ID: 927486548

View in Genome Browser
Species Human (GRCh38)
Location 2:23492040-23492062
Sequence CAGAGGAACTGGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 637}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927486548_927486555 -5 Left 927486548 2:23492040-23492062 CCTTTTTCCCTCCAGTTCCTCTG 0: 1
1: 0
2: 3
3: 67
4: 637
Right 927486555 2:23492058-23492080 CTCTGGTACACTGGCCCCAGCGG 0: 1
1: 0
2: 0
3: 9
4: 139
927486548_927486556 -4 Left 927486548 2:23492040-23492062 CCTTTTTCCCTCCAGTTCCTCTG 0: 1
1: 0
2: 3
3: 67
4: 637
Right 927486556 2:23492059-23492081 TCTGGTACACTGGCCCCAGCGGG 0: 1
1: 0
2: 1
3: 10
4: 148
927486548_927486557 5 Left 927486548 2:23492040-23492062 CCTTTTTCCCTCCAGTTCCTCTG 0: 1
1: 0
2: 3
3: 67
4: 637
Right 927486557 2:23492068-23492090 CTGGCCCCAGCGGGAGCTCTAGG 0: 1
1: 0
2: 2
3: 30
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927486548 Original CRISPR CAGAGGAACTGGAGGGAAAA AGG (reversed) Intronic
900974952 1:6011198-6011220 CACAGGAGCAGGAGGGAAACAGG + Intronic
901623054 1:10604673-10604695 CAGAGGAAATGGCTGGAGAAAGG + Intronic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
902098514 1:13966134-13966156 CAGAGGAAGGGGAGAGAAATAGG - Intergenic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902714282 1:18261757-18261779 CAGAGGAAGTGGAGGGACTTGGG + Intronic
904534006 1:31187292-31187314 CTGAGGAACAGCAGGGAATATGG + Intronic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
904895511 1:33814601-33814623 CATTGAAACAGGAGGGAAAAAGG - Intronic
905316151 1:37082677-37082699 AAGAGGAGATGGAGGGCAAAGGG + Intergenic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
905817908 1:40966221-40966243 CAGAGGAACTGGGATGAGAATGG + Intergenic
906146452 1:43563547-43563569 CTGAGAGACTGGAGGGAAACTGG + Intronic
906288112 1:44601578-44601600 CACTGAAACTGGAGGGAACAGGG + Intronic
906505957 1:46379811-46379833 CAGAAGAACAGAAGGGAAAAGGG + Intergenic
906690480 1:47789601-47789623 CAGAGGAAGAGGAGAGAGAAGGG - Intronic
907774441 1:57499467-57499489 CAGAGGAACTGGGTGGAATGTGG + Intronic
908645392 1:66272639-66272661 CAGAGGAAGTGGGGGAGAAAAGG - Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909541723 1:76799195-76799217 TAGAGAAACTGGAAGGAATAAGG + Intergenic
910040885 1:82850463-82850485 GAGGGGAGCTGGAGGGCAAATGG + Intergenic
910765887 1:90781814-90781836 CAGTGAAACTGCAGGGATAAAGG + Intergenic
911348001 1:96720720-96720742 GAGAGTAACTGGAGGGACACAGG + Intergenic
912551805 1:110489761-110489783 CAGAGGAACAGGAGGTCAGACGG - Intergenic
912727375 1:112070053-112070075 AAGAGTAACTGGAGGGATAGTGG - Intergenic
912830813 1:112952221-112952243 GAGAGAAACCGGAGGAAAAATGG + Intronic
914747037 1:150508594-150508616 GAGAGGCAAGGGAGGGAAAAGGG + Intronic
915475301 1:156149683-156149705 CAGAGGAACTGGTTGTAAAGAGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915980803 1:160418932-160418954 AAGAGGAAGAGGAGGGAAACAGG - Intronic
916678558 1:167084304-167084326 CAGAGGAAATGGAGAAAAACGGG + Intronic
916944427 1:169711680-169711702 AGGAGGAAGGGGAGGGAAAAGGG - Exonic
917608679 1:176663804-176663826 CAGGAGAACTTGAGAGAAAATGG - Intronic
918008294 1:180562568-180562590 CAGAGGCACAGGTGGAAAAAGGG + Intergenic
918471468 1:184880168-184880190 CAGAGGAACTGGATGTTAGAAGG - Intronic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
918629184 1:186695424-186695446 AAGAGGAAAAGGAGGTAAAAGGG - Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920269958 1:204755330-204755352 AAGAGGAACAAGAAGGAAAAAGG - Intergenic
920304875 1:205012227-205012249 CAGAGGAAGTGGAGGAAAGGGGG + Intronic
920660727 1:207912027-207912049 CAGAGGAACTGGTGAGGAACAGG - Intergenic
920693521 1:208164535-208164557 CACAGAATTTGGAGGGAAAAGGG + Intronic
920860134 1:209699205-209699227 CTGAGGAACTGGGGTGAGAATGG + Intronic
920914677 1:210250759-210250781 CAGAGGAACTGCAGTGAGAATGG - Intergenic
921294727 1:213691107-213691129 CAGAGGAAGGGAAGGGAAGATGG - Intergenic
921713307 1:218394328-218394350 TAGAGGAACTGAAGTGAAATAGG + Intronic
922095085 1:222436463-222436485 CAGAGGTAAAGGATGGAAAAGGG + Intergenic
922170923 1:223153862-223153884 AAGAGGAACAGAAGGGACAAGGG - Intergenic
922273641 1:224056839-224056861 CAGAGGAGCTGCACGGAAAAAGG - Intergenic
922273769 1:224057792-224057814 CAGAGGAGCTGCACGGGAAAAGG + Intergenic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923498753 1:234546996-234547018 CCAAGGAAAGGGAGGGAAAATGG + Intergenic
923936330 1:238764385-238764407 CATAGGAAATGGGGTGAAAAGGG - Intergenic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924257578 1:242197526-242197548 GAGAGGAACTGGTTGGAGAAAGG - Intronic
924373683 1:243383878-243383900 AACAGCAAATGGAGGGAAAAAGG - Intronic
924566338 1:245201827-245201849 CAGAGTAGCTGGGGGTAAAAAGG - Intronic
1063308842 10:4933817-4933839 CAGAGGAAAAGGAGGAAAGACGG - Intronic
1063507234 10:6611064-6611086 AACAGGAACTGGAAGCAAAAAGG - Intergenic
1063615895 10:7600322-7600344 CAGGGGACCAGGTGGGAAAATGG - Intronic
1063961319 10:11307691-11307713 CAAAACAACTGGAGGCAAAATGG - Intronic
1064230022 10:13521646-13521668 CAGAGGAAATGAAGGGCCAAGGG - Intronic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1067119725 10:43463927-43463949 CAGAGGAAAGGGAGAGAGAAAGG - Intronic
1069561991 10:69437148-69437170 CAAAGAAAAAGGAGGGAAAAGGG - Intergenic
1069739727 10:70679686-70679708 CAGAGGCACTGAAGGCAAAGGGG - Intronic
1069792486 10:71031889-71031911 CAGAGGAAGAGAAGGCAAAAGGG - Intergenic
1070053625 10:72913293-72913315 CACAGGGACTGCAGAGAAAAAGG - Exonic
1070326262 10:75391312-75391334 AAGAGGAACAAGAGGTAAAAGGG - Intergenic
1070363155 10:75710598-75710620 CAGGGGAAGCGGGGGGAAAAAGG - Intronic
1070379153 10:75864365-75864387 CAGGGGAACAGGAGGTTAAAGGG - Intronic
1070394395 10:75999550-75999572 CAGAGGAACTAGAGGCACATTGG - Intronic
1070921908 10:80192664-80192686 CAGGGGAACTGGAAGGACACTGG + Intronic
1073114153 10:101081570-101081592 CAAAGGAACAGGAGAGAAAGTGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074496020 10:113980784-113980806 GAAAGGATCTGGAGGGAAACTGG - Intergenic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075197709 10:120375364-120375386 AAGAAGAACTGGAGGCAATATGG + Intergenic
1075573285 10:123560432-123560454 CAGAGGAACAGCAAGGACAAGGG + Intergenic
1075962475 10:126581245-126581267 CAAAGGAATTGGAAGGAAAAGGG + Intronic
1075997965 10:126893465-126893487 CAGATGCGCTGCAGGGAAAAGGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076178916 10:128390808-128390830 CCGTGGAACTGAATGGAAAACGG - Intergenic
1076594891 10:131619307-131619329 CAGAGCACCTGGTGGGCAAAAGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077392524 11:2306791-2306813 AGGAGGAAAAGGAGGGAAAAGGG + Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078639016 11:13078091-13078113 CGGAGGCACAGGTGGGAAAAAGG + Intergenic
1078730686 11:13971300-13971322 CAGAGCAACAGCAGGCAAAAGGG + Intronic
1078885360 11:15494518-15494540 TAAAGGAAATGGAGGGAAAGTGG + Intergenic
1078893829 11:15580708-15580730 GAGAGGAATTGGGGAGAAAAGGG - Intergenic
1078926043 11:15876044-15876066 AAGAGGAGCTGGATGGACAAAGG - Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1080026587 11:27621499-27621521 TGGAGGAACTGGAGAGAGAAGGG - Intergenic
1080175164 11:29354575-29354597 CAGAGAAACTGCAAGGGAAATGG - Intergenic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080517409 11:33037366-33037388 CATAGGACTTGGAGGGAGAAAGG - Intergenic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080966265 11:37217953-37217975 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1081394507 11:42569703-42569725 CAGAGTAAATGAAGGGAAATTGG - Intergenic
1081540928 11:44033998-44034020 GAAAGGAACTGGAGGGAGAGGGG + Intergenic
1081747702 11:45484537-45484559 GGGAGGAAGTGGAGGGAAAGAGG + Intergenic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081806342 11:45892869-45892891 TAGAGGAACCAGAGGGAAATGGG + Intronic
1082698039 11:56395051-56395073 TAGTTGAACTGGGGGGAAAATGG + Intergenic
1082799468 11:57403929-57403951 GAGAGGAACTGGAGGTGAATTGG - Intronic
1083065824 11:59922964-59922986 CAGAGGAAGAGGAGGGAGAGTGG + Intergenic
1083899816 11:65638178-65638200 CAGAGGTACTGGCGGGAGCAGGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1086525427 11:87719771-87719793 CAAAGGAACGAGACGGAAAATGG - Intergenic
1087726664 11:101725914-101725936 GAGAGGAAAGGGAGGGAAATAGG + Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088932459 11:114366039-114366061 CACAGGCACTGGAGGGAACAAGG - Intergenic
1089175613 11:116546952-116546974 CAGAGGAAGATGTGGGAAAATGG + Intergenic
1089271606 11:117305428-117305450 CAGAGGAACTAGCTGGGAAAAGG - Intronic
1090118169 11:123996852-123996874 CAGAGGATGTGGAAGGAAATAGG + Intergenic
1090188956 11:124756123-124756145 CACAGGGACTGGGGTGAAAAGGG - Intronic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090854960 11:130603076-130603098 CAGAGGAACTGGAGGGACCCTGG + Intergenic
1092844347 12:12570181-12570203 CTAAGGAACTGGAAGGAAAGAGG + Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093471369 12:19505614-19505636 CAGCGTAGCTGGAGGGAACAAGG + Intronic
1094313631 12:29113875-29113897 AAAGGGAACAGGAGGGAAAATGG + Intergenic
1095177250 12:39107171-39107193 CAGGGAAACTGGAGAGGAAATGG - Intergenic
1095238245 12:39824806-39824828 CACAGAAACTGCAAGGAAAAAGG + Intronic
1095817623 12:46441660-46441682 GAGTGGAACTGGATAGAAAAAGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1097141934 12:56909294-56909316 CAGAGGCCTAGGAGGGAAAATGG + Intergenic
1097201814 12:57285292-57285314 CAAAGGCACTGTAGGAAAAATGG + Intronic
1097210029 12:57360657-57360679 AAGAGGAAAGGGAAGGAAAAAGG + Intronic
1097327908 12:58300086-58300108 GAGATAAACTTGAGGGAAAAAGG + Intergenic
1097425101 12:59434638-59434660 CATAGGAACTGAAGGCAGAAAGG + Intergenic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1099343812 12:81472810-81472832 CCTAGGAACAGGAGAGAAAATGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1100861939 12:98815670-98815692 CTGAGGAACTGGAAAAAAAATGG - Intronic
1100995801 12:100299511-100299533 CAGACAAACTGCAAGGAAAAGGG - Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102542114 12:113628567-113628589 CAGATGAATAGGAGGGGAAATGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102758563 12:115365685-115365707 CAGAGGAACTGCAGGAGGAACGG - Intergenic
1102879490 12:116473476-116473498 CAGAGCAGCTGGAGGGAACTAGG + Intergenic
1103042060 12:117703909-117703931 CAAAGAAACTGGGGAGAAAAAGG + Intronic
1103193633 12:119023754-119023776 CAAAGAAATGGGAGGGAAAATGG - Intronic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1103949082 12:124541725-124541747 GAGTGGAACTGGAGGGAGATGGG + Intronic
1104080419 12:125425375-125425397 TAGGGGAACTGGAGGGGTAAAGG - Intronic
1104595019 12:130115074-130115096 CATGGGAACTGGAGGGAGAGAGG - Intergenic
1104830514 12:131747689-131747711 CAGATGAACTGGATGGATGAGGG + Intronic
1105069555 12:133226419-133226441 CAGAGGAACGTGAGGAAAAGGGG - Exonic
1105572949 13:21621216-21621238 CAGAGAGACTGAATGGAAAATGG - Intergenic
1105694091 13:22871393-22871415 CAGAGGCCTGGGAGGGAAAATGG + Intergenic
1106857843 13:33872228-33872250 CAAAGGCACTGGAGGGGAGAAGG + Intronic
1107196024 13:37652575-37652597 GAAAGGAAGAGGAGGGAAAAAGG - Intronic
1107520090 13:41171653-41171675 CAGAGGATTAGGAAGGAAAAAGG - Intergenic
1108347137 13:49557353-49557375 CAAAGGAAATGGAGAGGAAATGG + Intronic
1109340069 13:61045331-61045353 GAGAGAAAGTGGAGGAAAAATGG - Intergenic
1109459816 13:62641823-62641845 CACTGGAACTGGATTGAAAATGG - Intergenic
1109872027 13:68344650-68344672 TTGAGGAACTGGAAGAAAAATGG + Intergenic
1110001206 13:70203749-70203771 ACTAGGAACTGTAGGGAAAATGG + Intergenic
1110442217 13:75538291-75538313 AAGAGGAACAGCAGGGATAATGG - Intronic
1110866937 13:80407109-80407131 CAGAGCATTTGGAGGGAACATGG - Intergenic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111248676 13:85575022-85575044 CAGAGGATCCGTGGGGAAAAAGG - Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112337498 13:98527321-98527343 TAGATGAAGTGGAGGGAGAAGGG - Intronic
1112809653 13:103203260-103203282 CAGAGGAACTAGAATCAAAATGG - Intergenic
1112942049 13:104875217-104875239 CACAGGAGCTGGGGGGAGAAAGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113084501 13:106554448-106554470 GAGAGGAAGGGGAAGGAAAAAGG + Intronic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114683709 14:24507919-24507941 CAGAGCAAGTGGAAGGAAAAGGG - Intronic
1114742615 14:25113689-25113711 CACAGGAATTGGAGGGAATGGGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115909537 14:38240380-38240402 TAGAGTACCTGGATGGAAAAGGG + Intergenic
1116153098 14:41167164-41167186 CAGGGGAAAGGGAGGGGAAAGGG - Intergenic
1116476610 14:45347777-45347799 CAGAGAAACTGGATGAAATATGG - Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117773790 14:59161796-59161818 CACAGGAACAAAAGGGAAAAGGG + Intergenic
1118135806 14:63025371-63025393 CAGAGCAACTGGAAAGAGAAAGG + Intronic
1118380833 14:65216380-65216402 CAGACTATCTGGGGGGAAAAGGG + Intergenic
1118532958 14:66727953-66727975 CAGAGGCATAGGAGGAAAAATGG + Intronic
1118695323 14:68379389-68379411 CAGAGGGACTGCTGGGAGAAGGG + Intronic
1118698367 14:68408301-68408323 CAGATTAACTGGAGGGTCAAAGG + Intronic
1119467824 14:74873327-74873349 CAGAGAAACTGAAGGGGAAAAGG - Intergenic
1119569407 14:75657084-75657106 CAGAGAAGCTTGGGGGAAAAAGG + Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1119780448 14:77273546-77273568 CTGAGGAAATGGAGGCAAAGAGG + Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120571483 14:86122636-86122658 TAGAGGGATTGGAGGGGAAAAGG + Intergenic
1121042750 14:90762290-90762312 CAGAGGCACTGGTAGGAAATTGG - Intronic
1121108311 14:91295250-91295272 GAGAAGAACTGGAAGGAAAAAGG + Intronic
1121434479 14:93910124-93910146 GAGATGTACTGGATGGAAAAAGG + Intergenic
1121593262 14:95137156-95137178 AAGAGGAAGGGGAAGGAAAAGGG + Intronic
1121967278 14:98322136-98322158 GAGAGGAAATGGAAGGAAAAGGG - Intergenic
1122190507 14:100039046-100039068 TATAAGAACTGAAGGGAAAAAGG + Intronic
1122299415 14:100723448-100723470 CAGAGGAGCGGGGAGGAAAAAGG + Intergenic
1124997738 15:34740161-34740183 CAGAGAAACTTGACAGAAAAAGG + Intergenic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125613279 15:40987324-40987346 CAGATGAACTGAAATGAAAAGGG - Intronic
1125761639 15:42100206-42100228 CAGAGGAAGTGCAGGCAAAAGGG + Intergenic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1126960079 15:53982511-53982533 CAGAATAACTGGAGGAAGAAGGG + Intergenic
1127013374 15:54655236-54655258 CAGAAGAACAGGAGGGTAAGAGG + Intergenic
1127884996 15:63190560-63190582 CAAAGGAAGTGAAGAGAAAATGG - Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129403575 15:75300379-75300401 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1129544178 15:76377017-76377039 CAGAGCGACAGGAGGGCAAAGGG + Intronic
1129961956 15:79695007-79695029 CACAGCATCTGGAGGGAAGAAGG - Intergenic
1130270425 15:82443421-82443443 GTGAGGAACTGGAGGGTAACTGG - Intergenic
1130275543 15:82474410-82474432 GTGAGGAACTGGAGGGTAACTGG + Intergenic
1130462770 15:84170740-84170762 GTGAGGAACTGGAGGGCAACTGG - Intergenic
1130467903 15:84201805-84201827 GTGAGGAACTGGAGGGTAACTGG + Intergenic
1130473989 15:84247668-84247690 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130481402 15:84361736-84361758 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130485784 15:84397705-84397727 GTGAGGAACTGGAGGGTAACTGG - Intergenic
1130489907 15:84424047-84424069 GTGAGGAACTGGAGGGTAACTGG + Intergenic
1130496363 15:84471737-84471759 GTGAGGAACTGGAGGGTAACTGG - Intergenic
1130501495 15:84502797-84502819 GTGAGGAACTGGAGGGCAACTGG + Intergenic
1130590195 15:85206403-85206425 GTGAGGAACTGGAGGGTAACTGG + Intergenic
1131003244 15:88955100-88955122 CCGAGGACCTGGAGAAAAAAGGG - Intergenic
1131258256 15:90875557-90875579 GAGAGGAACAAGAGGGGAAAAGG - Intronic
1132104992 15:99057008-99057030 CAGAGCATCTGGAAGGGAAAAGG + Intergenic
1132851789 16:2028107-2028129 CAGGGGACCTGGAGGAAAAGGGG - Intronic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133749478 16:8713305-8713327 AAGAGGCCCTGGAAGGAAAAAGG + Exonic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1134291986 16:12909014-12909036 GAGAGAAACTGGAAGGCAAAAGG - Intronic
1134630673 16:15753585-15753607 CAGAAGATCTGGAAGGACAATGG - Intronic
1134780231 16:16888701-16888723 TTGAGCAACTGAAGGGAAAATGG + Intergenic
1135458692 16:22622134-22622156 CAGAGGAACTCGGGGGAAATAGG - Intergenic
1135611166 16:23868668-23868690 AAGAGAAAATGGAGGGGAAATGG - Intronic
1135702235 16:24642464-24642486 CAAAGGCACAGGAGGGGAAAAGG + Intergenic
1135795532 16:25438136-25438158 AAGAGCAACTGGGGGGAAAAAGG - Intergenic
1136248746 16:28989954-28989976 CAGAGGAAGTGGAGGAAGAGGGG + Exonic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137770256 16:51010668-51010690 CAGGGGAAGAGGTGGGAAAAAGG - Intergenic
1138033131 16:53577087-53577109 CAAAGGAACTGAAAGGAAATGGG + Intergenic
1139033301 16:62911703-62911725 CAGAGGCATAGGAGGAAAAATGG - Intergenic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1140186612 16:72778707-72778729 CAGGGGAAGTGAAGGGAGAAGGG + Intergenic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141154335 16:81586706-81586728 CAGAGGAGCCCGAGGGAAAGTGG - Intronic
1141552264 16:84813916-84813938 CAGAGTAACAGGAGGGAATATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142253171 16:89002127-89002149 CAGAGGAACTGGGGGGACAGAGG + Intergenic
1142253177 16:89002144-89002166 CAGAGGAGCTGGGGGGACAGAGG + Intergenic
1142253233 16:89002303-89002325 CAGAGGAACCGGGGGGACAGAGG + Intergenic
1142253331 16:89002581-89002603 CAGAGGAACCGGGGGGACAGAGG + Intergenic
1142253373 16:89002706-89002728 CAGAGGAACCGGGGGGACAGAGG + Intergenic
1142253401 16:89002780-89002802 CAGAGGAACCGGGGGGACAGAGG + Intergenic
1142253425 16:89002848-89002870 CAGAGGAACTGGGGGGACAGAGG + Intergenic
1142253443 16:89002899-89002921 CAGAGGAGCTGGGGGGACAGAGG + Intergenic
1142814481 17:2414574-2414596 CAGGGGAACTGAAAGGAGAAGGG - Intronic
1143197600 17:5087941-5087963 AAGAAGATCTAGAGGGAAAATGG + Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143588573 17:7865752-7865774 GAGATGCACTGGAGGTAAAAGGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1143988769 17:10938835-10938857 CACAGGTACTGGAGGGAGCAAGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145294674 17:21578743-21578765 CCCAGGAACTGGAGGCAAAGAGG + Intergenic
1145369158 17:22294431-22294453 CCCAGGAACTGGAGGCAAAGAGG - Intergenic
1146066609 17:29640656-29640678 AATAGGACCTGGAGGGAGAATGG + Intronic
1146098319 17:29954304-29954326 CAGAGGCCTAGGAGGGAAAATGG + Intronic
1146154048 17:30504782-30504804 CTGAGGAACTGGAGTTGAAATGG - Intronic
1146255542 17:31390069-31390091 CAGACGAACTGAAGGGTCAAAGG + Intergenic
1146264518 17:31443519-31443541 AAGAGGAACTGACAGGAAAAAGG - Intronic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146406098 17:32539506-32539528 TAGAGGCTCTGGAGGGAACATGG - Intronic
1146453846 17:32994708-32994730 CAGAGGAACTGGAGGGGACTAGG + Intronic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1147166472 17:38596189-38596211 CAGAGGAGCTGGAGAGAGGAGGG + Intronic
1147201215 17:38802828-38802850 CAGAGGAATTAGAGCGAAAACGG - Exonic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1147721009 17:42539361-42539383 CAGAGGAACAGGAGGGACAAGGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147818093 17:43224609-43224631 CAGAGAAACTTCAGGGAACAAGG + Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1148170433 17:45514978-45515000 CAGAGCATCAGGAGGGAACAGGG - Intergenic
1148170909 17:45518971-45518993 CAGAGCATCAGGAGGGAACAGGG - Intergenic
1148278772 17:46330830-46330852 CAGAGCATCAGGAGGGAACAGGG + Exonic
1148300982 17:46548692-46548714 CAGAGCATCAGGAGGGAACAGGG + Exonic
1148365112 17:47049581-47049603 CAGAGCATCAGGAGGGAACAGGG + Intergenic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1148572350 17:48680278-48680300 CAGAGAAACTGGAGGAAACCAGG - Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1150094884 17:62365053-62365075 TAAATGAACTGGAAGGAAAAAGG - Intergenic
1150401525 17:64860571-64860593 CAGAGCATCAGGAGGGAACAGGG - Exonic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1150781623 17:68127615-68127637 CAGAGTATCAGGAGGGAACAGGG - Intergenic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151143068 17:72013974-72013996 TAGAGGAACTGGAGGGTGGAGGG - Intergenic
1151534269 17:74729858-74729880 AAGAAGATCTGGAGGGACAAAGG + Intronic
1152806620 17:82359831-82359853 GAGGGGAACTTGAGGGAAACTGG - Intronic
1152916041 17:83036596-83036618 CAAAGGAACGGGACTGAAAACGG + Intronic
1153671913 18:7419627-7419649 CAAAGGAACTGAGGGAAAAAAGG + Intergenic
1153706218 18:7748401-7748423 CAGAGGAAGGGGAGGAAGAAGGG - Intronic
1153888602 18:9491351-9491373 CAGAGGACTTGGGGGGACAAAGG - Intronic
1155426148 18:25709666-25709688 CAGAAGAACAAGAGAGAAAAAGG + Intergenic
1156506372 18:37597576-37597598 CAGAGGATCTCCAGGGAAAGAGG - Intergenic
1156538432 18:37886395-37886417 TAAAGTAACTGGATGGAAAAAGG - Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157210273 18:45736104-45736126 AAGAGCAAGTGGAGGGACAAAGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157531284 18:48423073-48423095 AGGAGAAACTGGAGGGAAAAGGG - Intergenic
1157588999 18:48824974-48824996 GAGAGGAAGTGGAGGAAAACAGG - Intronic
1157869992 18:51221178-51221200 CAGAGGAAAAGGAGGGGAAGTGG + Intergenic
1158684163 18:59598024-59598046 AAGAGAAAGTGTAGGGAAAATGG + Intronic
1159552380 18:69908616-69908638 AATATGAATTGGAGGGAAAAGGG - Intronic
1159739443 18:72147827-72147849 CAGAGGAATAGCAGGAAAAATGG - Intergenic
1159864476 18:73687998-73688020 CACATGAACTGGGGGGAAAAGGG - Intergenic
1160208448 18:76857086-76857108 CATAGGAACTGGGGGGACATGGG - Intronic
1160617765 18:80146664-80146686 CATAGGAGCTGTAGAGAAAATGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161796894 19:6392506-6392528 CAGAGGAACAGGATGTACAAAGG + Intronic
1162067146 19:8132826-8132848 AAGAGGAGGAGGAGGGAAAAGGG - Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164235043 19:23324248-23324270 GAGAGGAAGTGGAGAAAAAAAGG - Intronic
1164250180 19:23468990-23469012 GAGAGGAAGAGGAGAGAAAAAGG - Intergenic
1164690514 19:30207548-30207570 CAGAGGAGGTGGAGCGGAAAGGG + Intergenic
1164889071 19:31807532-31807554 GAGAGGAACAGGAGTGAACATGG + Intergenic
1164966911 19:32493070-32493092 CAGAGGAAGAGGTGAGAAAAGGG + Intergenic
1167017402 19:46850125-46850147 GAGAGGACCTGGAGGTAAGATGG - Intronic
1168401342 19:56087688-56087710 CTGAGGAAGAGCAGGGAAAATGG + Exonic
925294648 2:2768943-2768965 GAAGGGACCTGGAGGGAAAAGGG - Intergenic
925790108 2:7475985-7476007 CAGATGAACGGGAAGCAAAATGG + Intergenic
925803075 2:7621117-7621139 TAAAGGAACTGGAGTGAACAAGG - Intergenic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926736722 2:16079026-16079048 CAGAGGACATGCAGGGAAAGGGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927711281 2:25327946-25327968 CAAAGGGCCTGGAGGGAATAGGG - Intronic
928115824 2:28544604-28544626 CAGAGGAACGAGAGTCAAAAGGG + Intronic
928142345 2:28740671-28740693 CAGAGGAAGTGGTAGGAAATAGG - Intergenic
929197777 2:39204022-39204044 AGGAGGAACTGAAGGGAAAGGGG - Intronic
929590926 2:43145730-43145752 CGTAAGAACAGGAGGGAAAAGGG + Intergenic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931267545 2:60673870-60673892 AAGAGTTAGTGGAGGGAAAATGG + Intergenic
931856932 2:66312505-66312527 CAAAGGAAGAGGAGGAAAAAAGG + Intergenic
934098649 2:88630185-88630207 CAGAGTATCTGGAGGAAAAGGGG + Intergenic
934713780 2:96531657-96531679 CAGGGCAACTAAAGGGAAAAGGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936039303 2:109137656-109137678 CAGAGATACTGGAGAGAAAGAGG + Intronic
936315352 2:111420101-111420123 TTGAGGAAATGGGGGGAAAAGGG - Intergenic
936776069 2:115974996-115975018 AAGAGATACTGGAGTGAAAAGGG - Intergenic
937028158 2:118716438-118716460 CAGATGAAAGGGAGGGAGAATGG - Intergenic
937563334 2:123252660-123252682 CAAAGCAACAGGAGGAAAAATGG - Intergenic
937787637 2:125921047-125921069 CGGAGTAAGTGTAGGGAAAAAGG - Intergenic
938470784 2:131558981-131559003 CAGAGGAACTGCAGTGGAGAAGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
939662812 2:144911386-144911408 CAGAGGAACTGCAGGGGTATTGG + Intergenic
939969369 2:148643259-148643281 AAGAGGAACAGGAGGAAAAAGGG + Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940616445 2:156054636-156054658 CAGAGGATCTCCAGGGAAACTGG - Intergenic
940638478 2:156325702-156325724 CAAAGGAACTGGAATGATAATGG - Exonic
940839607 2:158564623-158564645 GTGAGGAACTGGGGGGAAATGGG - Intronic
941460575 2:165766674-165766696 CAGAGGAACTGAAGGGTGATGGG - Intronic
941916861 2:170818698-170818720 CAAATGAACTGCAGGGAAGATGG + Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942336476 2:174892377-174892399 GAAAGGAACAGAAGGGAAAAAGG - Intronic
942487901 2:176458512-176458534 CAGAGGGACTTGAGGGTAAGTGG - Intergenic
942533670 2:176940082-176940104 CAGAGGATCTGGAAGGAATGAGG - Intergenic
942745681 2:179229293-179229315 CAGAACAAAAGGAGGGAAAAAGG + Intronic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
945064980 2:205940743-205940765 CACAGAAATTGGAAGGAAAAGGG + Intergenic
945111452 2:206364264-206364286 CAGATTAACAGGAGGAAAAAGGG + Intergenic
945512133 2:210715512-210715534 CAGAGGCACTTGAGAGATAAAGG + Intergenic
948166112 2:235863898-235863920 AAGAGAAACTAGAGGGAACAAGG + Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
948547314 2:238742109-238742131 CAGATTCACAGGAGGGAAAATGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948662125 2:239514146-239514168 CACAGGACCTGGAGGCAGAATGG + Intergenic
948878876 2:240845680-240845702 CAGAGGCCTAGGAGGGAAAAAGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169276582 20:4237148-4237170 CAGAGGACCAGGAGGGAGATGGG + Intronic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1170059285 20:12242691-12242713 CAGAGGAACTATGGAGAAAAGGG - Intergenic
1170144755 20:13160997-13161019 CAAATGAACTGGAGAGGAAAGGG + Intronic
1170500692 20:16973092-16973114 CAAAGGAACAGCAGTGAAAATGG - Intergenic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1170555654 20:17512921-17512943 CAGGGGCACTGGCGGGTAAAGGG - Intronic
1170691788 20:18622849-18622871 CAGAGGAACTTGCGGGATATTGG - Intronic
1171055641 20:21903839-21903861 CAAAGGAAATGGAGGGAAAGTGG - Intergenic
1172036916 20:32017785-32017807 CCCAGGAACTGGATGGAAATCGG - Exonic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1173280331 20:41621229-41621251 GGGAGGAACTGAAGGGGAAAGGG + Intergenic
1173311267 20:41898051-41898073 CTTAGGAACAGCAGGGAAAATGG - Intergenic
1173337513 20:42124844-42124866 AAGGGGAAATGGAGGGACAAAGG - Intronic
1174003639 20:47392949-47392971 CACTGGAACTGTTGGGAAAAGGG + Intergenic
1175021305 20:55852814-55852836 CGGAGGAACAGAAGAGAAAAGGG + Intergenic
1177144376 21:17391791-17391813 CATGGGAACTGGAGGGCAAGGGG - Intergenic
1177759132 21:25382904-25382926 CAGAGGATCAGTAGGCAAAAAGG - Intergenic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1180196192 21:46195749-46195771 CCCAGGAGCTGGAGGGAAACAGG + Exonic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182156082 22:28074427-28074449 AACAGGAGCTGGAGGGAGAAGGG - Intronic
1182320526 22:29475979-29476001 CAGAGAAATTGGGGGGAAAGAGG + Intergenic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182932539 22:34188903-34188925 CAGAAGAGCAGGAGGGCAAAAGG + Intergenic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1182980313 22:34664258-34664280 TAGAAAAACTAGAGGGAAAAAGG + Intergenic
1183077481 22:35436188-35436210 AAAAGAAAATGGAGGGAAAATGG + Intergenic
1183966110 22:41443958-41443980 AAGAGGAAAAGGAGGGATAATGG + Intronic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1185294241 22:50045542-50045564 CAGAGACACTGCAGGGAGAAGGG - Intronic
949133237 3:531043-531065 CTGAGGAACAGAATGGAAAAAGG + Intergenic
949374212 3:3368966-3368988 AAGAAAAACTGGAGGGAAAGTGG - Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
951170804 3:19539695-19539717 CAGAGGAACTGTGGGTAAGAGGG - Intergenic
951693947 3:25426698-25426720 CAGAGGCAGTGGAGAAAAAAGGG + Intronic
951843858 3:27064258-27064280 TAGAGGAGCATGAGGGAAAATGG + Intergenic
952038250 3:29230667-29230689 GAGAGGAAAGGGAAGGAAAAAGG - Intergenic
952127696 3:30321128-30321150 AAGAGGCAATGGAAGGAAAATGG + Intergenic
952819560 3:37474602-37474624 CAGAGGAACTGACTGGGAAAGGG - Intronic
953162758 3:40436665-40436687 CACAGGAACTGGAAGGCACAAGG + Intergenic
953454307 3:43029731-43029753 TAGAGGAACTGGAGGTAGGAGGG + Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954349248 3:50029226-50029248 AAGAGAAACTGCAGAGAAAAGGG + Intronic
954351438 3:50047510-50047532 CACAGGAACAGGTGGGAAAAGGG - Intronic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955691233 3:61592444-61592466 AAGAGGCACTGGGGGAAAAAAGG + Intronic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
955980577 3:64522014-64522036 CAGAGGAGCAGGAGATAAAAAGG + Intronic
956170116 3:66426550-66426572 CATGGGCACTGGAGGGACAATGG - Intronic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
956493943 3:69804292-69804314 GAGAGGAAGGGGAGGGAAATGGG - Intronic
956733122 3:72214857-72214879 AAGAGAAAGTGGATGGAAAATGG - Intergenic
956914189 3:73853452-73853474 CAGAGGAACCAAAAGGAAAAAGG + Intergenic
956935351 3:74094651-74094673 CAAAGGAAATCAAGGGAAAATGG + Intergenic
957150272 3:76477552-76477574 CAGAGAAACTAGAGGTATAATGG - Intronic
958005387 3:87803123-87803145 CAGATGAATTCGAGAGAAAATGG - Intergenic
958147926 3:89650814-89650836 TAGAGGAATGGGAGAGAAAAGGG + Intergenic
958762488 3:98326091-98326113 CAGAGAAGCAGGAGGGAAACTGG - Intergenic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
959852002 3:111098400-111098422 TAGAGCCACTGGAGGGAACACGG - Intronic
960434745 3:117612013-117612035 CAGAGAAAATGGGGGAAAAAAGG + Intergenic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
961406030 3:126680078-126680100 GAGAGGCACTGGAGGGAGATGGG + Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961678639 3:128583960-128583982 GGGAGGAAGTGCAGGGAAAAAGG - Intergenic
961696959 3:128712030-128712052 CAGAGGAACTAGAGGCACAAAGG + Intergenic
961702070 3:128752330-128752352 CAAAGGAAGTGGAAGAAAAATGG + Intronic
962265682 3:133942773-133942795 AAGAGGAAGGGGAGGGAAAAAGG + Intronic
962552376 3:136508113-136508135 TAGAGGAACGTGAGGGAACAAGG + Intronic
963928394 3:150976250-150976272 CAGAGAGACTGCAAGGAAAATGG - Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
965951130 3:174309424-174309446 CAGATGCACTGGTGGGATAAGGG - Intergenic
966123972 3:176553686-176553708 CAGATGAAGAGGAGGGAGAAGGG - Intergenic
966242166 3:177766738-177766760 CAGAGGAACAGGAGAGAGTATGG - Intergenic
966297449 3:178440630-178440652 CAGGGAAACTGGAGGGTAAGGGG + Intronic
966472234 3:180303655-180303677 CAGAGGAATAGTTGGGAAAAGGG + Intergenic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967226169 3:187293455-187293477 TAGAGAAACTGGAGAGAAAATGG - Intergenic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967408339 3:189142028-189142050 CTGAGGAACTGGGGGAAACAGGG + Intronic
968252094 3:197228009-197228031 CTGAGGCACTGCAGTGAAAAAGG - Intronic
968325881 3:197815199-197815221 GAGAGAAACTGGAGGGACATAGG - Intronic
968937274 4:3617703-3617725 GGGAGGAATGGGAGGGAAAAAGG - Intergenic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
970210269 4:13702593-13702615 CTGAGGCACAGGATGGAAAAGGG + Intergenic
970554876 4:17220978-17221000 CAGGGCAAGTGGAGGGAGAAAGG - Intergenic
971455265 4:26838118-26838140 CAGAGGAAATGGATGGGAAAGGG - Intergenic
971959542 4:33467678-33467700 CGCAGGAACGGGAGGAAAAACGG - Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
977554701 4:98477082-98477104 CAGAGGATCTGTAGGTGAAAGGG + Intronic
977928523 4:102728261-102728283 CAGAGCAACAGGAAGGAACAGGG - Intronic
979311631 4:119210730-119210752 TGGAGGAACTGGAGGAAGAATGG + Intronic
979561460 4:122106538-122106560 CAGAGCACCTGGAGGGAGCAGGG + Intergenic
979984421 4:127296135-127296157 CAGAGGCCTAGGAGGGAAAAAGG - Intergenic
980439949 4:132829361-132829383 CTGAGCAACTGGAAGGATAAAGG - Intergenic
981594022 4:146398917-146398939 CAGGAGAACGGGAGTGAAAAAGG + Intronic
981733206 4:147921750-147921772 GGGAGGGACTGGAGGTAAAACGG - Intronic
981828539 4:148973409-148973431 GAAAGGAACTGGAGGGGAAGGGG + Intergenic
982081351 4:151793331-151793353 CAGAGGAAGTGGATCGAAGAAGG + Intergenic
982089803 4:151870636-151870658 CAGAGGAACTGGGGGTATAAAGG + Intergenic
982912379 4:161160704-161160726 CTGAGAAATTGGAGAGAAAAAGG - Intergenic
983101423 4:163630875-163630897 CAGAAGAAATGCAAGGAAAAAGG + Intronic
983225514 4:165082525-165082547 CAGAAAAACTGGAGGAGAAAGGG - Intronic
983711109 4:170716607-170716629 CAGAGGAACTGGTGAGAAAAGGG + Intergenic
985135935 4:186786218-186786240 CAAAAGAGCTGGAGGGAAACAGG - Intergenic
985308912 4:188575946-188575968 CAAAGGAACTTGGGAGAAAATGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985955434 5:3262166-3262188 CAGGGCAACAGGAGGGAGAAGGG - Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987333050 5:16873882-16873904 CAGAGGCCCAGGAGGAAAAATGG - Intronic
988009170 5:25461573-25461595 CAGAGGCCCAGGAGGAAAAAGGG + Intergenic
988479558 5:31618652-31618674 CAGAGGCTCGGGAGAGAAAAAGG + Intergenic
988705841 5:33725268-33725290 AAGATGAACTGGAAGGAAATCGG - Intronic
989182807 5:38595450-38595472 CCCAGGGACTGGAGGGAAAGAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990378488 5:55197255-55197277 CAGAGGAGCTTGGGGTAAAAAGG - Intergenic
990686622 5:58310027-58310049 CAGAAGAAGTGAAGAGAAAAAGG - Intergenic
991443129 5:66672327-66672349 AAAAGGAAAGGGAGGGAAAAAGG - Intronic
991968459 5:72114814-72114836 GAGAGGAACAGGAGGGCAAGAGG - Intronic
992040584 5:72827004-72827026 GAGAGGAAATGGAGAGTAAAGGG + Intronic
992430378 5:76704948-76704970 TTTAGGAACTGAAGGGAAAATGG - Intronic
992982338 5:82188694-82188716 CAGAGGACCTGGAGGGGAAATGG + Intronic
993517032 5:88850347-88850369 CAGATGAAATGGAGGCAAAGAGG + Intronic
995011432 5:107260470-107260492 CAGAGGCCTTGGAGGAAAAATGG - Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
995518678 5:112978462-112978484 CACAGGCACTGGAAAGAAAAAGG - Intronic
996408530 5:123130206-123130228 GAGAGGAAGGGAAGGGAAAAGGG - Intronic
996695762 5:126393118-126393140 CAGAGGAAGGGGAGAAAAAAGGG - Intronic
996914701 5:128698482-128698504 CAGAGAAACTTGAAGGAAAGAGG - Intronic
998506461 5:142676145-142676167 CAAAGGAACAGCAGGGAAACAGG + Intronic
998533952 5:142911700-142911722 CAGAGAAATGGGAGGGAATAGGG - Intronic
998593200 5:143499765-143499787 ATGAGGAAATGGAGGCAAAAAGG + Intergenic
998765111 5:145477877-145477899 AAGAGGAATAGGAGGGAAAGGGG + Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1000983554 5:167842614-167842636 CTGAGGAACTGGGGGATAAAAGG - Intronic
1001016491 5:168146284-168146306 GAGAGGAATTAGAGGGGAAAAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001548006 5:172582433-172582455 CAAAGGAACTGGAGGGACTGGGG + Intergenic
1001597219 5:172906107-172906129 CAAAGGAGCTGGAGGGAGAGAGG - Intronic
1001744800 5:174084120-174084142 TGGAGGAAATGGAAGGAAAAAGG - Intronic
1001853354 5:174989043-174989065 CACAGGAAGTGGAGGGAACCAGG - Intergenic
1001937482 5:175715589-175715611 CAGGGGAACTGGAGAGAGCAGGG + Intergenic
1001939902 5:175733042-175733064 CAGCGGGACTGGACAGAAAAGGG + Intergenic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002530323 5:179840675-179840697 GAGAGGCATGGGAGGGAAAAGGG + Intronic
1003494669 6:6653722-6653744 CTGAGCAACTGGAAGGAGAAAGG - Intronic
1003509230 6:6765550-6765572 CAGGAGATCTGGAGGGAACAAGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1005114608 6:22321795-22321817 AAGAGGTACTGGACAGAAAATGG - Intergenic
1005518253 6:26574906-26574928 CAAAAGAAATGGAGGGCAAAAGG - Intergenic
1005730752 6:28694490-28694512 CAGAAGAAGTTGAGGGAAAGGGG + Intergenic
1005853171 6:29838197-29838219 CATAGGAAATGGTGGGAAACTGG - Intergenic
1006113568 6:31763270-31763292 CTGAGGACCTGGAGGGCAAGGGG - Intronic
1006228278 6:32559016-32559038 CAGAGAGACTGAAGGGAAAGAGG + Intronic
1006630998 6:35429439-35429461 CAGGGGAACAGGAGGAAAAGAGG + Intergenic
1007242499 6:40437208-40437230 GAGAGGATCTGGAGGGACAGTGG - Intronic
1007255527 6:40525648-40525670 CACAGGAACTGAGGGGCAAAGGG - Intronic
1007502874 6:42312160-42312182 CAGATTAACAGGAGGAAAAAAGG + Intronic
1008481409 6:51989838-51989860 CAGAGGAAATGAAGGGATAGGGG + Intronic
1008627148 6:53327827-53327849 GAGAGGAAATGGAAGGTAAAAGG - Intronic
1009674395 6:66797987-66798009 CACAGGAAAGGAAGGGAAAATGG + Intergenic
1009923021 6:70086415-70086437 AAGAGGAAGGTGAGGGAAAAAGG + Intronic
1010360205 6:74984728-74984750 CAAAAGAATTGGAGGGAAATTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1013596356 6:111664252-111664274 CACAGGAACTGAGGGGAAACAGG + Intronic
1013825432 6:114205433-114205455 CAGAGTAACTGGAGAGGGAATGG - Intronic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014134009 6:117866757-117866779 CAGAGGCCCAGGAGGAAAAATGG - Intergenic
1014212342 6:118720191-118720213 AAGAAGAAAAGGAGGGAAAAAGG - Intergenic
1014426777 6:121316472-121316494 CTGAGGAACTGTGTGGAAAAAGG - Intronic
1014480684 6:121932753-121932775 CAGAGGGACTGGAAGGTCAAGGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1015055567 6:128898877-128898899 CAGAGGAACAGCAAGGACAAAGG - Intronic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1017858783 6:158376108-158376130 GAGAGGAGGTGCAGGGAAAAGGG - Intronic
1017896755 6:158686738-158686760 GACAGGAATTGGAGGCAAAAAGG + Intronic
1017953972 6:159162711-159162733 CAGAGGAGATGGAGGAACAAAGG + Intergenic
1018362317 6:163084433-163084455 TAGAGGAACTGAAGAGAAAATGG + Intronic
1018761808 6:166899856-166899878 CACAGGAATTGGGGGGACAAGGG - Intronic
1018921614 6:168179705-168179727 CAGGGGAATTGGAGGGGAATTGG + Intergenic
1020250729 7:6466316-6466338 CAGAGGATCTGGAAGAGAAATGG + Exonic
1020871880 7:13640905-13640927 GGGAGGCACTGGAAGGAAAATGG - Intergenic
1021606800 7:22416225-22416247 CAGAGAAAATGTAGAGAAAATGG - Intergenic
1021715861 7:23461522-23461544 CAGAGCAACTGGGTGGAAGATGG - Intronic
1021781971 7:24115073-24115095 CACAGAAGCTGGAGGGAAAATGG + Intergenic
1022728711 7:33003504-33003526 GAGAGGAATTGGAGGCAGAAAGG - Intronic
1022763123 7:33379162-33379184 CAAAAGAACTGTAGGGACAAAGG - Intronic
1023124587 7:36942901-36942923 CCAAGGATCTGGAAGGAAAAAGG + Intronic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024035724 7:45506124-45506146 AAGAGGAACTGGAGAGGAAGAGG - Intergenic
1025044938 7:55684485-55684507 GAGAGGAATTGGAGGCAGAAAGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026557563 7:71421536-71421558 CTGAGGAACTGGAGGGATGTTGG + Intronic
1027858401 7:83542708-83542730 CCAAGTAACTGGAAGGAAAAGGG - Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1029409074 7:100397503-100397525 CTGAGGACCTGGAGGGAATGGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1030406991 7:109127698-109127720 CAGAGAAACTGGTAGGAGAAAGG - Intergenic
1030431962 7:109461099-109461121 CAAAGGAACAGGATGGAAAAAGG - Intergenic
1031882161 7:127209716-127209738 CAGAGGAACTTCAGTGAAGATGG - Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1032955803 7:136970877-136970899 CAATGGAACTGAAGGAAAAATGG - Intronic
1033032430 7:137840292-137840314 CAGATGAGCTGGAAGGAAAGAGG + Intronic
1034862914 7:154615470-154615492 CACAAAAACTGGAGGGAAAATGG - Intronic
1035058357 7:156051575-156051597 CAGAGGCACTGGAGTGCTAATGG - Intergenic
1035341478 7:158165313-158165335 GAGAGGTGCTGGAGGGAAAGTGG + Intronic
1035461718 7:159043198-159043220 GAGAGGAATTGGAGGGGGAAGGG + Intronic
1036001716 8:4612547-4612569 CCGAGGAACTGGAGGAACAGTGG + Intronic
1036489967 8:9215721-9215743 CAGAGGAACTGGTCGAAACATGG - Intergenic
1036917648 8:12820220-12820242 AGGAGGAACAGGAGGGCAAAAGG + Intergenic
1037330896 8:17742551-17742573 CAGAGGATCTGGGTGGAAACAGG - Intronic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1037916002 8:22773837-22773859 TAGAGGAACAAGATGGAAAAGGG - Intronic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038297759 8:26311747-26311769 TGGAGGAACTGGAGAAAAAAGGG - Intronic
1038482098 8:27908953-27908975 AAAAGGAAATAGAGGGAAAAAGG - Intronic
1039652102 8:39353354-39353376 CAGAGGACTAGGAGGAAAAATGG + Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041273029 8:56127430-56127452 CAAAGGAAAGGAAGGGAAAATGG + Intergenic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1043492534 8:80763572-80763594 CAGAGGCCTAGGAGGGAAAATGG - Intronic
1044012359 8:87010206-87010228 CAAGGGAAGTGGGGGGAAAAAGG - Intronic
1044065246 8:87690560-87690582 CTGAGGAACAGGATGGAATATGG + Intergenic
1044228267 8:89744122-89744144 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1044466455 8:92512504-92512526 CAGAGAAGCTGGGGGGAAATGGG - Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044637709 8:94343002-94343024 CACAGGGTCTGGATGGAAAAAGG + Intergenic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1046363644 8:113195903-113195925 GAGAGGAAGTGAAGGCAAAAAGG - Intronic
1046820400 8:118628565-118628587 CAGAGGAGCAAGAGAGAAAAAGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047676677 8:127210239-127210261 CAAAGGCACTGGAGGAAATAAGG + Intergenic
1047711317 8:127555411-127555433 CACAGTAATTGAAGGGAAAATGG - Intergenic
1047713723 8:127576544-127576566 AACAGGAACTGGTGGGAGAATGG - Intergenic
1048277582 8:133078458-133078480 CTGAGGAACAGTATGGAAAATGG - Intronic
1048393585 8:133990961-133990983 CAGGGCAACTGGAGGAAAATGGG + Intergenic
1048787169 8:138062838-138062860 AAGGGGAACTGTCGGGAAAAGGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1048879970 8:138864085-138864107 CAGAGGAAGAGGAGGGACCAAGG + Intronic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049261398 8:141641116-141641138 CAGAGGTGCTCCAGGGAAAATGG - Intergenic
1049751437 8:144286141-144286163 CTGATGAACAGGGGGGAAAAGGG + Intronic
1049858130 8:144876672-144876694 CAGAGAAATTCCAGGGAAAAAGG + Intronic
1049979711 9:892817-892839 CTGAGGAACTGGATGAGAAAAGG - Intronic
1050641389 9:7671314-7671336 CAGAGAAAATGAAGAGAAAAGGG + Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052360707 9:27553505-27553527 CATAGGAATTGGAGTGAAACTGG + Intronic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1055157176 9:73078751-73078773 CAGAGGTACTTGACAGAAAATGG + Intronic
1055495435 9:76849983-76850005 CAGAGGACATGCAGAGAAAAGGG - Intronic
1057706632 9:97399496-97399518 CAAAGGAAGTGGAGGCAAAAAGG - Intergenic
1058801046 9:108544739-108544761 GAGAGGAAGTGAAGGAAAAAGGG + Intergenic
1059326192 9:113505313-113505335 CAAGGGAACTGGAGGCACAAAGG - Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1060171074 9:121461554-121461576 TAGAGGAAGAGAAGGGAAAAGGG + Intergenic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1060589783 9:124809489-124809511 CAGAGGAACAGCAGGGACGAAGG + Intronic
1061057716 9:128233173-128233195 CATAAGAACTGGGGGGAAAGAGG + Intronic
1062161075 9:135080255-135080277 CAGAGAAGCTGGAGGGGAAGAGG - Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1186969080 X:14820264-14820286 CAGAGGAACAAGAAGGGAAAAGG - Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187634371 X:21210950-21210972 CAGAGACATAGGAGGGAAAATGG + Intergenic
1188069865 X:25705560-25705582 CAGAGGACTAGGAGGAAAAATGG + Intergenic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1189326051 X:40111755-40111777 CAGAGAAACTGGGGGGGAAGGGG - Intronic
1189701196 X:43717259-43717281 CAGAGGAATAGTAGGGAAATAGG + Intronic
1189915914 X:45855792-45855814 TAGAGGAACTGGAGGGGGCATGG + Intergenic
1190111272 X:47590574-47590596 CAAAGGACCTGGAGGGACAGAGG - Intronic
1190438419 X:50450927-50450949 AAGACGAATTGGAGGGAACAAGG - Intronic
1190458247 X:50645687-50645709 GAGAGGTGGTGGAGGGAAAAGGG + Intronic
1190531854 X:51386442-51386464 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1193039143 X:76986557-76986579 AAGAGGAAGAGGAGGGAAAATGG - Intergenic
1194269948 X:91800128-91800150 AAGAGAAAGTGGAGAGAAAATGG - Intronic
1194597692 X:95879016-95879038 AAGTGGAACTGGAAGGTAAAAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198033209 X:132775397-132775419 GAGAGGAACTGGAGGAAGAGCGG - Intronic
1199681437 X:150227347-150227369 AAAATGAACTGGGGGGAAAAAGG + Intergenic
1199838680 X:151620892-151620914 AGGAGGAGGTGGAGGGAAAAAGG - Intronic
1200587189 Y:5021567-5021589 AAGAGAAAGTGGAGAGAAAATGG - Intronic
1201257001 Y:12117772-12117794 AAAAGAAACTGGAGTGAAAAAGG + Intergenic
1202368282 Y:24181325-24181347 GTGAGGAACTGGAGGGTAACTGG - Intergenic
1202372415 Y:24207857-24207879 GTGAGGAACTGGAGGGTAACTGG + Intergenic
1202498370 Y:25462263-25462285 GTGAGGAACTGGAGGGTAACTGG - Intergenic
1202502503 Y:25488792-25488814 GTGAGGAACTGGAGGGTAACTGG + Intergenic