ID: 927489966

View in Genome Browser
Species Human (GRCh38)
Location 2:23514796-23514818
Sequence CAGCAAGGATAGATGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927489966_927489971 6 Left 927489966 2:23514796-23514818 CCACGCTCCATCTATCCTTGCTG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 927489971 2:23514825-23514847 CTTCAGTTGGTTCTTCCACCCGG 0: 1
1: 0
2: 2
3: 15
4: 156
927489966_927489970 -7 Left 927489966 2:23514796-23514818 CCACGCTCCATCTATCCTTGCTG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 927489970 2:23514812-23514834 CTTGCTGCTTTGGCTTCAGTTGG 0: 1
1: 1
2: 0
3: 25
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927489966 Original CRISPR CAGCAAGGATAGATGGAGCG TGG (reversed) Intronic
900203248 1:1420553-1420575 CAGCACGGCCAGGTGGAGCGGGG + Exonic
900369102 1:2323624-2323646 CAGCAAGGAGGGGTGCAGCGAGG - Intronic
900594549 1:3474776-3474798 CAGCAAGGTAAGATGGGGCCTGG + Exonic
900863045 1:5246371-5246393 AAGGAAGGATAGAGGGAGGGAGG - Intergenic
901070190 1:6513119-6513141 CTCCCAGGCTAGATGGAGCGAGG - Intronic
901171168 1:7258724-7258746 CAGCAATGAAAGATGCAGAGAGG - Intronic
902376190 1:16031031-16031053 CAGCAAGGACAGCAGGAGTGGGG - Intronic
902381118 1:16052757-16052779 CAGCAAGGACAGCAGGAGTGGGG - Intronic
904010387 1:27386366-27386388 CAGCTAGGATAGAGGAAGAGAGG - Intergenic
904424684 1:30415770-30415792 CAGCAAGGAAGGAGGGAGCTGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905406469 1:37735712-37735734 CAGCAAGTATAGAAAGAGCCTGG - Intronic
905791584 1:40792410-40792432 TAGCAGGGATATATGGAGAGAGG - Intronic
906904174 1:49870457-49870479 CAGAAAGGATAAATGGATTGAGG + Intronic
908824128 1:68117078-68117100 AAGCAGGGATAGAGGGAGGGAGG - Intronic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
911186114 1:94906577-94906599 TAGCAAAGATAGATGGAGCCAGG - Intronic
912245739 1:107960107-107960129 CAGCAAGGATAGAAGTGGCCAGG - Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912577391 1:110685972-110685994 AAGCAAGGAGAAATGGAGAGAGG - Intergenic
913207613 1:116555454-116555476 AAGCAAAGAGAGATGGAGGGAGG + Intronic
915177785 1:154031041-154031063 CAGAAAGGATAAATGCAGCTGGG - Intronic
915969918 1:160347404-160347426 AAGAAAGGATAGAAGGAGGGAGG - Intronic
917460809 1:175227523-175227545 CAGCCAGGATAGATGGCTCAAGG + Intergenic
917512702 1:175681441-175681463 CAGCAAAGAGAGCAGGAGCGAGG + Intronic
919939039 1:202273853-202273875 CAACAAGGAGAGATGGAAAGGGG - Intronic
924286551 1:242493603-242493625 CACCGAGGATAGCTGGAGAGAGG + Intronic
924645133 1:245870497-245870519 ATGCAGGGATAGATGGAGCGAGG - Intronic
1063940278 10:11121430-11121452 CAGCAAGGACAGAGGGAGAGAGG - Intronic
1064072814 10:12245290-12245312 CACCCAGGATAGATGGAGTGTGG + Intronic
1066290498 10:34010083-34010105 AAGGAAGGAGAGATGGAGGGAGG + Intergenic
1067159605 10:43813213-43813235 CAGCATGGATGGCTGGAGTGTGG + Intergenic
1067833685 10:49624846-49624868 ATGCAAGGATAGATGGATGGTGG + Intronic
1070153385 10:73818834-73818856 CTGCAAGGATAGATGGTGGGAGG + Intronic
1070567059 10:77611804-77611826 CAGCAAGCATTCATGGGGCGAGG + Intronic
1071142560 10:82527797-82527819 CAGAAAGGAGAGACGGAGAGAGG - Intronic
1074311530 10:112327110-112327132 CAGGAAGCAAAGATGGAGCCAGG + Intergenic
1074538129 10:114343545-114343567 CAGCAAGGAGGGAGGGAGGGAGG + Intronic
1074546688 10:114406677-114406699 CAGCAAGGAAGAATGGAGCTGGG + Intergenic
1074559389 10:114521660-114521682 AAGGAAGGAAAGAAGGAGCGGGG - Intronic
1076504788 10:130964467-130964489 CAGGAAGGACAGATGGATGGTGG - Intergenic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1086208382 11:84287661-84287683 AAGAAAGGAGAGATGGAGGGAGG - Intronic
1088435791 11:109811875-109811897 AAGCAGGGATGGATGGAGAGAGG + Intergenic
1090856426 11:130612723-130612745 CAGGAAGCATAGGTGGAGTGAGG + Intergenic
1092193801 12:6537286-6537308 CTGCAAAGAAAGAGGGAGCGGGG - Intronic
1092993341 12:13924525-13924547 CAGCAGGGATAGAGGGAGCTGGG + Intronic
1096749872 12:53751875-53751897 CCGCAAGGAGAGAGGGAGCGGGG - Intergenic
1097555149 12:61127492-61127514 CAGCAGTGATGGATGGAGCAAGG + Intergenic
1104373476 12:128244189-128244211 CAGCAAGGAGAGAGGGACCTCGG - Intergenic
1105794168 13:23834095-23834117 CAGCAAGGGTGGGTGGAGAGAGG + Intronic
1109551149 13:63902312-63902334 TAGCAAGGCTTGATGGGGCGGGG + Intergenic
1110293546 13:73835615-73835637 AAGCAAGGAGAGATGCAGTGGGG + Intronic
1111328321 13:86729775-86729797 CAACTAGGAAAGAAGGAGCGAGG + Intergenic
1111553319 13:89846118-89846140 CAGTAAGGGTAGCTGGAGAGAGG - Intergenic
1113737307 13:112688237-112688259 CAGCAAGGATAGAGAGGGCATGG + Intergenic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1115464751 14:33702821-33702843 CAGTAAGGATTGAGGGAGCTGGG + Intronic
1118480278 14:66158030-66158052 CATCAAGGAGAGAAGGAGTGTGG + Intergenic
1119218629 14:72888634-72888656 TAACAAGGAAAGATGGAGAGTGG - Intronic
1119548392 14:75490321-75490343 CAGCCAGGAAATATGGAGCCAGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1127020626 15:54744039-54744061 CAGCAAGGAAGGAGGGAGGGAGG + Intergenic
1134875060 16:17690777-17690799 CACCAAGGAGGGATGGAGCTGGG + Intergenic
1136030503 16:27499357-27499379 CAGCAGGGAGAGGTGGAGTGGGG + Intronic
1138263478 16:55643041-55643063 AAGCTAGGATAGTTGGAGCTTGG - Intergenic
1141987720 16:87590783-87590805 CAGCAAGGGTGGGTGGGGCGGGG + Intergenic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143550304 17:7626692-7626714 AAGCAAGGGTATATGGAGGGGGG - Intronic
1143701047 17:8660474-8660496 CAGCAAGGTTAGATGATGCTGGG - Intergenic
1143849530 17:9799809-9799831 CAGCAAAGATAGATGAAATGAGG + Intronic
1144541041 17:16143379-16143401 CAGCAAGGAGACCTGGAGAGAGG - Intronic
1145266390 17:21381486-21381508 CAGCAAGGCAAGCAGGAGCGTGG - Intronic
1147110431 17:38257318-38257340 CAGCAAGGAGGGATGGAGAGGGG + Intergenic
1148243119 17:46012902-46012924 CAGGGAGGATGGATGGCGCGCGG - Intronic
1149784217 17:59421803-59421825 CAGGGAGGATAAATGGAGCCAGG + Intergenic
1150731053 17:67694317-67694339 CAGGAAGGCTAGCTGGGGCGTGG - Intronic
1151352795 17:73541592-73541614 CAGCAGGGAGAGACGGAGGGAGG - Intronic
1151495540 17:74455920-74455942 CAGCAAGGCTGGGTGGAGGGTGG - Intergenic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1152410888 17:80122390-80122412 CAGGGAGGGTTGATGGAGCGTGG + Intergenic
1153987817 18:10368715-10368737 AAGAAAGGAGAGATGGAGAGAGG + Intergenic
1156022100 18:32611545-32611567 GAGCAAGGAGAGAGGGAGCGGGG - Intergenic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1158425299 18:57334587-57334609 CAGCAAGCACAGAAGGTGCGGGG - Intergenic
1158988762 18:62847266-62847288 CAGCAAGGAGAGATGGGGAGAGG + Intronic
1166161856 19:40960017-40960039 CCCCAAGGAGAGATGGAGAGGGG - Intergenic
1167231308 19:48285617-48285639 AAGAAAGGATGGAAGGAGCGAGG + Intronic
1167696699 19:51019382-51019404 CAGCCAGGGTAGCTGGGGCGCGG - Intronic
926244344 2:11112253-11112275 CAGACAGGATAGATGGCGCACGG + Intergenic
926244349 2:11112283-11112305 CAGACAGGATAGATGGCGCACGG + Intergenic
927489966 2:23514796-23514818 CAGCAAGGATAGATGGAGCGTGG - Intronic
928301507 2:30129558-30129580 CAGGAAGTAGAGATGGAGTGTGG + Intergenic
928877054 2:36052428-36052450 CATCAAGAATGGATGGAGGGAGG - Intergenic
932605136 2:73160355-73160377 CACCAAGGACAGCTGGAGGGTGG + Intergenic
932609341 2:73187296-73187318 CAGCAAGGACAAATGGAATGAGG + Intergenic
935502419 2:103857587-103857609 CAGCTAGGATACATCGAGGGAGG - Intergenic
935620501 2:105125832-105125854 AAGGAAGGAGAGATGGAGGGAGG + Intergenic
936459438 2:112701947-112701969 CAGCAATGATTGATGGGGCACGG - Intergenic
936463430 2:112727442-112727464 CTGCCAGGATAGTAGGAGCGAGG + Intronic
938881564 2:135594804-135594826 CAGTAAGGAAAGATGGGGAGAGG - Intronic
947927396 2:233933709-233933731 TAGCAAGAACAGATGGGGCGGGG + Intronic
1168960523 20:1866388-1866410 CAGCAAGGCTGGCAGGAGCGAGG - Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169824307 20:9749858-9749880 CAGCAAGGAGATATGGAACTTGG - Intronic
1171265090 20:23765052-23765074 CAGCAAAGAGAGATGGGGTGGGG - Intergenic
1173622702 20:44448878-44448900 CAGAAAGGAGGGATGGAGGGCGG - Intergenic
1175983961 20:62755117-62755139 AAGGAAGGATGGATGGAGGGAGG - Intronic
1176790957 21:13318983-13319005 CACAAAGTACAGATGGAGCGTGG - Intergenic
1179122274 21:38559117-38559139 CAGCTAGGATTCATGGAGCAAGG - Intronic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1182000564 22:26916269-26916291 AACCAAGGACAGATGGAGAGTGG + Intergenic
1182031673 22:27163848-27163870 CAGCATGGATGGGTGGAGTGCGG - Intergenic
1183092587 22:35532968-35532990 CAGCAATAATTGATGGAGCTGGG - Intergenic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183561976 22:38582227-38582249 CAGGAGGGATAGCTGGAGAGGGG - Exonic
1183573134 22:38669254-38669276 CAGGAAGGAGAGCTGGAGTGAGG - Intronic
1183701934 22:39456071-39456093 CAGCAAGGATGGATGAAGCTGGG + Intergenic
1185095336 22:48803308-48803330 CAGCCAGGATAAAGGGAACGAGG - Intronic
950614905 3:14150591-14150613 CATGAAGGAGGGATGGAGCGAGG + Intronic
951819696 3:26794411-26794433 CAGAAAGGAAAGATGGAAGGAGG + Intergenic
952424224 3:33158524-33158546 GAGCAAGCTTTGATGGAGCGGGG - Intronic
954126852 3:48536329-48536351 CGGCAGAGGTAGATGGAGCGGGG + Exonic
954934114 3:54311297-54311319 CAGCAAGGAGAGATGCGGAGGGG - Intronic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
958414748 3:93860394-93860416 CAGCAGGGAAAGAAGGAGAGGGG + Intergenic
958542281 3:95494124-95494146 GTGTAAGGATAGCTGGAGCGTGG + Intergenic
960386114 3:117023783-117023805 AAGCAAGGAAAGAGGGAGGGGGG - Intronic
960955177 3:123026670-123026692 CAGCGAGGAGGGAGGGAGCGGGG - Intronic
962413526 3:135162064-135162086 CAGCAAGGATTGATGGGCTGCGG + Exonic
963006570 3:140731998-140732020 CAGCAAGGAGAGAGAGAGTGGGG - Intergenic
964077537 3:152709831-152709853 CAGCAGGGAAAGGTGGAGCTGGG - Intergenic
968390423 4:187976-187998 CAGCAAGGAAAAATGGATTGGGG + Intergenic
972572313 4:40321539-40321561 CAGACAGGATTGATGGAGCCTGG + Intergenic
982216593 4:153087674-153087696 CAGCAGGAAGAGATGAAGCGGGG + Intergenic
984135289 4:175929580-175929602 CAGCAAGGATAGATTTAGGAAGG - Intronic
986001609 5:3634940-3634962 CAGCATGGATAAAGGGATCGAGG + Intergenic
989408819 5:41093510-41093532 CAGTAAGGATAGTAGGAACGGGG - Intergenic
991518654 5:67469062-67469084 CAGAAAGGATAGAGGAAGAGAGG - Intergenic
995982050 5:118116171-118116193 AAGAAAAGAGAGATGGAGCGTGG + Intergenic
996030431 5:118698887-118698909 TAGCAAGGATGGAAGGAGGGAGG - Intergenic
997200219 5:132005514-132005536 CAGCAAGGACAGTTAGAGCTGGG - Intronic
998149880 5:139750815-139750837 CAGCAAGGCTGGATAGAGTGAGG - Intergenic
999996840 5:157100394-157100416 CAGGAAGGAAAGATGGTGAGTGG - Intronic
1002699287 5:181111143-181111165 CAGCAAGGCTAGAAAGACCGCGG - Intergenic
1004593901 6:17080533-17080555 CAGCAAGGATGGATGCAAAGTGG + Intergenic
1005463574 6:26091097-26091119 CAGCAAGGGTATGTGGAGAGGGG + Exonic
1006038202 6:31230578-31230600 CAGGAAGGATACAGGGAGAGGGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1010720802 6:79281394-79281416 CATCAAGGATAGATGGACAGAGG + Intergenic
1013976238 6:116081994-116082016 CAGCAAAGATAAATGGTGTGTGG + Intergenic
1014508391 6:122288760-122288782 CAGTAAGGATAGAGAGAGTGAGG + Intergenic
1016117379 6:140303686-140303708 CAGCATGGGTAGCTGGAGAGGGG + Intergenic
1016428149 6:143956030-143956052 CAGCAAGGAGACGTGAAGCGTGG + Intronic
1019483538 7:1277173-1277195 AAGGAAGGAAAGATGGAGGGAGG - Intergenic
1019549260 7:1594059-1594081 GAGGGAGGATAGATGGAGGGAGG - Intergenic
1019869961 7:3751343-3751365 CAGCAAGGATTCATGAAGGGAGG - Intronic
1020991889 7:15208227-15208249 CAGTAAGGATACATAGAGAGAGG + Intronic
1024300373 7:47882883-47882905 CAGCAAGAAGAGAAGCAGCGAGG + Intronic
1024990548 7:55231807-55231829 CAGTAAGGAGGGATGGACCGGGG + Intronic
1026178220 7:68016359-68016381 AAGGAAGGATGGATGGAGGGAGG - Intergenic
1028249382 7:88523070-88523092 CAGAAAGGAAAGCTGGAGAGAGG + Intergenic
1029592843 7:101518737-101518759 CAGCAAGGATACCAGGAGAGGGG - Intronic
1030634000 7:111927452-111927474 CAGCAATGAAAGCTGGAGAGGGG + Intronic
1031686307 7:124734612-124734634 CAGCAAAGAGAGATGGGGTGGGG - Intergenic
1032129728 7:129218296-129218318 AAGAAAGGATAGAAGGAGGGAGG - Intergenic
1032483886 7:132268527-132268549 AAGCAAGGCTAGTTGGAGTGTGG + Intronic
1032725206 7:134584528-134584550 AAGGATGGATAGATGGAGGGAGG + Intergenic
1032802743 7:135329548-135329570 CAGCAAGGCTAGAGGAAGCAAGG + Intergenic
1034620524 7:152453271-152453293 CAGCAAGGAAAGATAGATCCCGG + Intergenic
1036709710 8:11070269-11070291 CAGCAGGGATTGATGAGGCGTGG - Intronic
1036767409 8:11557590-11557612 CAGCAGGGATCAAGGGAGCGAGG + Intronic
1037085750 8:14847664-14847686 AAGGAAGGAAAGATGGAGGGAGG + Intronic
1040460585 8:47644071-47644093 CAGCCAGGATAGACTGAGGGTGG - Intronic
1041807050 8:61863010-61863032 CAGCAAGGGTAGTTGGAGAGTGG + Intergenic
1044955156 8:97472447-97472469 CAGCAAGGATAGAAGGGCCTGGG + Intergenic
1045664420 8:104469597-104469619 CAGGAAGGAGAGACGGAGAGAGG + Intergenic
1045737943 8:105318547-105318569 CAGCGAGGAGAGGGGGAGCGCGG - Intronic
1047886332 8:129253997-129254019 CATCAAGGAGAGATTGAGGGAGG - Intergenic
1051885700 9:21890342-21890364 CAGCAAGGAGACATGTAGCCTGG - Intronic
1053067262 9:35077453-35077475 TAGCCAGGATAGATGGAGATAGG - Intronic
1053265827 9:36712593-36712615 GGGGAAGGAGAGATGGAGCGTGG - Intergenic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1054950568 9:70846403-70846425 CAGCAATGACAACTGGAGCGTGG - Exonic
1055772817 9:79735777-79735799 AAGCAAGGATGGAAGGAGCAAGG - Intergenic
1056404317 9:86259453-86259475 TGGCAAGGAGAGATGGAGTGAGG - Intronic
1056545105 9:87606636-87606658 AAGGAAGGAGAGATGGAGGGAGG - Intronic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1058691158 9:107521854-107521876 CAGCAAGGAAACAGGGAGCTAGG - Intergenic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1185544158 X:928685-928707 CAGCCAGGATGGATGGGGCCTGG - Intergenic
1185834065 X:3328967-3328989 AAGGAAGGAAAGAAGGAGCGAGG + Intronic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1190931431 X:54951978-54952000 CGGCAAAGGTAGATGGAGCGAGG + Exonic
1191095212 X:56666182-56666204 CAGCAAGGAAAAATGCAGAGTGG - Intergenic
1195693166 X:107645965-107645987 AAGCATGGAGAGATGGAGTGGGG - Intronic
1197028982 X:121790615-121790637 AAGCAAGGATAGAAGAAGGGAGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198140549 X:133798390-133798412 TAGCAAGGAAAGATGGAATGGGG + Intronic
1198210210 X:134509146-134509168 TAGGAAGGATAAATGGAGAGAGG - Intronic