ID: 927484395

View in Genome Browser
Species Human (GRCh38)
Location 2:23478821-23478843
Sequence GCCGCCTGTGTCTTCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927484389_927484395 3 Left 927484389 2:23478795-23478817 CCCTCAGCAAACGAAATGCCCTA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484388_927484395 7 Left 927484388 2:23478791-23478813 CCTGCCCTCAGCAAACGAAATGC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484384_927484395 18 Left 927484384 2:23478780-23478802 CCGTTTGTCCCCCTGCCCTCAGC 0: 1
1: 1
2: 5
3: 60
4: 596
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484386_927484395 9 Left 927484386 2:23478789-23478811 CCCCTGCCCTCAGCAAACGAAAT 0: 1
1: 0
2: 0
3: 12
4: 268
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484390_927484395 2 Left 927484390 2:23478796-23478818 CCTCAGCAAACGAAATGCCCTAG 0: 1
1: 0
2: 0
3: 9
4: 73
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484387_927484395 8 Left 927484387 2:23478790-23478812 CCCTGCCCTCAGCAAACGAAATG 0: 1
1: 0
2: 0
3: 4
4: 127
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484385_927484395 10 Left 927484385 2:23478788-23478810 CCCCCTGCCCTCAGCAAACGAAA 0: 1
1: 0
2: 0
3: 18
4: 194
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73
927484383_927484395 23 Left 927484383 2:23478775-23478797 CCAGGCCGTTTGTCCCCCTGCCC 0: 1
1: 0
2: 2
3: 14
4: 239
Right 927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927484395 Original CRISPR GCCGCCTGTGTCTTCGGAGG AGG Intronic
901628885 1:10638764-10638786 GCCGCCTGTGTCCTCGGCCGCGG + Exonic
902228349 1:15011378-15011400 GCATCCTGTGCCTTCGGAGCTGG - Intronic
908790002 1:67771678-67771700 GTCGCCTGTGTCTGCTGTGGTGG - Intronic
910145694 1:84077970-84077992 CCCGACTGTATCTTCGCAGGCGG - Intergenic
912409033 1:109467040-109467062 GCCGGCTGTGTCTCCGCAGGTGG + Exonic
1062911959 10:1217159-1217181 GCCGCCTTGGTTTTGGGAGGTGG + Intronic
1067338251 10:45381109-45381131 GCCGCCTGTGTCCTGGAAGCAGG + Intronic
1067812591 10:49441618-49441640 GCCGCCGGCGTCTCCGCAGGTGG + Intergenic
1071514190 10:86286356-86286378 GCAGCCTGTGTCTCCGTGGGTGG + Intronic
1073112735 10:101072225-101072247 GCCGGCTGTGTCCTGGGAGGAGG + Intergenic
1073194296 10:101675624-101675646 GCCGCCTGTGTCTTCAGCACAGG + Intronic
1076907827 10:133372391-133372413 GCCCCCTGTGGCTGGGGAGGAGG + Intronic
1077308562 11:1878524-1878546 GTCCCCTGTGGCTTCGGTGGGGG + Intronic
1080384776 11:31804854-31804876 GCCGGCGGTATCTGCGGAGGTGG - Intronic
1082986393 11:59173551-59173573 GCTCCCTTTGTCTGCGGAGGAGG + Intronic
1084742264 11:71147328-71147350 GCTGCCTGTGTCTTCGAGGTGGG + Intronic
1089323883 11:117644238-117644260 TCCGCTTGTTTCCTCGGAGGAGG - Intronic
1089556874 11:119319944-119319966 CCGGCCTGGGTCTTTGGAGGGGG + Intronic
1094624187 12:32107065-32107087 GCCGCATGTGTCCTCGGGGCCGG - Intronic
1095440726 12:42237504-42237526 TCCGCCAGTGTCATGGGAGGGGG + Intronic
1101947688 12:109150393-109150415 GCAACCTGTGTCCACGGAGGAGG + Intronic
1103801438 12:123540402-123540424 GCAGCCTGTGCCTTAGGAGGGGG + Intergenic
1104810393 12:131616962-131616984 GGAGCCTGTGTCCTGGGAGGCGG - Intergenic
1109076791 13:57846038-57846060 TCCGGCTGTGGCTTCAGAGGTGG - Intergenic
1114487484 14:23071571-23071593 GCAGCCTGTGTGTGCGGATGGGG + Intronic
1118687635 14:68307079-68307101 GGCGCTTTTGTCTTGGGAGGCGG + Intronic
1119950271 14:78737733-78737755 GCAGCATGTGTCTCCTGAGGAGG + Intronic
1121693001 14:95891288-95891310 GCAGCCTGTGTCTTCAGACTCGG - Intergenic
1121967077 14:98320243-98320265 GCCCACTGTGTCTTCTGAGCAGG + Intergenic
1122480125 14:102041778-102041800 GCCACCTGTGGCTGGGGAGGTGG - Intronic
1129251032 15:74309082-74309104 GGTGGCTGTGTCTTAGGAGGAGG - Intronic
1132744948 16:1432677-1432699 GCCCCCAGAGACTTCGGAGGAGG + Intergenic
1135137763 16:19897498-19897520 GCAGCCTGTGTCTCCGGGGAAGG + Intergenic
1142076383 16:88120459-88120481 GCTGCCTGTGTTCTCCGAGGTGG - Intergenic
1142309888 16:89306274-89306296 GTGGCGTGTGTCTGCGGAGGGGG - Intronic
1142312299 16:89321103-89321125 GGCTCCTGTGTGTGCGGAGGGGG - Intronic
1142843671 17:2654595-2654617 GCCCTCTGAGTCTTCAGAGGAGG + Intronic
1142871712 17:2825503-2825525 GCCGCCTCTGTTTTAGGAGCCGG + Intronic
1147792513 17:43022246-43022268 GCTGCCTCGGTTTTCGGAGGCGG + Exonic
1148054498 17:44786131-44786153 GCCGCCTGTGACTGAGGTGGAGG - Intergenic
1151595879 17:75077815-75077837 GTCGCCTGCGTTTTGGGAGGTGG - Intergenic
1152307805 17:79531333-79531355 GCTGCCTGCGTGTGCGGAGGAGG + Intergenic
1152352181 17:79790159-79790181 TCCTCCTGAGACTTCGGAGGCGG - Intergenic
1152669028 17:81590403-81590425 GCAGCCTGAGCCTTTGGAGGAGG + Intronic
1156497923 18:37538066-37538088 GCCGCCTGTGTTTTCAGACGTGG - Intronic
1157271270 18:46278180-46278202 GACTCCTGGGACTTCGGAGGAGG - Intergenic
1160199899 18:76787700-76787722 GCCGCCTGTGTGTCCGGAATGGG + Intergenic
1161578662 19:5068569-5068591 TCCGCCTGTGTCCTTGGGGGTGG + Intronic
1163149435 19:15402270-15402292 GCCCTCTGTGTCCTGGGAGGAGG - Intronic
1165222151 19:34325272-34325294 ACCACCTGTGTCCTTGGAGGGGG + Intronic
1166332816 19:42088572-42088594 GCTGCCTGTCTTCTCGGAGGGGG + Intronic
925752835 2:7105185-7105207 GCTGCCTGTGTGGTGGGAGGAGG + Intergenic
925943844 2:8842799-8842821 ACCTCCTGTGTCTTCTGAGATGG - Intergenic
926235637 2:11041327-11041349 GCAGCCTGGATCTTTGGAGGTGG + Intergenic
927452788 2:23223250-23223272 TCTCCCTGTGTCTTGGGAGGAGG - Intergenic
927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG + Intronic
940131379 2:150387087-150387109 CCCACCTGTGTCTTCAGTGGTGG + Intergenic
944314846 2:198273172-198273194 ACAGACTGTGTCTGCGGAGGCGG + Intronic
946430937 2:219627285-219627307 GGGGCCTGTGTCTGCGGAGGGGG + Intergenic
948301191 2:236908740-236908762 GCCCTCTGTGTCTTCAGTGGAGG - Intergenic
1175029164 20:55935025-55935047 GCAGCCTGTTTCTTAGGAGAAGG - Intergenic
1183553355 22:38506173-38506195 GCCGCCTCTCTCGTCGGAGACGG + Exonic
950578070 3:13844958-13844980 GCCGCCTTTGTCCTCGGGAGGGG - Intronic
950677619 3:14564177-14564199 GCCACCTGTTTCTTGGCAGGTGG - Intergenic
974020817 4:56690661-56690683 GGCACCTCTGTCTTCGGAGGTGG + Intergenic
984847716 4:184121937-184121959 GCTTCCTGTGTCTTCAGGGGAGG + Intronic
985646467 5:1087030-1087052 GCCGCCTTTGTCTCCGCAGCTGG - Exonic
1006473775 6:34242642-34242664 GAGGGCTGTGTCTTCTGAGGGGG + Intronic
1011654830 6:89542510-89542532 GCCTCCTGTGTCTCGGGAAGCGG - Intronic
1017769936 6:157637189-157637211 GACACCTGTGGCTTTGGAGGTGG + Intronic
1024571837 7:50729723-50729745 GCTGCCTTGGTCTTCGGGGGGGG - Intronic
1033160511 7:138992087-138992109 GCAGCTTGTGTCTTAGGGGGCGG - Intergenic
1034956689 7:155339494-155339516 TCCCCGTGTGTCTTGGGAGGCGG - Intergenic
1035280605 7:157775995-157776017 GCCAGCTGTGTACTCGGAGGTGG + Intronic
1036788283 8:11702169-11702191 GCCGCCTGTGTCCTTGGCTGTGG + Intronic
1045643834 8:104281202-104281224 GCCGCCTGTTAGATCGGAGGTGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048296792 8:133220564-133220586 GCCACCTGTGTTTGCAGAGGTGG + Exonic
1057684699 9:97221786-97221808 GCCCCATCTCTCTTCGGAGGAGG - Intergenic
1059234730 9:112751450-112751472 GGCGCCTGTGTCCTCGGATGGGG + Intronic
1059358900 9:113723789-113723811 GCTGCCTGGGTCTTCAGAGGTGG + Intergenic
1061050115 9:128190440-128190462 GCCCCCTGTGTGTTGGGAGGGGG + Exonic
1061050313 9:128191366-128191388 GCTGGCTGTGTCTGCGGAGGAGG - Intronic
1061898815 9:133662554-133662576 GCCCCCTGAGTCTGGGGAGGGGG - Intergenic
1186165946 X:6825886-6825908 GCCGCCTGCTTCTTTGGAGTGGG - Intergenic