic
965436687 3:168661322-168661344 TCCCAGCTACTTAGGGAGGCAGG + Intergenic
967452100 3:189637027-189637049 TCTCAGCAGCTCAGGGTGGAAGG + Intronic
967875534 3:194265973-194265995 TCTCAGGTGGTGAGAGAGGCGGG - Intergenic
967888912 3:194351273-194351295 TCTCTGCTCCTGAGGAAGACAGG - Exonic
968092051 3:195904516-195904538 TCTCAGGGGCTGAGAGAGGAGGG + Intronic
968334228 3:197899948-197899970 TCTGAGCAGCTGTGGGAGGGCGG + Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968785774 4:2621341-2621363 GATCACCTACTGAGGGAGGCTGG - Intronic
969134390 4:5018830-5018852 CCTCATCTGCTGAGGGACCCGGG - Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969514594 4:7639302-7639324 TGCCAGCAGCTGAGAGAGGCAGG - Intronic
969660266 4:8523285-8523307 TCAGGGCTGCTGAGGGTGGCTGG + Intergenic
969935612 4:10677524-10677546 CCCCAGGTGCTGAGGGAGGGAGG + Intronic
970515620 4:16827201-16827223 TCTCTGCTGATGAGAGAGACGGG - Intronic
970531107 4:16985365-16985387 TCTCAGCTGCTGAGGTGGAAGGG - Intergenic
971764184 4:30808008-30808030 TCTTAGCTGGTGTAGGAGGCAGG + Intronic
972082874 4:35175354-35175376 ACTCATCTGCTCAGGGATGCAGG + Intergenic
972521121 4:39857919-39857941 TCTCAGCAACTTTGGGAGGCCGG - Intronic
973631247 4:52822984-52823006 CCTCAGCTGATGTGTGAGGCTGG + Intergenic
975812938 4:78188431-78188453 GCTCATCTGATGATGGAGGCTGG + Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
977296293 4:95213065-95213087 TCTGAGCAGCTGAGTGACGCAGG - Intronic
978557008 4:109991836-109991858 TCTAAGCTCCTGAGAGAGGCTGG - Intronic
980107412 4:128601051-128601073 GCTCAGGTGGTGAGGGAGGGAGG + Intergenic
982012181 4:151116591-151116613 TCCCAGCTACTGGGTGAGGCAGG - Intronic
982152459 4:152475308-152475330 TCCCAGCTACTCAGGAAGGCGGG + Intronic
984342150 4:178470858-178470880 TCCCAGCTACTGAGGGAGGAGGG + Intergenic
984914309 4:184707370-184707392 TCTCAGTTGCTGCAGGGGGCAGG - Intronic
985091183 4:186364056-186364078 TCCCAGCTGCTCAGTGAGGTGGG + Intergenic
985553282 5:543857-543879 TCTGAGCCACTGAGGGATGCAGG - Intergenic
985871797 5:2563124-2563146 CCTCTGCTGCTGTGGGAGTCTGG + Intergenic
987155395 5:15083993-15084015 TCTCAGCTACTTGGGGCGGCGGG + Intergenic
987395585 5:17420024-17420046 GATGAGCTGCTGAGAGAGGCTGG - Intergenic
988502157 5:31792534-31792556 TCCCAGCTTCTTCGGGAGGCTGG - Intronic
988822304 5:34899299-34899321 GATCTGCTGCTGGGGGAGGCAGG + Intronic
989188281 5:38645497-38645519 TGTCAGGAGCTGAGGAAGGCAGG + Intergenic
989440514 5:41466712-41466734 TACCAGAGGCTGAGGGAGGCAGG - Intronic
990315770 5:54581922-54581944 TCTCAGCTGGGGAGGGGTGCAGG - Intergenic
990357362 5:54982732-54982754 TCTTAACTACTGAGGGAGTCAGG - Intronic
990994266 5:61715609-61715631 TCTCAGCTGCTGAGCCAGATGGG - Intronic
991951158 5:71947965-71947987 TCCCAGCAGATGAGGGAGGGAGG + Intergenic
992278068 5:75141683-75141705 TCCCAGTTACTGAGGGATGCTGG + Intronic
993350198 5:86841015-86841037 TCTAAGCTGCTGCTGGAGGCAGG - Intergenic
993399719 5:87433779-87433801 TCACAGCTTCTCAGGGATGCAGG + Intergenic
993800561 5:92329299-92329321 TCTCAGTTGCAAATGGAGGCAGG + Intergenic
994619027 5:102140840-102140862 GTTCAGCTATTGAGGGAGGCAGG - Intergenic
997189721 5:131919986-131920008 TCTCATATGCTAAGGGAGGTGGG + Intronic
997419120 5:133751971-133751993 TCTCTGCTGCTAATGGAAGCTGG + Intergenic
997480526 5:134180980-134181002 CCTCTACTGCTCAGGGAGGCAGG - Intronic
998386927 5:141762508-141762530 TCCCAGCTCCTCGGGGAGGCAGG + Intergenic
999161971 5:149509039-149509061 TCTCAGCTTCTTGGGGATGCTGG - Intronic
999454336 5:151702546-151702568 GCTGAGCGGCTGAGGGAAGCTGG - Intergenic
999927743 5:156397661-156397683 TCTAAGCTGCTCGGGGAGACAGG - Intronic
1000854116 5:166378646-166378668 TGCCAGCTGCTGTGGCAGGCAGG + Intergenic
1002129184 5:177069338-177069360 TCTCAGCTGCTCGCTGAGGCAGG + Intronic
1002334474 5:178468509-178468531 TGTGAGCAGATGAGGGAGGCAGG - Intronic
1002457672 5:179354880-179354902 TCTCAGCTGCCCCAGGAGGCAGG - Intergenic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003644181 6:7901106-7901128 TCTGAGCTGCTGAGGAAGCTGGG - Intronic
1003846038 6:10174271-10174293 TCTCAAGAGCTGAAGGAGGCAGG + Intronic
1003964682 6:11241781-11241803 CCTCAGCTGATGAGGGCAGCGGG - Intronic
1004275067 6:14228913-14228935 TCTAAGCTCCTGAAGGATGCTGG + Intergenic
1005699956 6:28390655-28390677 TCTCTGATGCTGAATGAGGCTGG + Exonic
1006680561 6:35794197-35794219 TCCCAGCTACTAGGGGAGGCTGG + Intergenic
1007324561 6:41050012-41050034 TCTGAGCTGTTGGGAGAGGCAGG + Intronic
1007473733 6:42106174-42106196 TCTCTGCTGCTGAGGAGAGCCGG + Exonic
1008413191 6:51207199-51207221 TCTTGGCTGCTGTGGGAGGAAGG - Intergenic
1008532801 6:52480022-52480044 TTTCAGCTGTGGAGGGAGGCTGG - Intronic
1011657876 6:89567826-89567848 ACTCAGCGGCTGAGGGACCCTGG - Intronic
1012044481 6:94252654-94252676 TGTCAGCTACTGAGGCAGGGAGG - Intergenic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1013932691 6:115553636-115553658 GCTCAGGTGATTAGGGAGGCTGG + Intergenic
1014806887 6:125839558-125839580 TCAAAGCTGCGGAGGGAGGGAGG - Intronic
1015866923 6:137736535-137736557 TCTCAGCTGCTTGAGCAGGCAGG + Intergenic
1016023504 6:139260106-139260128 TCCCAGCTACTTGGGGAGGCAGG + Intronic
1016781727 6:147966655-147966677 TCCCAGCTACTTGGGGAGGCTGG - Intergenic
1017878818 6:158545521-158545543 TTCCAGCTGCTGTGGGATGCAGG + Intronic
1018186486 6:161269522-161269544 TCCCAGCTGCTGGGGGAGGGGGG + Intronic
1018669182 6:166165947-166165969 TCTCTGCTGTTGAGGGAAGTGGG + Intronic
1018834453 6:167472559-167472581 TCTCAGCTTCTGGGGAAGCCTGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019211471 6:170408769-170408791 TCTGAGCAGCTGAGGGACCCTGG - Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1023664160 7:42503158-42503180 TCTCAGATTCTGTGGGATGCAGG - Intergenic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1024118656 7:46215937-46215959 TCTCTGCTGCTGGGTGAAGCAGG - Intergenic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1024587678 7:50855696-50855718 CCTCAGCCTCTGAGGCAGGCTGG + Intergenic
1024980809 7:55156167-55156189 TGGCAGCTGCTGAGCGGGGCTGG - Intronic
1025235902 7:57234756-57234778 CCTCAGCCTCTGAGGGATGCGGG + Intergenic
1025284165 7:57649109-57649131 TCACATCTGGTGAGGCAGGCAGG + Intergenic
1026452275 7:70539933-70539955 TCTCAGCCACTGAGGAAGCCCGG + Intronic
1028173742 7:87628971-87628993 TCTCAGCCCCGGCGGGAGGCTGG - Intronic
1028494286 7:91447066-91447088 TTTCAGGTGCTGAGGGAGGTGGG - Intergenic
1028824205 7:95250753-95250775 TCTCAGCTGTTGAGAGAATCAGG + Intronic
1029086191 7:98013570-98013592 TTCCAGCTGCTGCGGGAGGAGGG - Intergenic
1029332376 7:99869566-99869588 TCTCAGCTACTCAGGGCGGTGGG - Intergenic
1029364104 7:100106399-100106421 GCTCAGCTCCTGAGACAGGCTGG - Exonic
1032174787 7:129613780-129613802 TCCCAGCTGCTGGGAGGGGCGGG + Intronic
1032224368 7:130019163-130019185 TCCCAGCTACTGGGTGAGGCAGG - Intronic
1033719105 7:144038001-144038023 TCACAGCCACTGAGGGAGGGAGG + Intergenic
1034034994 7:147809864-147809886 TGTGAGGTGCTGAGGAAGGCTGG + Intronic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035875659 8:3186695-3186717 TCTCTACTGCAAAGGGAGGCTGG - Intronic
1035929747 8:3766992-3767014 TCTCAGATGTTGAGGGCTGCTGG - Intronic
1036590913 8:10167198-10167220 ACTCAGCTGCAGTGGGAGCCCGG - Intronic
1036937354 8:13015991-13016013 TCCCAGCTACTTTGGGAGGCTGG + Intronic
1037049450 8:14352255-14352277 TATCAGCTACTGAGTGAGGAAGG + Intronic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037993531 8:23337349-23337371 TCACAGCTCCTCAAGGAGGCTGG + Intronic
1038251822 8:25911974-25911996 TCTCTGCTTCTGAGGCAGGGAGG + Intronic
1038292460 8:26262146-26262168 TCTCAGCGCCAGAGGGATGCAGG + Intergenic
1038462911 8:27731399-27731421 CCTCAGCTGTTGATGTAGGCAGG + Intergenic
1038762805 8:30400337-30400359 TCCCAGCTACTTTGGGAGGCTGG - Intronic
1039743113 8:40400053-40400075 TGAAAGGTGCTGAGGGAGGCAGG - Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041901918 8:62992128-62992150 TCCCAGCTACTCTGGGAGGCAGG - Intronic
1042228875 8:66537160-66537182 GGTCAGCTCCTGAGGGAGGGAGG + Intergenic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1044750215 8:95408473-95408495 TCTCAGCTGCTGAGAGATAGAGG + Intergenic
1048496721 8:134941781-134941803 TCTCAGAGCCTGAGGCAGGCTGG - Intergenic
1048526514 8:135207802-135207824 TCTCAGGTGCTCAGGGAAGGTGG + Intergenic
1048907749 8:139104708-139104730 TCTGAGATGCTGAGGCAGGGAGG + Intergenic
1049129011 8:140820215-140820237 TCCCAGCTACTCAGGGAGGCTGG - Intronic
1049287779 8:141785853-141785875 ACTCAGTTGCTGCGGGTGGCAGG + Intergenic
1049311532 8:141936243-141936265 TTCCTGCTGCTGAGGGGGGCTGG - Intergenic
1049469788 8:142770180-142770202 TCCCAGCCTCTGAGGGAGACCGG - Intronic
1049624231 8:143612960-143612982 TCACCGCTGCAGAGGCAGGCAGG + Exonic
1049783718 8:144440578-144440600 TCCCAGCTGCCGAGGGTGGATGG + Intronic
1049796133 8:144498074-144498096 TCTCTGCTCCGGAGGGAGGCAGG - Intronic
1049848850 8:144820105-144820127 ACACAGCTGCTGTGGAAGGCAGG + Intergenic
1050330269 9:4538760-4538782 ACTCAGCTCTTTAGGGAGGCAGG + Intronic
1050359641 9:4817605-4817627 TCCCAGCTACTCAGGGGGGCAGG - Intronic
1050890436 9:10818541-10818563 TCCCACCTGGTGAGGGAGGGAGG - Intergenic
1052696754 9:31888429-31888451 CCTCCGCTGCTGAGGCAGACAGG - Intergenic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1054812556 9:69446599-69446621 TGGCAGCTGCAGAGGGAGTCAGG + Intronic
1055554385 9:77460344-77460366 TCCCAGCTGCTGCTGGTGGCCGG - Intronic
1056578300 9:87872299-87872321 TCTGAGCTGCTGAGCCAGGCGGG - Intergenic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057449285 9:95142477-95142499 TCTCAGAAGCTGAGGGGGGTTGG - Intronic
1058307307 9:103459878-103459900 TCTCACCTAACGAGGGAGGCAGG + Intergenic
1058777859 9:108302913-108302935 TCACTTCTGCTGAAGGAGGCAGG + Intergenic
1058985697 9:110207214-110207236 TCCCACCTGCTAAGGGAGCCAGG - Intronic
1059501452 9:114757323-114757345 TCTCAGCTGCTTAGGGCAGAGGG - Intergenic
1059586391 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG + Intergenic
1060892098 9:127195451-127195473 GCTCAGCAGCTGATGGAGGAAGG + Intronic
1061320922 9:129828845-129828867 TCTCAGCTGCTGGGGAAGCTGGG - Intronic
1061661192 9:132131390-132131412 TTTCAGCAGCTCAGGGAAGCAGG - Intergenic
1062324392 9:136005222-136005244 TCCTAGCTGCTGAGGGGGCCTGG + Intergenic
1062413728 9:136437719-136437741 TGTCAGCCGCGGCGGGAGGCAGG - Intronic
1062571992 9:137190022-137190044 TCTCAGGTGCCGAGAGGGGCAGG + Exonic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203631106 Un_KI270750v1:73371-73393 TCCAAACTCCTGAGGGAGGCGGG + Intergenic
1186992159 X:15082025-15082047 TCAAAGATGCTGAGGCAGGCTGG - Intergenic
1187476082 X:19612378-19612400 TCCCAGCTACTTGGGGAGGCTGG - Intronic
1187547732 X:20268445-20268467 TCACACCTGCTTAGGGAGGCAGG - Intergenic
1188513972 X:30965350-30965372 TCCCAGCTACTCAGGGAGGCTGG + Intronic
1189015387 X:37091576-37091598 TCCCAGCTACTTTGGGAGGCTGG - Intergenic
1189236283 X:39489661-39489683 ACTCACCTGATGAAGGAGGCAGG + Intergenic
1189357888 X:40325306-40325328 TCTCTGCAGCTGAGGCAGACCGG - Intergenic
1190211855 X:48455212-48455234 TCTCAGCTACTCAGGGAGGCTGG - Intergenic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1191673835 X:63774230-63774252 TGACAGCTGCTGGTGGAGGCAGG + Intronic
1193357818 X:80542594-80542616 TGTCAGCTGGTGTGGGATGCTGG - Intergenic
1193506471 X:82349962-82349984 TCTCTGCTGCTGAGGATGGTGGG - Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1198688920 X:139259257-139259279 TCTACTCTGCTGAGGCAGGCTGG + Intergenic
1198952956 X:142093831-142093853 TCCCAGCTGCTGATGGTTGCCGG - Intergenic
1199724175 X:150565699-150565721 TCTCTGCAGTTGGGGGAGGCAGG - Intergenic