ID: 927485572

View in Genome Browser
Species Human (GRCh38)
Location 2:23486342-23486364
Sequence AGGGATAAGCCCCAGCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927485572_927485575 -2 Left 927485572 2:23486342-23486364 CCGAGATGCTGGGGCTTATCCCT 0: 1
1: 0
2: 0
3: 15
4: 176
Right 927485575 2:23486363-23486385 CTCCCACGATTGCCACTGACAGG 0: 1
1: 0
2: 1
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927485572 Original CRISPR AGGGATAAGCCCCAGCATCT CGG (reversed) Intronic
900503958 1:3019899-3019921 AGGGAGGAGCTCCAGCGTCTGGG + Intergenic
903270914 1:22187703-22187725 AGGGGCAACCCCCAGCATCAAGG - Intergenic
905608827 1:39330737-39330759 TGGGATAAGCCCCAACATGTAGG - Intronic
905687237 1:39917203-39917225 AGGCATGAGCCACTGCATCTGGG + Intergenic
905878992 1:41451320-41451342 AGCCATAAGCCCCTGAATCTGGG + Intergenic
912631519 1:111250306-111250328 AGGGATAAGACCTAGCATTCAGG + Intergenic
913997275 1:143661717-143661739 AGGCATCAGACCCAGCATCCTGG - Intergenic
917258417 1:173141138-173141160 AGGGATAACCTCCAGCAACATGG - Intergenic
922325522 1:224524804-224524826 AGGGATAAACCACACAATCTCGG - Intronic
923484749 1:234418572-234418594 AGGTTTAAGCCCTGGCATCTTGG - Intronic
924312270 1:242756633-242756655 AGGCATGAGCCACAGCATCCAGG - Intergenic
1063145360 10:3290667-3290689 AGGGAGAAGCCACAGGCTCTGGG + Intergenic
1064475561 10:15684649-15684671 AGGGAAGAGCCACAGCACCTAGG + Intronic
1064791532 10:18961874-18961896 TGGGATATGCCCTAGCTTCTAGG - Intergenic
1066707994 10:38202155-38202177 AGGTATTTGCCCCAGCACCTAGG + Intergenic
1067983837 10:51118867-51118889 AGGGAAAAGCAACAGCATATTGG + Intronic
1070326704 10:75394471-75394493 GGGGATAAGTCCCACCTTCTGGG + Intergenic
1071980557 10:91000787-91000809 AGGGCTAAGCACCAGCAGCTGGG - Intergenic
1072753200 10:97999204-97999226 AGGCATGAGCCCCACCATCCTGG + Intronic
1077546135 11:3170828-3170850 AGGGAGGAGCCACAGCATGTTGG + Intergenic
1079118129 11:17653635-17653657 AGGGTTAAGGCTCAGCAGCTGGG + Intergenic
1079496170 11:21046993-21047015 AGGTGTGAGCCCCAGCACCTGGG + Intronic
1080784821 11:35465368-35465390 AGGAAGAAACCCAAGCATCTGGG - Intronic
1081373279 11:42330082-42330104 AGTCATAAGCCCCAGTATCTGGG + Intergenic
1083142027 11:60729938-60729960 AGGGAGAGGGGCCAGCATCTGGG - Intronic
1083883563 11:65559648-65559670 AGGGGCAAGCCCCTGCTTCTTGG + Intergenic
1086092641 11:83020145-83020167 AGGTAGAAGCCCCACCCTCTCGG + Intronic
1088811714 11:113396786-113396808 AGGCAGAAGCCACAGCATCTGGG + Intronic
1091456371 12:611011-611033 AGGCATAAGCCACGGCACCTAGG + Intronic
1091584237 12:1806808-1806830 GGACAGAAGCCCCAGCATCTGGG - Intronic
1091910451 12:4226630-4226652 AGGGAGCAGCCCCAGCTTCCCGG + Intergenic
1096871719 12:54596722-54596744 AGAGCTGAGCCCCAGCACCTGGG - Intergenic
1097217576 12:57426269-57426291 AGGGATAACCCACAGAATTTAGG + Intronic
1098146091 12:67499176-67499198 AGGGAGAAGCTACACCATCTGGG + Intergenic
1101130642 12:101687691-101687713 ATGGCTAAGACCCAGCAGCTGGG - Intergenic
1103403678 12:120660063-120660085 AGAGAAATGCCCCAGCATCCTGG + Intronic
1106420527 13:29581957-29581979 AGGGTTAAGCCCCAGCCTTCAGG - Intronic
1107517853 13:41149233-41149255 AGGGAAAAGCCACTTCATCTTGG + Intergenic
1108354219 13:49615722-49615744 AAGGATAGGCCTCAGCATATTGG + Intergenic
1110491845 13:76118587-76118609 AGGCATAAGCACCAGCACCAAGG - Intergenic
1115414103 14:33111297-33111319 AAGTCTCAGCCCCAGCATCTAGG + Intronic
1115613909 14:35074761-35074783 AGGGGTAAGCCACTGCATCTGGG - Intronic
1117116854 14:52522799-52522821 AGTTATAAGCCCTAGAATCTGGG - Intronic
1118609828 14:67531634-67531656 AGGGATGAGCCACCGCACCTCGG - Intronic
1119031123 14:71193426-71193448 AGGGATCAGCCCCAGCCCCACGG + Intergenic
1121596908 14:95170624-95170646 AGGCATGAGCCACAGCACCTGGG - Intergenic
1121800482 14:96770100-96770122 AGAGACAAACCCCAGCTTCTAGG - Intergenic
1125513196 15:40303666-40303688 AGAGATAGGCCCCAGCCTCTGGG - Intronic
1126179738 15:45773459-45773481 AGAAATAAGCACCAGGATCTAGG - Intergenic
1126766250 15:52014430-52014452 AGGGATGAGCCACCGCACCTGGG - Intronic
1128940569 15:71784681-71784703 AGAGACAAGCCTCAGCCTCTAGG - Intergenic
1130044922 15:80436093-80436115 AGGGATGGGCCCCTTCATCTTGG + Intronic
1133067996 16:3223680-3223702 AGGGCTATACCTCAGCATCTAGG - Exonic
1134034007 16:11015768-11015790 AGGGCCAAGCCCCAGCACCCTGG - Intronic
1135078793 16:19416443-19416465 AGGGATAAACCCCAGCAGATGGG - Intronic
1135265435 16:21021629-21021651 AGGCATAAGCCACAGCGCCTGGG - Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1138831220 16:60377159-60377181 AAATATAAGCACCAGCATCTTGG + Intergenic
1139079462 16:63497986-63498008 AAGGGTAAGCCCAAACATCTAGG - Intergenic
1139625941 16:68188305-68188327 AGGAAGAAGCCCCACCATCCTGG - Intronic
1141435370 16:83996951-83996973 AGTGGCAAACCCCAGCATCTTGG + Intronic
1141483089 16:84319662-84319684 AGGAAGCAGCCCCAGCACCTGGG + Intronic
1143634535 17:8156757-8156779 AAGGAAAATCCCCAGCTTCTGGG - Intronic
1143715343 17:8763934-8763956 AGGCATTAGCCACTGCATCTGGG - Intergenic
1148494025 17:48041660-48041682 AGGGAAAAGACCCAGCATTTGGG + Intergenic
1149569603 17:57663136-57663158 AGAGCAAAGCCCCAGCAACTGGG - Intronic
1149605989 17:57925669-57925691 AGAGATAAGCTTCACCATCTGGG + Intronic
1149832043 17:59880790-59880812 AGGCATAAGCCACCGCACCTGGG + Intronic
1150336063 17:64331740-64331762 GGGGATCTGCCCCAGCATGTGGG - Intronic
1151468091 17:74300805-74300827 AGGGCGAGGCCTCAGCATCTGGG + Intronic
1151501946 17:74495780-74495802 AGGCATGAGCCACTGCATCTGGG - Intergenic
1153977586 18:10283141-10283163 ACGGCCAAGCCCCAGCAGCTGGG + Intergenic
1162480317 19:10923660-10923682 AGGGATGAGCCACAGGACCTGGG + Exonic
1163290040 19:16373287-16373309 CGCGCAAAGCCCCAGCATCTGGG + Intronic
1163611723 19:18305192-18305214 GGGGATTAGCCCCAGCACCTGGG + Intergenic
1165879978 19:39035507-39035529 AGGCATAAGCCACTGCACCTAGG - Intergenic
1166696834 19:44856680-44856702 GGTGATAAGTCCCAGCACCTGGG + Intronic
1167524684 19:49976407-49976429 AGGCATGAGCCACAGCACCTGGG + Intergenic
926820571 2:16847475-16847497 AGGCATAAGCCACTGCACCTGGG + Intergenic
926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG + Intronic
927485572 2:23486342-23486364 AGGGATAAGCCCCAGCATCTCGG - Intronic
929470949 2:42192161-42192183 AGGTATAAGACCCAGACTCTTGG - Intronic
929646477 2:43633481-43633503 AAGTATAAACCCCAGCACCTGGG - Intergenic
930387179 2:50711612-50711634 AGGCATAAGCCACCGCACCTGGG + Intronic
932936515 2:76109411-76109433 AGGCATGAGCCACAGCACCTGGG + Intergenic
933345946 2:81085901-81085923 AGGAATCAGCCCCAGCAGGTAGG + Intergenic
934588850 2:95528688-95528710 AGTGCTAAGGCCCCGCATCTTGG - Intergenic
937158976 2:119742183-119742205 GGGAATAAGCCCCAACATTTGGG - Intergenic
938902469 2:135809550-135809572 TGGCAAAGGCCCCAGCATCTGGG - Exonic
941856806 2:170239643-170239665 AGGGATAATCACCAGCTTCAGGG - Intronic
944301631 2:198130692-198130714 AAGGATAACCCCCAGGATTTAGG - Intronic
944551659 2:200849944-200849966 AGGCATGAGCCACTGCATCTGGG + Intergenic
944926848 2:204474267-204474289 AGGGAAAGCCCCCAGCATTTCGG + Intergenic
947214872 2:227740969-227740991 AGGCATGAGCCACAGCACCTGGG - Intergenic
948392310 2:237621241-237621263 AGGCATAAGCCACTGCATCCAGG + Intergenic
1169299102 20:4426733-4426755 AGGCATATGTCCCAGCATTTAGG + Intergenic
1170444969 20:16416993-16417015 AGGGATCTGCCCCACCTTCTTGG - Intronic
1171846028 20:30275354-30275376 AGTGATAAGTCCCTTCATCTTGG + Intergenic
1174811628 20:53650507-53650529 AGGCATAAACCACTGCATCTGGG + Intergenic
1175978073 20:62723557-62723579 AGGGATAAGCCATTCCATCTGGG + Intronic
1176295472 21:5069844-5069866 AGGGAGCAGCCCCAGCCCCTGGG + Intergenic
1179861578 21:44192280-44192302 AGGGAGCAGCCCCAGCCCCTGGG - Intergenic
1180556582 22:16583103-16583125 AGGCATAAGCCACTGCATCTGGG - Intergenic
1180632440 22:17238907-17238929 AGGCATGAGCCACCGCATCTAGG + Intergenic
1180787358 22:18554403-18554425 AGGGCTGAGCACCAGCATCCGGG - Intergenic
1181234381 22:21440902-21440924 AGGGCTGAGCACCAGCATCCGGG + Intronic
1181244267 22:21493929-21493951 AGGGCTGAGCACCAGCATCCGGG - Intergenic
1181614542 22:24044092-24044114 AGGGACAAGCCCCACCCTTTTGG + Intronic
1181749127 22:24976695-24976717 AGGGGTGGGCCCCAGCATGTGGG - Intronic
1182440660 22:30362118-30362140 AGGGGAAAGCCCCATCTTCTGGG + Intronic
1183714282 22:39524624-39524646 AGGGCACAGCCCCAGCATCCTGG - Intergenic
952577780 3:34795377-34795399 AGGGATTAGCCCTAGCATGGTGG + Intergenic
954378679 3:50208038-50208060 TGGGCTCAGCCCCAGCCTCTGGG + Intronic
955497310 3:59547371-59547393 AGGGGTATGGCCCAGAATCTGGG + Intergenic
957013612 3:75037216-75037238 AGGGCTAATGTCCAGCATCTAGG - Intergenic
958056126 3:88414557-88414579 AGGCATGAGCCACAGCACCTAGG + Intergenic
960037408 3:113115802-113115824 AGGCATAAGCCACAGCATGAAGG - Intergenic
960690469 3:120341836-120341858 AGGGAGAAGCCCCACCCTCCTGG + Intronic
965848546 3:172993066-172993088 GGGGATAAGCCCCAACCACTGGG - Intronic
967122467 3:186395251-186395273 AGACATAAGCCCCCGCATCTTGG - Intergenic
969184462 4:5465103-5465125 AAGGATGAGGCCCAGCCTCTAGG + Intronic
969622551 4:8285966-8285988 AGGAATCTGCCCCAGCCTCTGGG + Intronic
974920894 4:68237735-68237757 AGGCATAATCCACTGCATCTTGG - Intronic
977821342 4:101475703-101475725 GGGGACAAGCCACAGCATTTTGG - Intronic
977839683 4:101687451-101687473 AGGGAGAAGCCACAGCAACTTGG - Intronic
989023827 5:37042682-37042704 AAGGAGAAGCACCAGCATGTCGG - Intronic
992738113 5:79744407-79744429 AGGGATAAGAGCCAGCAGCTAGG - Intronic
993630538 5:90280980-90281002 AGGGAAAATCCCCACCTTCTGGG - Intergenic
994315004 5:98323102-98323124 AGAGTTAAGCTCCACCATCTTGG + Intergenic
996925906 5:128826423-128826445 TGGGATCAAACCCAGCATCTTGG - Intronic
1000796605 5:165672083-165672105 AGGCATGAGCACTAGCATCTGGG - Intergenic
1002473653 5:179452116-179452138 AGGGAGATGCCCCAGCAAATGGG + Intergenic
1006332975 6:33405378-33405400 AGGGATCAGCCCCTCCAACTGGG - Exonic
1006813373 6:36835242-36835264 AGGGATCTGGCCCAGCATGTTGG - Intronic
1010426118 6:75730776-75730798 AGGCATAAGCCACAGCGCCTCGG - Intergenic
1010777734 6:79906321-79906343 AGGGAAATGCCCCAGCACTTTGG - Intergenic
1016670774 6:146704384-146704406 AGGGATAAGCTCCAAGAACTTGG - Intronic
1017108895 6:150913850-150913872 AGGCATGAGCCACAGCACCTGGG - Intronic
1019302293 7:311953-311975 AGGGAGAAGCCCCCACATCAGGG + Intergenic
1019412509 7:912414-912436 AAGGATAAACCCCCACATCTGGG + Intronic
1023380073 7:39598385-39598407 AGGCATAAGCCACCGCACCTGGG + Intronic
1024846058 7:53643633-53643655 AGGAATAAGCCTCAGAATCTAGG - Intergenic
1026734639 7:72941969-72941991 AGGGATCAGCCCCAGCAAAGTGG - Exonic
1026784975 7:73296881-73296903 AGGGATCAGCCCCAGCAAAGTGG - Intergenic
1027109103 7:75423049-75423071 AGGGATCAGCCCCAGCAAAGTGG + Exonic
1027183237 7:75953894-75953916 AGGGGCAAGGCCCAGCATTTAGG + Intronic
1033244247 7:139704983-139705005 AGGGACAGGGCCCAGCATTTGGG - Intronic
1033588010 7:142788499-142788521 AGCAATCAGCCCCAGCATTTTGG + Intergenic
1033658373 7:143388088-143388110 AGGGTCAAGCCTGAGCATCTGGG + Intronic
1040428273 8:47311538-47311560 AGGCATAAGCCACTGCAACTAGG - Intronic
1042523859 8:69744027-69744049 GAGGAGAAGCCCCAGCAGCTGGG - Intronic
1046676273 8:117112011-117112033 AGAGACAAGCAGCAGCATCTGGG + Intronic
1047492056 8:125383280-125383302 AGGCATGAGCCACAGCAGCTGGG - Intergenic
1047790726 8:128200790-128200812 ATGGATGAGCCCAAGAATCTTGG - Intergenic
1047976416 8:130134944-130134966 AGAGAGCAGCCCCAACATCTGGG - Intronic
1051418052 9:16863252-16863274 AGGGCTATGCCCCAGCCTTTTGG - Intronic
1052228235 9:26116028-26116050 AGGGATCAATCCCAGCATTTAGG - Intronic
1052830603 9:33212204-33212226 AGGGTTAGCCCCCAGCAGCTGGG + Intergenic
1056806045 9:89729538-89729560 AGTGACAATCCCCAGCTTCTAGG + Intergenic
1056962974 9:91142956-91142978 AGGGATCAGCCACTGCACCTGGG - Intergenic
1057167982 9:92943248-92943270 AGGAACAAGCTTCAGCATCTGGG - Intergenic
1057896857 9:98916138-98916160 AGGGAAAAACCTCAGGATCTCGG - Intergenic
1062473110 9:136714807-136714829 AGGGAGGACCCCCAGCAGCTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186032881 X:5389763-5389785 GGGGAAAAACTCCAGCATCTTGG + Intergenic
1186449462 X:9660066-9660088 GTGGATAAGCCCAGGCATCTGGG + Intronic
1186946990 X:14579606-14579628 AGGCATGAGCCACAGCACCTGGG + Intronic
1187270377 X:17775243-17775265 AGGAAGAAGCCCCAACACCTGGG - Intergenic
1187320131 X:18230465-18230487 AGGAAGAAGCCCCAACACCTGGG + Intergenic
1187401777 X:18966805-18966827 AGGGACCAGCTCCAGCATTTCGG - Intronic
1188823709 X:34804402-34804424 AAGGAAAATACCCAGCATCTGGG + Intergenic
1197431338 X:126370125-126370147 AGGGAAAGACCCCAGCATTTGGG + Intergenic
1197683888 X:129417510-129417532 AGGGATAAGCACCAACCTCTAGG + Intergenic
1200931649 Y:8702280-8702302 AGGGACACGCCCCATCAACTGGG + Intergenic
1200936026 Y:8739279-8739301 AGTGACAAGTCCCTGCATCTTGG - Intergenic
1201993264 Y:20053428-20053450 AGGGATGAGCCACAGCACCCGGG + Intergenic