ID: 927484107

View in Genome Browser
Species Human (GRCh38)
Location 2:23477241-23477263
Sequence CCCCTGCTGCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 402}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927484107_927484111 -2 Left 927484107 2:23477241-23477263 CCAGCTTCCCTCTGCAGCAGGGG 0: 1
1: 0
2: 5
3: 51
4: 402
Right 927484111 2:23477262-23477284 GGCAGAACATCAGACCAACAAGG 0: 1
1: 0
2: 0
3: 18
4: 207
927484107_927484114 26 Left 927484107 2:23477241-23477263 CCAGCTTCCCTCTGCAGCAGGGG 0: 1
1: 0
2: 5
3: 51
4: 402
Right 927484114 2:23477290-23477312 GCCACGTCCAGATTCTCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927484107 Original CRISPR CCCCTGCTGCAGAGGGAAGC TGG (reversed) Intronic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900401385 1:2474280-2474302 CCGCAGCTGCAGCGTGAAGCCGG - Intronic
900420444 1:2553804-2553826 GTGCTGCTGCAGAGGGAAGCTGG - Intergenic
900423982 1:2567854-2567876 GTGCTGCTGCAGAGGGAAGCTGG + Intergenic
900607527 1:3530536-3530558 TCCCAGCTGCAGAGAGAGGCAGG + Intronic
900763478 1:4488329-4488351 CCTCTACAGCAGAGGGCAGCTGG - Intergenic
900794151 1:4697951-4697973 ACGCTGGTGCAGAGTGAAGCTGG - Intronic
901069035 1:6508163-6508185 CCCCTGCTGCAGCGGTCACCTGG + Intronic
901379633 1:8864255-8864277 CCCCTGCTGCAGGAGTAGGCTGG - Intronic
902085311 1:13855777-13855799 CCCAGGCTGCACAGAGAAGCAGG - Intergenic
902429490 1:16352214-16352236 CCCGGGCCGCAGAGGGGAGCCGG - Intronic
902444225 1:16451906-16451928 CCCCTGGGGGAGGGGGAAGCAGG - Exonic
902587826 1:17451861-17451883 TCCTTGCTTCAGAGGGAAGGAGG + Intergenic
902624495 1:17668653-17668675 CCCCTGCTGCAGAGGCTCCCTGG - Intronic
902944562 1:19825484-19825506 CCTCTGCTGGAGAGGGCAGCAGG - Intergenic
903083945 1:20837980-20838002 CTCTAGCTGCAGACGGAAGCAGG + Intronic
903177142 1:21587926-21587948 CCTTTGCTGGAGATGGAAGCTGG - Intergenic
903499849 1:23794914-23794936 CCCCTGCTGCAGACAGAGCCAGG - Exonic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
904878804 1:33678540-33678562 CAGCTGCTGCAGGGGGAAGGGGG + Intronic
905124450 1:35707486-35707508 CCCCTGCTGGAGACGGAGGTTGG + Intergenic
905346919 1:37317697-37317719 GCCCTGCTGAAGAAGGAAGGTGG + Intergenic
906149449 1:43579045-43579067 CTGCTGCTGCAGAAAGAAGCAGG - Intronic
906246811 1:44282067-44282089 CCCCTGTAGCAGAGTGGAGCAGG - Intronic
906318668 1:44803734-44803756 CCCTAGCAGCTGAGGGAAGCCGG + Intronic
906732164 1:48092112-48092134 CGCCAGCAACAGAGGGAAGCAGG + Intergenic
908127075 1:61042966-61042988 CCCCTCGCGAAGAGGGAAGCGGG + Intronic
911799756 1:102121226-102121248 ACCCTGCTGCAGAGAAGAGCAGG - Intergenic
912152993 1:106882289-106882311 CACCTTCTCCACAGGGAAGCAGG + Intergenic
913185028 1:116363066-116363088 CCCTTGCTGGATAGGGATGCAGG - Intergenic
913286684 1:117233058-117233080 CCCTTCCCGCAGAGGGAAGGAGG - Intergenic
913371383 1:118103435-118103457 CCTCTGCTGCTGAGGAAGGCTGG - Intronic
915035733 1:152922465-152922487 CACCTCCTGCAGAGGGAAGATGG - Intergenic
915243105 1:154537785-154537807 CGCCTGCTCCAGAGTGATGCTGG - Intronic
915458447 1:156055097-156055119 CCCCTGTCGAAAAGGGAAGCCGG + Intronic
915662516 1:157415928-157415950 CTCCTGCTGCAGTGGGGTGCCGG + Intergenic
917972692 1:180219037-180219059 TCCCTGCTCCAGACTGAAGCAGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920414205 1:205787626-205787648 GCCGTCCTGCAGAGGGAACCAGG - Intergenic
921080762 1:211737069-211737091 CCCATGCTGCACTGGGAGGCTGG + Intergenic
923166068 1:231363413-231363435 CCTCTGCTGCAAAAGGAAGTGGG - Intergenic
923942622 1:238844581-238844603 CCTCTGCTGGAGTAGGAAGCTGG - Intergenic
924899788 1:248385127-248385149 ACCCTGCTGCAGAGAAAATCTGG + Intergenic
1063196138 10:3745522-3745544 CACCTGCTCCAGAAGGCAGCTGG - Intergenic
1063701430 10:8388591-8388613 CTCCTGCTCCAGTGGGAACCTGG - Intergenic
1064605155 10:17031522-17031544 TACCTGCTTCAGAGTGAAGCAGG - Intronic
1065797944 10:29324168-29324190 GACCTGCTGCACAGGTAAGCTGG + Intergenic
1067278976 10:44857140-44857162 CCCCAGCTGCAGGGGTCAGCTGG + Intergenic
1067804377 10:49382914-49382936 CACCTGCTGGAGAGGGACCCCGG + Intronic
1069572841 10:69504797-69504819 CCCCAGGGGCAGAGGCAAGCTGG - Intronic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1071559439 10:86633498-86633520 ACCACGCTGCAGAGGGGAGCTGG + Intergenic
1073178437 10:101570169-101570191 CGCCTCCTGCAGAGAGGAGCGGG + Intergenic
1073206908 10:101774451-101774473 CCCCAGCTGCAGGTGGAGGCAGG - Intronic
1073686054 10:105755047-105755069 CCCCTGCTACAGAGCGCAGTGGG + Intergenic
1074309197 10:112307827-112307849 CCCCTCCTGCAGAATGAAACTGG + Intergenic
1075955404 10:126519077-126519099 CCCTTCCAGCAGAGGGAACCAGG + Intronic
1075991561 10:126842969-126842991 CCCCTGCTGCACAGGAAATGTGG + Intergenic
1076616584 10:131759151-131759173 AGCCAGCTGCTGAGGGAAGCTGG - Intergenic
1077107320 11:847867-847889 CCCCAGCCACAGAGGGACGCAGG + Intronic
1077132105 11:978198-978220 CTCCTGCTGCACATGGCAGCCGG + Intronic
1078426361 11:11254165-11254187 CCCCTGGGCCAGAGGCAAGCAGG - Intergenic
1078884641 11:15488344-15488366 CCCTAGCTTCAGAGGGAGGCAGG - Intergenic
1078986694 11:16605153-16605175 CCCCGGCTGCAGAGGAACGGCGG + Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1080937871 11:36882500-36882522 CCCCTCCTGCAAAGGGAGGCAGG + Intergenic
1081808933 11:45904602-45904624 TCCCTGGGGCAGAGGGACGCAGG + Intronic
1083204280 11:61138722-61138744 CCCCTGAGGTAGAGGGAGGCTGG - Exonic
1083421276 11:62554586-62554608 TTCCTGCTGCAGAGGGGAGGGGG + Intronic
1083656924 11:64234412-64234434 CCCCTGCCGCGGCGGGAGGCGGG + Intergenic
1083772760 11:64877771-64877793 GCCCTGCTGCTGAGGGGAGTGGG + Intronic
1083853256 11:65379783-65379805 ACCCTGCTGGAGAGGGAAGCTGG + Intronic
1084120469 11:67066134-67066156 ACACTGCTGCAGAGGCAAGGAGG - Intronic
1085150872 11:74252062-74252084 GCCCTGCTGCCAAGGAAAGCTGG + Intronic
1085298109 11:75442360-75442382 CACCTGGTGCTGGGGGAAGCCGG + Exonic
1086753123 11:90524599-90524621 GCACTGCTGCACAGGGAAGGAGG + Intergenic
1087141372 11:94768643-94768665 CCCCTGCTGCTCACGGAAGGGGG + Intronic
1088645527 11:111913507-111913529 CCCCAGCTGGGGAGGGCAGCAGG + Exonic
1089495179 11:118904520-118904542 CCCTTGGTGCTGAGGGCAGCTGG - Intronic
1090042311 11:123301834-123301856 CCCCGGGCGCCGAGGGAAGCGGG + Intergenic
1090360927 11:126172081-126172103 CACCTGCTGTAGAGGGATCCCGG + Intergenic
1091786007 12:3243807-3243829 CCCCTGCTGCCTAGAGCAGCTGG - Intronic
1091994496 12:4982580-4982602 CCCCTGCTTCAGAGGGAGCCAGG - Intergenic
1094491830 12:30965524-30965546 CCCCTGCAGCACTGGGAAACAGG + Intronic
1097237493 12:57550076-57550098 CTCCTGCGGCAGCGGGATGCGGG - Exonic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1097585743 12:61514132-61514154 CCACTGCTGCAGTGGGAAGTTGG - Intergenic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1099202026 12:79689720-79689742 TCCCTGCCGCAGAGGTGAGCCGG - Exonic
1100786389 12:98083014-98083036 CTCCTACTGCTAAGGGAAGCTGG - Intergenic
1101988819 12:109468034-109468056 CCCCCGCTGCTGGAGGAAGCAGG - Intronic
1102009078 12:109607011-109607033 CCCCTGCTTCCAAAGGAAGCAGG - Intergenic
1103722077 12:122980561-122980583 CACCTCCCGCAGAGGCAAGCAGG - Exonic
1104482712 12:129122072-129122094 CCACTGCTGCAGAGCGATGCTGG + Intronic
1105824245 13:24108127-24108149 GCCCGGCTGCAGGGGGAAGGGGG + Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108064371 13:46562662-46562684 CCCCTGCTGTAGCTGGTAGCTGG + Intronic
1108363866 13:49691455-49691477 ACCATGCGGCAGAGGAAAGCAGG + Exonic
1108493743 13:51005089-51005111 CCCATGCTGCAGATGAAGGCAGG + Intergenic
1109024638 13:57142531-57142553 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109025625 13:57149101-57149123 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109026615 13:57155674-57155696 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109027607 13:57162245-57162267 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109028593 13:57168810-57168832 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109686415 13:65826855-65826877 CACCTGCTGCAGAGGGCACATGG + Intergenic
1110803129 13:79723666-79723688 CCCTTCTGGCAGAGGGAAGCTGG + Intergenic
1113510253 13:110848388-110848410 CCCCTTCTTCAGAGGGCGGCAGG + Intergenic
1113604962 13:111598495-111598517 GCCCTCCTGCCAAGGGAAGCGGG - Intronic
1113967407 13:114161874-114161896 CCCCTGGTGCAGAAGCAAGTTGG + Intergenic
1114533436 14:23409276-23409298 CCCCAGGAGCAGAGGGTAGCAGG - Intergenic
1114901570 14:27067009-27067031 CCTCTGCTGCAGACAAAAGCAGG - Intergenic
1115358518 14:32475576-32475598 CCAGTGCTGCAAAGAGAAGCTGG - Intronic
1116012455 14:39367053-39367075 GCCCTGCTGCTGATGGAGGCAGG + Intronic
1117537430 14:56715142-56715164 CTCCTGCTGCAGAGTGAAAAGGG - Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118595062 14:67428840-67428862 GGCCTGCTGGAGAGAGAAGCAGG + Intergenic
1118890804 14:69907081-69907103 CCTCTGGTGTAGAGGGAAGGAGG + Intronic
1119390390 14:74287674-74287696 TCCCTGCTGGAGAGGACAGCAGG - Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119468650 14:74879721-74879743 CCCATGCTGCATAGAGCAGCAGG - Intergenic
1119774660 14:77240769-77240791 CCCCAGCAGCTGGGGGAAGCAGG - Intronic
1119866589 14:77979925-77979947 TGGCTGCTGCAGAGGTAAGCAGG + Intergenic
1122241101 14:100368073-100368095 CCCCCACTTCAGAGGGAAGCAGG + Intronic
1202902506 14_GL000194v1_random:51730-51752 TGCCTGCTGCAGGGGGATGCAGG - Intergenic
1125477226 15:40055433-40055455 CACCTGGTTCAGAGGGCAGCTGG - Intergenic
1125968909 15:43896162-43896184 TACCTGCTGCAGAGTGTAGCTGG - Intronic
1126725989 15:51632963-51632985 GCTGTGCTGCAGAGAGAAGCAGG + Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128795434 15:70463177-70463199 GCCCTGGAGCAGAGGGGAGCTGG + Intergenic
1129907390 15:79198084-79198106 TGCAGGCTGCAGAGGGAAGCAGG - Intergenic
1130048678 15:80465473-80465495 GCCCTGCTGCAGATGGCACCAGG - Intronic
1131311831 15:91297300-91297322 CCTCTGCAGCAAAGGGAGGCTGG - Exonic
1132540566 16:506826-506848 CCCCTGCTGCAGAGTGGAGAGGG + Intronic
1132686336 16:1163670-1163692 CCCGGGCTGCTGGGGGAAGCTGG + Intronic
1132984913 16:2760357-2760379 CCCCTGCTTCAGGGCGACGCGGG + Exonic
1133126114 16:3647052-3647074 CCCCTGCTTCAGAGGACAGCAGG + Intronic
1134110538 16:11512888-11512910 CCCATGGTGCAGAGCGAAGTCGG + Intronic
1134263762 16:12674953-12674975 CCCCTCCAGCAGTGAGAAGCTGG - Intronic
1135561347 16:23479240-23479262 TGCCTGCTGCTGAGGGAATCAGG - Intronic
1135561370 16:23479374-23479396 TGCCTGCTGCTGAGGGAATCGGG - Intronic
1135561383 16:23479440-23479462 TACCTGCTGCTGAGGGAATCAGG - Intronic
1136398409 16:30005209-30005231 CCCCTGCTGCAGATGGCGGTGGG + Exonic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137512097 16:49110033-49110055 CCCCAACTCCAGAGAGAAGCAGG - Intergenic
1137600820 16:49755047-49755069 CTCCTGCTGAGGAGGGAGGCAGG - Intronic
1137982331 16:53080501-53080523 CCCCTGCTGCCCAAGTAAGCTGG + Intronic
1140945955 16:79768676-79768698 CTCCTGCTGCGAAGGGAAGAAGG + Intergenic
1141598363 16:85111031-85111053 CACCTGCTGCAGGGGGGCGCCGG - Intronic
1141998413 16:87649118-87649140 CCTCTGCTGCAGAGAGGGGCGGG + Intronic
1142003184 16:87675726-87675748 TCCCAGCTGCAGCAGGAAGCAGG + Intronic
1142144038 16:88485260-88485282 CCCCTGGTGCTGGGGGGAGCAGG + Intronic
1142408504 16:89904296-89904318 CCCCTCCTGCTGCTGGAAGCAGG - Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143551892 17:7635447-7635469 CCCCTTCTGCAGAGATCAGCCGG + Intergenic
1143674585 17:8422533-8422555 CCCTTCCAGGAGAGGGAAGCAGG - Intronic
1144668268 17:17116714-17116736 CCCCAGCTGCAGATGCATGCGGG - Intronic
1144957079 17:19024151-19024173 CCCCTGCTGCAGATGGCAGGAGG + Intronic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1145809883 17:27758306-27758328 CCCCTTTTACAGAGGGAAGGGGG - Intronic
1146498516 17:33344255-33344277 CCCCTGCTTCAGAGAAAAGCTGG - Intronic
1146662723 17:34675312-34675334 CCCCTGATGCCCAGGGAGGCAGG + Intergenic
1147325373 17:39667377-39667399 CCGCTCCTTCGGAGGGAAGCTGG + Intergenic
1147660790 17:42115831-42115853 ACCCTGCGGGGGAGGGAAGCAGG + Exonic
1149991487 17:61385971-61385993 CACCTGCTGGGGAGGGAGGCTGG + Intronic
1150676323 17:67247570-67247592 CCACTGCTGGTGAGGGAAGGTGG - Intergenic
1151783880 17:76265765-76265787 CCCCACGTGCAGAGGGGAGCCGG - Intronic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1156375610 18:36512573-36512595 CCCCAGCTGCAGGGGGGATCTGG + Intronic
1159131779 18:64288187-64288209 ACCGTCCTGCAGAGGGAAGCAGG - Intergenic
1159496425 18:69213343-69213365 CACCTTCTGCACAGGGCAGCAGG + Intergenic
1159773420 18:72575597-72575619 CCCCTGTTTCAGAGGGCTGCCGG + Intronic
1159895998 18:73996612-73996634 CCCCTGCAGCAGAGGACAGGTGG - Intergenic
1160464830 18:79068369-79068391 CACCCGCTGCAGCTGGAAGCCGG - Intergenic
1160735480 19:660417-660439 CCCCTGCGTCAGAGGCAGGCAGG + Intronic
1160979861 19:1811971-1811993 CCCCTGCGGCTGCGGGAAGACGG - Intronic
1161124461 19:2547910-2547932 CCCCTGCTGCAGAGCCCAGAGGG - Intronic
1161171003 19:2812520-2812542 CCCCTGCTGCTGAGGTGAGGGGG + Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1162023402 19:7879238-7879260 CCCCTGCTGCAGACAGAGCCAGG + Intergenic
1162316190 19:9939593-9939615 GCCCTGATACAGAGGGGAGCAGG - Intergenic
1162320052 19:9966424-9966446 CCCCTGCCGCAGAGCCAGGCAGG + Exonic
1162567256 19:11451217-11451239 CCCCTGCTGCAGACAGACCCAGG + Intergenic
1162698463 19:12495697-12495719 CTCCCGCCGCAGAGTGAAGCTGG + Intronic
1163324121 19:16592263-16592285 CCCCTCCTGCAGATGGAACTTGG - Intronic
1163527464 19:17830405-17830427 CCCATGCTAAAGAGGGACGCAGG + Intronic
1163943702 19:20517188-20517210 CTCCACCTGCTGAGGGAAGCCGG - Intergenic
1164037310 19:21466355-21466377 CCCCAGCTCCAGAGAGAAGCAGG + Intronic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164089884 19:21940608-21940630 CTCCTGACGCAGAGGGAGGCTGG + Intronic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1164737349 19:30551629-30551651 CCTCTGCTGCAGAAGCAACCAGG - Intronic
1164753783 19:30674722-30674744 TCCCAGCTACAGAGGCAAGCTGG - Intronic
1164937611 19:32227563-32227585 GGCCTGCTGTGGAGGGAAGCAGG + Intergenic
1166079307 19:40433939-40433961 CGCCTGCTGGGGAGGGAGGCAGG + Intergenic
1166181430 19:41111970-41111992 CTCCTGCTACAGAGGGAACTTGG - Intergenic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167019564 19:46863203-46863225 CCTCTGCTGCAGAGGCAAAGGGG + Intergenic
1167065632 19:47183768-47183790 CCCCTCTTGCCGAGGGAAGATGG - Intronic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1202635640 1_KI270706v1_random:41567-41589 CCTCAGCTGCACAAGGAAGCAGG - Intergenic
925289812 2:2739991-2740013 CACCTGCTGGAGAGAGAAGGAGG + Intergenic
925814578 2:7735200-7735222 CCCCTTCTGCAGGGGGCAGGTGG + Intergenic
927204041 2:20595764-20595786 CCCCTGCTGGGCAGGGAAGTGGG + Intronic
927216352 2:20669785-20669807 CCCCTTCGGCAGAGCGAAGTTGG + Intronic
927217094 2:20673904-20673926 CACCTGCTCCAGAGGAAATCTGG - Intergenic
927240361 2:20915465-20915487 CCCCAGCAGCAGAGGAAAGATGG - Intergenic
927318917 2:21720109-21720131 CCCCTTCTGCAGAAGGGAGCTGG - Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927633642 2:24795507-24795529 CCCTTGGTGTAGAGGGAATCAGG + Intronic
927714048 2:25341439-25341461 CCCCTGCGGCAGCGGCGAGCCGG + Intronic
930017312 2:46979784-46979806 CCTCTGCTGCAGAGACAGGCAGG - Intronic
931137031 2:59414461-59414483 CCCCAGCTGCAAAAGTAAGCAGG + Intergenic
932124688 2:69133106-69133128 CCCCTTCTGCAAAGCGAAGCTGG + Intronic
934098150 2:88626842-88626864 CCTCGGCTGCGGAGGGCAGCTGG - Intronic
934504155 2:94878666-94878688 TGCCTGCTGCAGGGGGATGCAGG + Intergenic
936025211 2:109026501-109026523 CCCTTGCTTCAGAGGGAAGAGGG - Intergenic
936154551 2:110039717-110039739 CCCCTGTTTCAGAGAGAAGAGGG + Intergenic
936190132 2:110331697-110331719 CCCCTGTTTCAGAGAGAAGAGGG - Intergenic
937046376 2:118854096-118854118 CCCCTGCTCCAGCAGAAAGCTGG + Intergenic
937096934 2:119241684-119241706 CCGCTGCAGCCGAGGGGAGCTGG - Intronic
937390550 2:121482251-121482273 GTCCAGGTGCAGAGGGAAGCTGG - Intronic
937460640 2:122082821-122082843 GCCCTTCTGCAGAAAGAAGCTGG + Intergenic
942179942 2:173370861-173370883 ACCCTGCTGAACAGGGAGGCTGG + Intergenic
942456741 2:176143227-176143249 CCACTGGGGCAGAGGGAAGTGGG + Intergenic
943541650 2:189222723-189222745 CCCCTTCTGAGGAGGAAAGCAGG - Intergenic
945016251 2:205520176-205520198 CCTCTGCTCCAGAGAGATGCAGG + Intronic
946152547 2:217786039-217786061 TCCAGGCTGCACAGGGAAGCAGG - Intergenic
946155277 2:217803012-217803034 CCCATGCAGCAGAGGGCAGAAGG - Exonic
946836210 2:223775082-223775104 CCAGTGCTGCAGCGAGAAGCAGG + Intronic
947466104 2:230347839-230347861 GCCCAACTGCAGAGGCAAGCTGG - Intronic
947874201 2:233457751-233457773 CCCCGACTGCAGTGGGCAGCAGG + Intronic
948041101 2:234902214-234902236 CCTCTCCTGCAGAGCCAAGCAGG + Intergenic
948137246 2:235645680-235645702 CCCTTCCTGCAGAGGGAGGTGGG + Intronic
948151700 2:235749610-235749632 CGCCTGAGGCAGAGGGCAGCAGG - Intronic
948191771 2:236064672-236064694 ACACTGCTGCAGAGGGACCCAGG + Intronic
949017460 2:241721438-241721460 CCCCTGTGCCAGAGGGCAGCGGG + Intronic
1169058296 20:2641725-2641747 CCCCTCCTGGTTAGGGAAGCTGG - Exonic
1170585790 20:17732927-17732949 ACCCTGCTCCCCAGGGAAGCTGG - Intronic
1170905244 20:20509530-20509552 CCCCTTCTGCAGAGGGAATCAGG + Intronic
1171063922 20:21994671-21994693 CCCCTGGTGCAGAGAGGAGAAGG + Intergenic
1171249930 20:23639102-23639124 TACCTGGTGCAGGGGGAAGCTGG - Intergenic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172192011 20:33067742-33067764 CCCCTCCAGCATGGGGAAGCTGG + Intronic
1172602028 20:36190602-36190624 AGCCTGCAGCAGAGGGATGCAGG - Exonic
1172602156 20:36191174-36191196 AGCCTGCAGCAGAGGGATGCAGG - Intronic
1172803971 20:37598195-37598217 CGGCTGCTGCAGAGGGGAGGTGG - Intergenic
1173171112 20:40724650-40724672 CCCCTGCTGCTCAAGGAATCAGG + Intergenic
1173545564 20:43895125-43895147 ACCCTGCAGCAGAAGGCAGCAGG + Intergenic
1174168179 20:48599485-48599507 CCACTGACACAGAGGGAAGCAGG + Intergenic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1175686298 20:61031101-61031123 GCCCTGCTGCTGAGGGGAGAGGG - Intergenic
1175689033 20:61052651-61052673 CAGCTGCTGCACAGGGAAGCTGG - Intergenic
1175696407 20:61106137-61106159 CCCCTCCTGCAGTGGGCAGAAGG - Intergenic
1175730423 20:61350274-61350296 CCAGTGCTGCAGAGGCCAGCGGG + Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176008807 20:62880925-62880947 GTCGTGCTGCAGCGGGAAGCCGG + Exonic
1176062868 20:63179861-63179883 CGCCTGCTGCAGACACAAGCAGG + Intergenic
1176103804 20:63376423-63376445 TCCCTGCTGCAGAGGAAGCCGGG + Intronic
1176111597 20:63413419-63413441 CCCCTGCTGGACAGGCAGGCGGG + Intronic
1176164472 20:63665476-63665498 GCCATGCTGCAGAGGGGAGTGGG + Intronic
1176514557 21:7774303-7774325 CCTCTGCTGGAGTGGGCAGCGGG - Intergenic
1176621872 21:9066497-9066519 TGCCTGCTGCAGGGGGATGCAGG - Intergenic
1178305055 21:31484451-31484473 CCCCGGAGGCAGAGGCAAGCTGG - Intronic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178648670 21:34404827-34404849 CCTCTGCTGGAGTGGGCAGCGGG - Intronic
1178932250 21:36829808-36829830 CCTCTCCCGCAGAGGGAAGGAGG + Intronic
1179641349 21:42749419-42749441 CCCCTGCAGCAGAGTGCACCAGG - Intronic
1179808655 21:43856110-43856132 CCCCTGCTGCAGACAGTGGCAGG - Intergenic
1181050753 22:20237261-20237283 CCCCTGCAGCAGACAGAGGCAGG + Intergenic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1181674818 22:24444748-24444770 CACCTGCTGTAGAGGGGGGCTGG - Intergenic
1182702676 22:32253266-32253288 CCTCTGCTGCAGTGGGACCCTGG + Intronic
1182745204 22:32600487-32600509 CCCCTGCTCCAGAGGAAATGAGG + Intronic
1183455791 22:37922364-37922386 CTCCTGCTGCAGACTGGAGCGGG - Exonic
1183607341 22:38873180-38873202 CCCCTCCTCAAGTGGGAAGCTGG - Intergenic
1183718445 22:39548144-39548166 CCCAGCCTGCAGAGGGGAGCAGG - Intergenic
1184040671 22:41941374-41941396 CTCCTGCTGCGGCGGGAACCAGG + Intronic
1184153025 22:42649380-42649402 CCCCTGCTCCGGAGTGACGCGGG - Intronic
1184322465 22:43752947-43752969 CCCCTACTGATGAGTGAAGCTGG - Intronic
1184330813 22:43826327-43826349 CCACAGCCTCAGAGGGAAGCTGG - Intronic
1184674949 22:46036458-46036480 CCCCTTCTGCACAGGGAGGAAGG + Intergenic
1184735447 22:46395193-46395215 CCACTGCTGCAGGGGGATGAAGG - Intronic
1184791672 22:46703916-46703938 CAGCTGGTGCAGAGGGCAGCAGG - Intronic
1185028388 22:48428306-48428328 TCCCTGTTCCAGAGAGAAGCTGG + Intergenic
1185242722 22:49755236-49755258 GGCCTGCTGTGGAGGGAAGCAGG - Intergenic
949548896 3:5096226-5096248 CCCCCGCTGCCTAGGGAAGGTGG - Intergenic
950581630 3:13866111-13866133 CTCCTGCTGCAGAGAGGAGTTGG + Intronic
950624160 3:14232031-14232053 TCCCAGCTGCAGAGGTGAGCTGG - Intergenic
952902665 3:38120399-38120421 CTCCGGCTGCAGAGGGCAGGTGG - Intronic
952927241 3:38329097-38329119 CTCCAGCTGCAGAGGGCAGGTGG + Intergenic
953358389 3:42273709-42273731 CCTCAGCTTCAGAGAGAAGCTGG - Intergenic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
953902876 3:46853053-46853075 ACCCTGCTTGAGGGGGAAGCTGG + Intergenic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
954110920 3:48432549-48432571 CCCCTGCTCCAGCAAGAAGCTGG + Exonic
956421906 3:69094360-69094382 CCCTGGCTGCAGAGGCAGGCAGG + Intronic
957755903 3:84487220-84487242 ACCCTGATGCAGAGGGCAACGGG + Intergenic
960449628 3:117790526-117790548 CCCCTGTGGGAGAGGCAAGCTGG - Intergenic
960969475 3:123129411-123129433 ACCCGGCTGCGGAGGGAAGTGGG + Intronic
961112537 3:124297297-124297319 GCCCAGTTGCAGAGTGAAGCAGG - Intronic
961193548 3:124982744-124982766 CCCCGGCTGCAGATGGAAGGGGG - Intronic
961308329 3:125975468-125975490 CCCCTTCTTCTGAGGGAAGGAGG - Intronic
961353826 3:126321463-126321485 GCACTGCTGCAGATGGAACCAGG - Intergenic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
961869646 3:129978034-129978056 GCTCTGCTGCAGAGGGAATCAGG + Intergenic
963274595 3:143317470-143317492 CTCCTGCTGCTGTGGGAATCAGG - Intronic
965071794 3:163924294-163924316 TCCCTGCTGTAGAAGGAAGTAGG + Intergenic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
966926154 3:184645864-184645886 CCCCTGAGGCTGAGGGCAGCTGG + Intronic
968007786 3:195254861-195254883 CCCCTGCTACAGAGAGGAGGTGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969312539 4:6362290-6362312 CCCATCCTGAAGAGGGAAGCAGG + Intronic
969621651 4:8281744-8281766 CCCCTACTGCTGACGGCAGCAGG + Intronic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
970174401 4:13324210-13324232 CCACTGCAGTAGAGAGAAGCAGG + Intergenic
970364719 4:15346922-15346944 CCCCTGTTGCATAAGGAAGAAGG - Intronic
970511846 4:16788891-16788913 GCCCTGCTGCAGTGGGCTGCTGG - Intronic
970579128 4:17458249-17458271 CCCCTGTTGCAAGGGGAATCAGG - Intergenic
971405763 4:26320038-26320060 CCACTACTGCACAGGGAACCGGG - Intronic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
974101624 4:57423333-57423355 CACCTTCTTCACAGGGAAGCAGG - Intergenic
978628126 4:110711004-110711026 CATCTGCTGCAGAGGGAAGTTGG - Intergenic
981573530 4:146178392-146178414 CCCCTGCTGCCGAGGAAGGAGGG + Intronic
984791567 4:183619579-183619601 CCCCTCCTGCAGGGGGAGGGGGG + Intergenic
984928277 4:184825715-184825737 CTCCGGCTGCCGAGGGAAGCGGG + Intronic
984966264 4:185143129-185143151 TCCCAGCTGCAGAGGGCATCGGG - Intergenic
985658736 5:1145127-1145149 CCCCTTCTTCAAAGGGAACCTGG + Intergenic
985725986 5:1515891-1515913 TCCCTGCAGCTGGGGGAAGCAGG - Intronic
985761175 5:1749645-1749667 CCCCTGAGGCAGTGGGAAGCTGG - Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985905846 5:2835580-2835602 CGCGTGCTGCAGATGGAAGGTGG + Intergenic
985944119 5:3163496-3163518 GTCCTGCTGCTGAGTGAAGCCGG - Intergenic
986570265 5:9157145-9157167 AACCTGATGCAGAGGGAAGGGGG - Intronic
986785439 5:11110229-11110251 CACCTGCTGCAGCGGGAAGTAGG - Intronic
987088146 5:14488052-14488074 CCCCTTCTGCAGGGGGCTGCTGG - Exonic
993026732 5:82655379-82655401 TCCCTGGTGAAGGGGGAAGCAGG - Intergenic
995724565 5:115169872-115169894 CCGCTGCTGCAGCCGGCAGCTGG - Intronic
995995340 5:118291667-118291689 TTCCTGCTGGAAAGGGAAGCAGG + Intergenic
996597558 5:125222849-125222871 CCCCGGCTGGACAGGGAAGATGG - Intergenic
997418382 5:133747170-133747192 CCACTGCTGCAAAGGGCAGGAGG - Intergenic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
997675570 5:135710203-135710225 CTCCTGCTGCAAAGGGCAGCTGG + Intergenic
998188330 5:140000376-140000398 CCCCTGCCGCAGAGGCATGGAGG + Intronic
999124965 5:149239952-149239974 TCCCTGCTGCAGAGGGCACAAGG + Intronic
999768473 5:154757149-154757171 TCCCGGCTGCAGAGGAATGCTGG - Intronic
1001448839 5:171808390-171808412 CCACCTCTGCAGAGGGATGCGGG + Intergenic
1001600868 5:172927233-172927255 CCACTGCTGCACAGGGTACCTGG + Intronic
1002213543 5:177612157-177612179 CCCCTGCTGGAAAGGGCAGATGG + Intergenic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1004280462 6:14275739-14275761 CCCCTGATGCGCAGGGACGCAGG + Intergenic
1004872417 6:19920305-19920327 AGCCTGCTACAGAGGGCAGCAGG - Intergenic
1006610373 6:35291092-35291114 CTGCTCCTGGAGAGGGAAGCAGG + Intronic
1007453835 6:41960978-41961000 TCCCCTCAGCAGAGGGAAGCTGG + Intronic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1010832463 6:80547492-80547514 CACCTTCTTCACAGGGAAGCAGG - Intergenic
1014262023 6:119230411-119230433 CCCCTGGGGCAGAGAGCAGCAGG - Intronic
1014858386 6:126431548-126431570 CCCCTGCTTCACAATGAAGCTGG + Intergenic
1017032208 6:150234130-150234152 GCCCTGCTGCAGAGGGAAGTAGG + Intronic
1018739567 6:166717110-166717132 CCTCTGCAACAGAGGGAAGGAGG + Intronic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019612080 7:1941695-1941717 CTCCTGCTGCAGGTGGAAGCCGG - Intronic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1019901718 7:4026149-4026171 CCACGGCTGGAGAGGGGAGCTGG + Intronic
1020050151 7:5076130-5076152 TCCATGGTGCAGAGGGAACCTGG - Intergenic
1020140226 7:5607736-5607758 TGGCTGCTGCAGAGGGAAGTCGG + Intergenic
1020764605 7:12304096-12304118 CCTCTGCTGCAGGAGGAAGTGGG - Intergenic
1021708701 7:23393856-23393878 CTCCTGCTGCGGAAGGAAGGAGG + Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022905020 7:34847467-34847489 CCCAAGCTGCAGTTGGAAGCTGG + Intronic
1023850374 7:44146664-44146686 CCCCTCATGCAGGTGGAAGCCGG + Intronic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1024676219 7:51640091-51640113 CCCCTGAAGCACAGGGAACCAGG + Intergenic
1026542476 7:71292129-71292151 CCCCTTCTGCAGTGGGATTCCGG + Intronic
1026880093 7:73902342-73902364 CCCCTGCTGGAGAGGGACATGGG - Intergenic
1031249235 7:119358026-119358048 CTCCTGCTGCAGTGTGAAGAAGG - Intergenic
1032085505 7:128881427-128881449 CCCATGAGGCAGGGGGAAGCTGG - Intronic
1032350435 7:131158006-131158028 TCCATGCTGCAGTGGGAAGTGGG + Intronic
1032387274 7:131533487-131533509 CCTCTCCTGCCCAGGGAAGCAGG - Intronic
1034487078 7:151372770-151372792 GCCCCGCTGCACAGGGCAGCAGG - Intronic
1035046873 7:155973582-155973604 CCAGTGCTGGAGAGGGATGCAGG + Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035891142 8:3344543-3344565 CCCCTGCTAGTGAGGGAGGCAGG - Intronic
1037890551 8:22621803-22621825 CACCTGCTGCTGGGGGAACCAGG - Intronic
1037906385 8:22718272-22718294 CCCCAGCTGCAGAAGGGAGGAGG - Intronic
1038168932 8:25111027-25111049 CCACTGCTGCAGTGGGGAGATGG + Intergenic
1038238062 8:25781194-25781216 TCCCTGTTTAAGAGGGAAGCTGG - Intergenic
1038424948 8:27458915-27458937 CCCTTGATGCACAGAGAAGCTGG + Exonic
1038583309 8:28768929-28768951 CTCCTTCTGCAGAGAGGAGCCGG + Intronic
1039665479 8:39522614-39522636 CCCAGGCTGCAGTGGGAAGTGGG - Intergenic
1039877859 8:41602887-41602909 CTCCTGCGGCAGAGGGATGAGGG + Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042064975 8:64864633-64864655 CCCCTGCTGTGGGGAGAAGCTGG - Intergenic
1042683842 8:71416032-71416054 CTCCTGCGGCACAGGGAAGCAGG - Intronic
1042992595 8:74657244-74657266 GTGCTGCTGCAGTGGGAAGCTGG - Intronic
1043453437 8:80391564-80391586 CCCCTACTAGAGAGGTAAGCAGG - Intergenic
1043808279 8:84701690-84701712 CCCCTGCTGCAGAGCTGAGAAGG + Intronic
1043944195 8:86231367-86231389 CCCCAGGGGCAGAGGGAAGGAGG + Intronic
1045353995 8:101368825-101368847 CGTCTGTTGCAGAAGGAAGCCGG - Intergenic
1047389295 8:124437149-124437171 TCCTGGCTGAAGAGGGAAGCAGG + Intergenic
1047611235 8:126522831-126522853 CCCCAGCTGCTGTGGGAAGGTGG - Intergenic
1048821533 8:138384870-138384892 CCTCTGCTGCTGAGTGAAGAAGG - Intronic
1049165389 8:141122372-141122394 CCCCGGCTGCAGGGAGAGGCAGG - Intronic
1049190306 8:141283790-141283812 GCCCTGCTGCAGTAGGGAGCAGG - Intronic
1049475581 8:142795621-142795643 CTCCTGCTCCAGAAGGAAGAAGG - Intergenic
1049562698 8:143319722-143319744 TCCCTGCAGCAGAGGAAAGAGGG + Intronic
1049592604 8:143469399-143469421 CCACAGCTGCAGTGGGCAGCTGG - Intronic
1049646974 8:143739876-143739898 CGCCCGCCGCAGAGGAAAGCGGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053551380 9:39082753-39082775 CCTCTGCTGCAGTGGAAACCTGG + Intronic
1055931403 9:81563232-81563254 ATCCTGCTGCAGAGGGTAGATGG - Intergenic
1056707610 9:88965416-88965438 CCCCTTCAGCAGTGGGAGGCAGG + Intergenic
1057176597 9:93004748-93004770 CTCCTGATGCAGAGGGAAGCCGG - Intronic
1057228974 9:93307601-93307623 GCCCTGCTGCAGGAGGGAGCTGG - Intronic
1057307771 9:93922014-93922036 CCACTGCTGCAGAGAGATGCTGG - Intergenic
1057857524 9:98612952-98612974 CCTCTGCTCTAGAGGAAAGCTGG + Intronic
1058671453 9:107363777-107363799 TTCCTGCTGCTGAGGGAATCAGG + Intergenic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1060173325 9:121479279-121479301 TCCCTTCTGCAGAAGGAGGCAGG + Intergenic
1060742756 9:126110481-126110503 CCCATGCTGCAGATGGAGCCAGG + Intergenic
1060811078 9:126611839-126611861 CGGCTGCTGCAGGGAGAAGCCGG - Intergenic
1061265664 9:129503538-129503560 CCCCAGCTGGAGATGGAAGGAGG + Intergenic
1061990685 9:134157077-134157099 CGGCGGCTGCAGAGGGCAGCCGG - Intronic
1062039717 9:134398680-134398702 CCCCTGCTCCAGATGTAATCTGG - Intronic
1062095328 9:134700150-134700172 CCCCTGCTGGAGGGGGGATCAGG + Intronic
1062149331 9:135009458-135009480 GGCCTGCTGCACTGGGAAGCGGG - Intergenic
1062579028 9:137221557-137221579 CCCCTGCAGCCGAGGTCAGCAGG + Exonic
1203745060 Un_GL000218v1:36915-36937 TGCCTGCTGCAGGGGGATGCAGG - Intergenic
1203565048 Un_KI270744v1:82569-82591 TGCCTGCTGCAGGGGGATGCAGG + Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185747190 X:2583246-2583268 CCCCTGCTCCAGAGGGGAGAGGG - Intergenic
1186286450 X:8048968-8048990 CCCTTGCTGCAGCAGGTAGCTGG - Intergenic
1189025387 X:37388620-37388642 CCCCGGCTGCACAGGGCAGCAGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1192858624 X:75040759-75040781 CTGCTGCTGCAGAGGGATGGGGG + Intergenic
1194438212 X:93895136-93895158 CCACTGCTGCAGGGGGATGAAGG + Intergenic
1198862661 X:141087819-141087841 CCACTGCTGCTGAGGGATGAGGG - Intergenic
1198900033 X:141499567-141499589 CCACTGCTGCTGAGGGATGAGGG + Intergenic
1199119060 X:144029490-144029512 CCCAGGCTGCACAGGGTAGCAGG - Intergenic
1199594490 X:149495860-149495882 CCCTTGGTGCAGAGGGAACTGGG - Intronic
1199604575 X:149567156-149567178 CCCCTGCATCAGATGGAAGGAGG - Intergenic
1199605876 X:149579362-149579384 CCCCTGCATCAGATGGAAGGAGG - Intergenic
1199633245 X:149790006-149790028 CCCCTGCATCAGATGGAAGGAGG + Intergenic
1199645031 X:149900090-149900112 CCCCTGCATCAGATGGAAGGAGG + Intergenic
1199679784 X:150216548-150216570 CCACTGCTGCAGAGAGCAACAGG - Intergenic
1200069584 X:153521338-153521360 TCACTGGGGCAGAGGGAAGCAGG + Intronic
1200969892 Y:9140565-9140587 CCTCTGCAGCAGAGAGTAGCCGG + Intergenic
1201158395 Y:11151954-11151976 TGCCTGCTGCAGGGGGATGCAGG - Intergenic