ID: 927490191

View in Genome Browser
Species Human (GRCh38)
Location 2:23516239-23516261
Sequence CCGGGCCCAGCAGGTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 472}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927490191_927490202 14 Left 927490191 2:23516239-23516261 CCATGGGCACCTGCTGGGCCCGG 0: 1
1: 0
2: 3
3: 44
4: 472
Right 927490202 2:23516276-23516298 GACCAGGAGCAACTATTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 32
927490191_927490201 -2 Left 927490191 2:23516239-23516261 CCATGGGCACCTGCTGGGCCCGG 0: 1
1: 0
2: 3
3: 44
4: 472
Right 927490201 2:23516260-23516282 GGGACTGGGAAGGGCTGACCAGG 0: 1
1: 0
2: 4
3: 61
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927490191 Original CRISPR CCGGGCCCAGCAGGTGCCCA TGG (reversed) Intronic
900353171 1:2246930-2246952 CCGTGCCCGGCCTGTGCCCATGG - Intronic
900353333 1:2247759-2247781 CTGGGCCCCACAGGTGCCCTTGG + Intronic
900461420 1:2803825-2803847 CGGGGCCGAGCAGGAGCACATGG + Intergenic
900595340 1:3477796-3477818 CCGGGGTGAGCAGGTCCCCAGGG - Intronic
900607692 1:3531182-3531204 CCAGGCCCCCCAGGAGCCCAAGG + Intronic
901182434 1:7350978-7351000 TCTGCCCCAGCAGCTGCCCATGG + Intronic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
901721797 1:11204587-11204609 CAGGGCCCAGCAGGAGCGCAGGG + Exonic
901854891 1:12038345-12038367 CTGGGCCCTGCAGCTGCCAATGG - Intergenic
902376404 1:16032086-16032108 CCTACCCCAGCAGCTGCCCAGGG - Intronic
902381373 1:16054015-16054037 CCTACCCCAGCAGCTGCCCAGGG - Intronic
902650401 1:17833567-17833589 CCTGGCCCATCAGGAGGCCATGG + Intergenic
902963925 1:19984563-19984585 TCGGGCCGCGCAGGAGCCCACGG + Intergenic
903031513 1:20467241-20467263 CGCTACCCAGCAGGTGCCCAGGG + Intergenic
904813499 1:33179380-33179402 CTGCACCCAGCAGATGCCCATGG - Intronic
905008355 1:34729453-34729475 GGGGTCCCAGAAGGTGCCCAGGG + Intronic
905168949 1:36098785-36098807 CAGGGCCCATCAGGGGCCAAAGG - Exonic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
907314287 1:53558669-53558691 CAGTGCCCAGCACCTGCCCATGG + Intronic
907540879 1:55214901-55214923 CCGGGCCCGGCGGGGGCCCGCGG - Exonic
907980093 1:59472373-59472395 TCGGGCCCCACAGGAGCCCACGG - Intronic
909335277 1:74465546-74465568 TCGGGCCACGCAGGAGCCCACGG - Intronic
910025569 1:82647062-82647084 CCTGACCAAGCAGGTTCCCAAGG + Intergenic
912822458 1:112878919-112878941 CCAGGCAAAGAAGGTGCCCAGGG - Intergenic
914928103 1:151906425-151906447 TCGGGCCGTGCAGGAGCCCACGG - Intronic
914958894 1:152189012-152189034 CCGGGCCCAGCAGCTGCCTGGGG - Intergenic
915321976 1:155061308-155061330 GGGGGGCCAGCAGGGGCCCAGGG - Intronic
915562175 1:156693734-156693756 CAAAGCCCAGCAGGAGCCCAGGG - Intergenic
915962601 1:160279573-160279595 TCGGGCCCACCAGGTGCCAGTGG - Exonic
917741736 1:177967792-177967814 CCAGCCACAGCAGGAGCCCAGGG - Exonic
918304861 1:183236478-183236500 CCTGGCCCAGCAGTTGACAAGGG + Exonic
919928944 1:202208803-202208825 CCACCCCCAGCAGGTGCCCTGGG - Intronic
920173723 1:204087348-204087370 CAGGGTCCAGCTGGTGCCCCTGG - Intronic
920194394 1:204217187-204217209 CAGGCCCCTGCAGGTGGCCAGGG + Intergenic
920247159 1:204596790-204596812 CTGGGCCAAGCAGGTACCAATGG + Intergenic
921938138 1:220813394-220813416 ACTGGCCCAGCAGGTACACAGGG - Exonic
922554141 1:226520251-226520273 CAGGGTCCAGCATGTGCCCTGGG - Intergenic
922704098 1:227779898-227779920 CCCGGCCCAGCAGATGCAGAAGG - Intronic
922766337 1:228158397-228158419 CGTGGCCCAGCTGGTGGCCAGGG + Exonic
922802878 1:228372110-228372132 CCGGCCCCTGCAGTTCCCCAGGG + Exonic
924009109 1:239644837-239644859 CAGGGCCCAGCAGGGTCCCATGG + Intronic
1062848536 10:726186-726208 CCGGGCCGAGCATGTCCTCATGG + Intergenic
1063708441 10:8453775-8453797 CCGAGCCCAGCACTTGGCCACGG - Intergenic
1064076007 10:12269321-12269343 CCTGGCCTAGCAGTTTCCCAAGG - Intergenic
1064561091 10:16596069-16596091 CCAGGACCCCCAGGTGCCCATGG - Intronic
1065845039 10:29736723-29736745 CCGGGCCCGGCAGGTGGGCGAGG - Intronic
1066064217 10:31750510-31750532 CGGGGCCCAGCGGCTGCCCAGGG - Intergenic
1067055633 10:43048343-43048365 CTGTGCCCAGCAGCTGCCCAGGG - Intergenic
1067140059 10:43648989-43649011 TCGGGCCCCGCAGGTCCCTAGGG + Intergenic
1067189427 10:44057168-44057190 CCGGCCCCAGGAGGTCCCCGAGG + Intergenic
1067743025 10:48910870-48910892 CAGAGCCCACCTGGTGCCCAGGG - Intronic
1068216739 10:53991160-53991182 CCGGTCCCATCAACTGCCCAAGG + Intronic
1068820966 10:61377093-61377115 CCAGGGCCAGCAGCTGCCGAGGG - Intergenic
1069280840 10:66651685-66651707 CCCGGGCCAGCAGGTGCAGAGGG - Intronic
1069955511 10:72048632-72048654 CCAGGCCCAGGAGGTGGCCAGGG - Intergenic
1070371001 10:75781914-75781936 CAGGGCCAAACAGGTGACCAGGG - Intronic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1070592642 10:77811682-77811704 CCCTGACCAGCAGGGGCCCATGG - Intronic
1070756865 10:78998675-78998697 AGGGGCCCAGGAGGTGGCCAAGG + Intergenic
1072623858 10:97098585-97098607 CTGGGCTGGGCAGGTGCCCAAGG + Intronic
1072783317 10:98264662-98264684 CCGGGACCAGCAGGTGGAGAAGG + Intronic
1074121675 10:110498066-110498088 GCGCGCCCCGCGGGTGCCCACGG - Exonic
1074522847 10:114240304-114240326 ACCGTCCCAGCAGGTGGCCAAGG - Intronic
1074687307 10:115972586-115972608 GGGAGGCCAGCAGGTGCCCAAGG - Intergenic
1076699083 10:132260853-132260875 CAAGGCCCAGCAGGAGCACAGGG + Intronic
1076782971 10:132734671-132734693 CCGGGCACTCCTGGTGCCCAAGG - Intronic
1076806421 10:132861441-132861463 ACGGGGCCAGCAGGAGCCCCAGG - Intronic
1076921676 10:133457606-133457628 CCGGGCCCAGCATCATCCCAAGG - Intergenic
1076944641 10:133637792-133637814 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
1077047002 11:551118-551140 CCTCCCCCTGCAGGTGCCCAGGG + Exonic
1077100245 11:819365-819387 CCGTGCCCAGCAGGGGCGGAGGG + Intronic
1077187693 11:1242840-1242862 GCGGGTCCAGGTGGTGCCCAGGG - Exonic
1077188116 11:1244511-1244533 GCGGGTCCAGGTGGTGCCCAGGG - Exonic
1077188652 11:1246611-1246633 GCGGGTCCAGGCGGTGCCCAGGG - Exonic
1077189071 11:1248282-1248304 GCGGGTCCAGGTGGTGCCCAGGG - Exonic
1077189634 11:1250466-1250488 GCGGGTCCAGGTGGTGCCCAGGG - Exonic
1077244133 11:1527838-1527860 CCAGGGCCAGCAGGTGCCCAAGG + Intergenic
1077466675 11:2736792-2736814 CCAGGCCCAGCAGAGGCGCAGGG - Intronic
1082770119 11:57201363-57201385 CAGGGCCCTCCAGTTGCCCATGG + Intergenic
1083299165 11:61731240-61731262 CAGGGCCCAGCAGTTCCCCAGGG - Intronic
1083485517 11:62981091-62981113 CCGGTCCCAGCAGGTACTCCGGG - Exonic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084171170 11:67401670-67401692 CCGGGCCGGGCAGGGGGCCAGGG + Intronic
1084309882 11:68310933-68310955 GCAGGCCCTGCAGGTGCCGAAGG + Intergenic
1084325902 11:68399926-68399948 CCGGGTCCACCGGGTGCCCTGGG + Intronic
1084473102 11:69374633-69374655 CCGGGCACAACAGGCTCCCAAGG - Intergenic
1084508847 11:69589172-69589194 CCAGGCCCAGGAGGTTCACAGGG + Intergenic
1084813604 11:71631668-71631690 TCGGGCCACGCAGGAGCCCATGG + Intergenic
1084948512 11:72651993-72652015 CTGGGGCCAGCAAGTGTCCATGG - Intronic
1084961972 11:72721565-72721587 CTGGGTCCACCAGGAGCCCACGG - Intronic
1085350730 11:75796546-75796568 CAGTGCCCAGCAGGAGCACAGGG - Intronic
1085507544 11:77068770-77068792 CTGGGGGCAGGAGGTGCCCAGGG + Intronic
1090229268 11:125089785-125089807 TCGGGCCCCACAGGAGCCCATGG - Intronic
1090451595 11:126811066-126811088 GCAGGGCCACCAGGTGCCCATGG - Intronic
1091207478 11:133831600-133831622 CTGGGTCCAGCAGGTCCTCAGGG + Intergenic
1091223836 11:133946249-133946271 CCGTCCCCATCAGGCGCCCACGG - Exonic
1092397680 12:8142631-8142653 CAGGGCCCAGCAGGTGCTGAGGG + Intronic
1092617109 12:10225700-10225722 TCGGGCCGCACAGGTGCCCATGG + Intergenic
1094833239 12:34309981-34310003 TCGGGCCATGCAGGAGCCCAAGG - Intergenic
1095982618 12:47981783-47981805 CCTGGCCCAGCTGGTGCTAATGG - Exonic
1096238069 12:49943207-49943229 CCTGGCTCAGCACCTGCCCAGGG - Intergenic
1096472749 12:51889430-51889452 CCGGGACCAGCGGGGGCTCACGG + Exonic
1097442852 12:59632578-59632600 CAAGGCACAGAAGGTGCCCAGGG - Intronic
1097863950 12:64543542-64543564 TCGGGCCGTGCAGGAGCCCACGG - Intergenic
1097891492 12:64781294-64781316 CCGGGCGCAGCAGGGTCCCGGGG + Intronic
1099191002 12:79561836-79561858 TCGGGCCATGCAGGAGCCCACGG - Intergenic
1100980230 12:100157539-100157561 CCAGGCCCTGCAGGGGGCCATGG - Intergenic
1101997473 12:109535315-109535337 CCAGGCCCATCTGCTGCCCAGGG + Exonic
1103070457 12:117936947-117936969 CAGAGCCCAGAGGGTGCCCAGGG + Intronic
1103573547 12:121860219-121860241 ACAGGCCCAGAAGGTTCCCATGG + Intronic
1103678676 12:122676708-122676730 TCGGGCCACGCAGGAGCCCACGG + Intergenic
1103741929 12:123096858-123096880 CCAGGCCCAGCAGGTCTCCCCGG + Intronic
1103940792 12:124500229-124500251 CAGGGGCCAGCAGGGGCCCTGGG - Intronic
1104049796 12:125187299-125187321 CCGGGGCCCGCAGGTGTCCCGGG - Intronic
1104344534 12:127983673-127983695 TCGGGCCGCGCAGGAGCCCATGG - Intergenic
1104485414 12:129147970-129147992 ATGGGCTCTGCAGGTGCCCATGG - Intronic
1104735199 12:131132158-131132180 CTGAGCCCAGCAGATGGCCAGGG - Intronic
1104877517 12:132046035-132046057 CTGGGTCCACCAGGAGCCCAAGG - Intronic
1104915785 12:132263774-132263796 ACGGGCCCAGCCGGTGCCTGTGG - Intronic
1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG + Intronic
1105004172 12:132710838-132710860 CCGGCCCGCGCAGGCGCCCACGG - Exonic
1106132749 13:26953193-26953215 CTGGGACCACCTGGTGCCCAGGG - Intergenic
1106555308 13:30803896-30803918 CTGTGCACAGCAGCTGCCCAGGG + Intergenic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1109210658 13:59531661-59531683 CTGGGCCCAGCAGGGGCTGAGGG + Intergenic
1109854256 13:68107791-68107813 TCGGGCCATGCAGGAGCCCATGG + Intergenic
1112923441 13:104643699-104643721 CCAGGCACAGCAGCAGCCCAAGG - Intergenic
1114473743 14:22980766-22980788 CCGGGCGCTCCAGGTGCCCGCGG - Intronic
1114566845 14:23639335-23639357 CCGGGAGCAGCTGGTGGCCAAGG + Exonic
1114646511 14:24259312-24259334 CGGGGCCCGGCTGGTCCCCATGG - Intronic
1116045616 14:39739773-39739795 CAGAGCTCAGCTGGTGCCCATGG + Intergenic
1116437602 14:44912307-44912329 CCGGGGCCAGCAGCTGCGGAGGG + Intergenic
1121417717 14:93790263-93790285 TGGCCCCCAGCAGGTGCCCATGG - Intergenic
1122297791 14:100714884-100714906 CCGGGCACAGCAGGTCTGCAGGG - Intergenic
1122588841 14:102830807-102830829 CAGTGCCCAGCAGTTACCCAGGG + Intronic
1122595192 14:102885512-102885534 AGGCACCCAGCAGGTGCCCATGG + Intronic
1122855358 14:104557370-104557392 TCGGGCTCAGGAGCTGCCCAAGG + Intronic
1122885473 14:104708563-104708585 CCGGGCCAGGAAGGAGCCCAAGG + Exonic
1123033140 14:105460533-105460555 CAGGGCCCAGCACCTGCCCCAGG + Intronic
1123053505 14:105559051-105559073 CCAGGCCCTGCAGGCCCCCAGGG - Intergenic
1123078082 14:105679465-105679487 CCAGGCCCTGCAGGCCCCCAGGG - Intergenic
1202918022 14_KI270723v1_random:3124-3146 CCGGGGCCTGCAGGTGACCCTGG - Intergenic
1202926605 14_KI270724v1_random:31462-31484 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
1123799185 15:23803202-23803224 TCGGGCCCCACAGGAGCCCACGG - Intergenic
1124372600 15:29111987-29112009 CCGGGGACAGCAGGAGCCCGGGG - Intronic
1124484203 15:30101225-30101247 CAGGGCCCGGCAGGAGGCCAGGG - Intergenic
1124519379 15:30395999-30396021 CAGGGCCCGGCAGGAGGCCAGGG + Intergenic
1124539276 15:30570222-30570244 CAGGGCCCGGCAGGAGGCCAGGG - Intergenic
1124759374 15:32437350-32437372 CAGGGCCCGGCAGGAGGCCAGGG + Intergenic
1127533616 15:59869025-59869047 CCTGGCCCAACAGGAGTCCAGGG + Intergenic
1127995961 15:64153256-64153278 CCTGAACCAGGAGGTGCCCAAGG + Exonic
1128075658 15:64823909-64823931 GCGGGCCCAGCAGCTGCGCTCGG + Exonic
1128656684 15:69467763-69467785 CAGGGCCCAACAGGGGCCCTGGG - Intergenic
1128750497 15:70145447-70145469 CCAGGGGCAGCTGGTGCCCAGGG + Intergenic
1128793886 15:70450989-70451011 CAGGGGCCAGGAGGTGCGCAAGG + Intergenic
1129038558 15:72665474-72665496 CCGGGCCCTGAAGGAGGCCATGG + Intronic
1129185715 15:73905064-73905086 CCAGGCCTAGCTGGGGCCCACGG + Intergenic
1129211332 15:74071756-74071778 CCGGGCCCTGAAGGAGGCCATGG - Intronic
1129399070 15:75269331-75269353 CCGGGCCCTGAAGGAGGCCATGG + Intronic
1129402677 15:75293607-75293629 CCGGGCCCTGAAGGAGGCCATGG + Intronic
1129540291 15:76342676-76342698 CCTGGGCCGCCAGGTGCCCAGGG - Intergenic
1129691406 15:77715770-77715792 CTGTCCCCAACAGGTGCCCAGGG + Intronic
1129717263 15:77859693-77859715 GGGGGCCCAGCATCTGCCCATGG - Intergenic
1129728461 15:77916029-77916051 CCGGGCCCTGAAGGAGGCCATGG - Intergenic
1129768348 15:78184797-78184819 CAGGCCCCAGCTGGCGCCCAGGG + Intronic
1130027592 15:80283219-80283241 CTGGGACCAGCAGGTGAGCAAGG - Intergenic
1130276171 15:82477405-82477427 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130468530 15:84204798-84204820 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130485222 15:84394964-84394986 CCAGGCCCTGCAGGGGGCCATGG + Intergenic
1130495734 15:84468744-84468766 CCGGGCCCTGCAGGGGGCCATGG + Intergenic
1130590823 15:85209397-85209419 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1131188541 15:90294816-90294838 CCGGGCCCTGCAGGGGGCCAAGG + Intronic
1131250289 15:90825762-90825784 TCGGGCCTCGCAGGAGCCCACGG - Intergenic
1131892146 15:96984247-96984269 TCGGGCCGCGCAGGAGCCCACGG + Intergenic
1132391226 15:101439519-101439541 CAGGGCCAGGCAGCTGCCCAGGG - Intronic
1132671286 16:1103148-1103170 CCCGGCCCAGCCGGAGGCCATGG - Intergenic
1133254081 16:4505729-4505751 CAGGGCCAAGCAGGCACCCAGGG - Intronic
1133961167 16:10494868-10494890 CGGGACACAGCAGGTGACCAGGG - Intergenic
1134256215 16:12613825-12613847 CAGGACACAGCAGGTGACCAGGG - Intergenic
1135960599 16:26991666-26991688 CCTGGCCCTCCCGGTGCCCAGGG + Intergenic
1137668661 16:50266645-50266667 CCGGCCCCAGCAGCCGGCCAGGG - Intronic
1140475397 16:75237248-75237270 CCGGGGCCAGCAGGTGTCGCGGG + Exonic
1141559148 16:84855059-84855081 CCCGGCACAGGAGATGCCCATGG - Intronic
1141623926 16:85251580-85251602 CCGGGCCCAGCCCCTGCCCAGGG - Intergenic
1141642801 16:85351132-85351154 CAGGGCACAGCTGGTGCCCCAGG - Intergenic
1141710429 16:85695734-85695756 CCGATTCCACCAGGTGCCCATGG + Intronic
1141835790 16:86538393-86538415 TCGGGTCCAGCAGGTGACCACGG + Intronic
1142134554 16:88445678-88445700 CCAGCCCCAGCAGGTGCCTCGGG - Intergenic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142467675 17:145534-145556 CCAGGAGCAGCAGGTGGCCAGGG + Intergenic
1142709350 17:1715142-1715164 CTGTGCCAAGCAGGTGCCCTTGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143120839 17:4605800-4605822 CCGGCTCCATCTGGTGCCCAGGG + Intronic
1143585135 17:7847167-7847189 CCGGGACCAGCCGGTGGCCAGGG - Exonic
1143639683 17:8189010-8189032 CAGGGCCCAGCAGGACCCTAAGG - Exonic
1143870773 17:9956122-9956144 CCTGGCCCAGCAGGAGCCTGTGG + Intronic
1144575282 17:16426001-16426023 CAGGACTCAGCAGCTGCCCACGG - Intronic
1144852628 17:18251721-18251743 CCAGGCCAAGCAGGTGCTGAAGG - Exonic
1145056336 17:19706345-19706367 CCAGGCAGAGCAGGTGCCCGTGG - Intronic
1145059170 17:19721389-19721411 CTGGGCCTGGAAGGTGCCCAGGG - Intergenic
1145276962 17:21437316-21437338 CCTGGCTCAGCAGGACCCCAGGG + Intergenic
1145314793 17:21723209-21723231 CCTGGCTCAGCAGGACCCCAGGG + Intergenic
1145713234 17:26995146-26995168 CCTGGCTCAGCAGGACCCCAGGG + Intergenic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1147192045 17:38743692-38743714 CAGGGCCCTGCAGGTAACCATGG - Intronic
1147194038 17:38753236-38753258 CCAGGCCCAGATGGTGACCACGG + Exonic
1147732093 17:42610239-42610261 CCGGGGGCGGCAGTTGCCCAAGG + Intronic
1147741272 17:42672203-42672225 TCGGGCCCTGCAGGTCCCCCCGG - Exonic
1148023410 17:44568474-44568496 TCGGGCCGTGCAGGAGCCCACGG - Intergenic
1148049860 17:44764521-44764543 CTGGGCCCAGCTTGTTCCCAGGG + Intronic
1148052495 17:44776014-44776036 CCGGGCCCTCCAGCTCCCCAGGG - Intronic
1148780437 17:50118250-50118272 CCGGGCCCAACTGTTGGCCAAGG - Exonic
1148794570 17:50190824-50190846 CCTGGCCCTGCTGGTGCCCCTGG - Exonic
1148795258 17:50193986-50194008 CCAGGCCCACCTGGTGCCCGTGG - Exonic
1148991300 17:51669096-51669118 CCGGTCCCATCAACTGCCCAAGG + Intronic
1149378811 17:56071953-56071975 CCGGGCACAGCAAGAGACCAGGG + Intergenic
1151618911 17:75233045-75233067 CCGGGCCCTGCAGGTTCCTCAGG + Exonic
1151692572 17:75695853-75695875 CAGGGCCTCGCAGATGCCCACGG + Intronic
1151731680 17:75915043-75915065 CACGGCCCAGCAGATGGCCATGG - Exonic
1151825875 17:76523851-76523873 CTGGGCCCACCAGGGGCCCTGGG + Intergenic
1152717351 17:81906416-81906438 GAGGGCCCATCAGCTGCCCAGGG + Intronic
1152901068 17:82941462-82941484 CAGGCCCCAGCTGGTGCCCCAGG + Exonic
1153711988 18:7809423-7809445 GCGGTCCCAGCAGCTGACCATGG - Intronic
1157618002 18:48998729-48998751 CAGAGCCCAGAGGGTGCCCAGGG - Intergenic
1157858337 18:51121029-51121051 TCGGGCCACGCAGGAGCCCAAGG + Intergenic
1158411594 18:57210509-57210531 CCAGGACCAGCAGGCGCCGAGGG + Intergenic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1159260447 18:66006035-66006057 TCGGGCCCTGCAGGAGCCCACGG + Intergenic
1160920934 19:1520265-1520287 CCTGACCACGCAGGTGCCCAGGG - Intergenic
1160923925 19:1533949-1533971 CCGGGTCCAGCAGGTGGCACAGG - Exonic
1160947981 19:1652290-1652312 CCGCGCCCAGCAGGTGAGCCCGG - Exonic
1160982727 19:1823692-1823714 GCGGGCCCAGCAGGCGCAGAGGG - Exonic
1161014839 19:1978456-1978478 CCGGGCCCCGCAGCTGCACCTGG + Exonic
1161028072 19:2045791-2045813 CTGGGTCCAGCAGCCGCCCAGGG + Intronic
1161156216 19:2733033-2733055 CCGGGCCATGCTGATGCCCAGGG + Exonic
1161479529 19:4503622-4503644 CTGGGCCCAGCAGCTGCCCCTGG - Exonic
1161531652 19:4793282-4793304 ACGGGCCCTGCAGCTGCCCAGGG + Exonic
1161770430 19:6227974-6227996 CCGGGAACTGCAGGTGCTCAAGG - Intronic
1162057842 19:8075366-8075388 CCTGGCCCATGTGGTGCCCACGG - Exonic
1162091048 19:8280431-8280453 TCGGGCGGAGCAGGAGCCCAGGG + Intronic
1162093282 19:8295269-8295291 TCGGGCGGAGCAGGAGCCCAGGG + Intronic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163740131 19:19006715-19006737 CAGGGCCCAGCAGCTCCCCAAGG + Intronic
1164156884 19:22602482-22602504 CCGGGCCCTGCAGGGTGCCATGG + Intergenic
1164591285 19:29508782-29508804 CCAGACCCAGGAGGTTCCCACGG - Intergenic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1166043819 19:40218028-40218050 CCGGGCCCACCAGCAGCCCCGGG - Exonic
1166738026 19:45097546-45097568 TCAGGCCCTGCAGGGGCCCAGGG + Intronic
1166953042 19:46442993-46443015 CAGGCCCCAGCAGCTGCTCAAGG - Intergenic
1167301597 19:48680869-48680891 CCAGACCCCGAAGGTGCCCACGG - Intergenic
1168267771 19:55231740-55231762 CCGAGGCCAGGAGGTGGCCATGG - Intronic
1168707334 19:58477539-58477561 CCCAGCCCAACAGTTGCCCAGGG - Exonic
925164765 2:1709244-1709266 CAGGCACCAGCAGGTGACCACGG + Intronic
925172537 2:1759313-1759335 CCGGTCCCATCAACTGCCCAAGG - Intergenic
926142626 2:10377447-10377469 GTGGGCACAGCAGGTGCCCGCGG - Intronic
926474732 2:13308385-13308407 CCGGGCCGCGCAGGAGCCCACGG + Intergenic
926616634 2:15002756-15002778 CCCGGCCCAGCAGCTGCGGAGGG - Intergenic
926886671 2:17604607-17604629 CCAGGCCCAGCTGGTTCTCACGG - Intronic
927199636 2:20570396-20570418 CCGCAGCAAGCAGGTGCCCAGGG - Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
928272970 2:29873714-29873736 CTGGGCAAAGCAGGGGCCCATGG + Intronic
928723062 2:34142546-34142568 CCGGTCCCATCGGCTGCCCAAGG - Intergenic
930230811 2:48841966-48841988 CCGAACTCAGCTGGTGCCCACGG - Intergenic
931208332 2:60168996-60169018 CCTGGGACAGCAGGTGCCCTGGG + Intergenic
932178335 2:69622389-69622411 CCGGTCCCATCAACTGCCCAAGG + Intronic
934714202 2:96533866-96533888 CCAGGCTCAGCAGTTGCCAAAGG - Intergenic
934853275 2:97714249-97714271 CAGGGCCCAGCAGGAGCCCAGGG - Intronic
936522155 2:113218155-113218177 CCGGGCCCAAGGGGTGCACAGGG - Exonic
937917488 2:127106231-127106253 CCGGCCCCACCGGGAGCCCAGGG - Intronic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
942317538 2:174709581-174709603 CCGGTCCCATCAACTGCCCAAGG - Intergenic
944581827 2:201138321-201138343 CCCCGCCCAGCAGCTGCTCATGG + Intronic
945102627 2:206275317-206275339 CTCGGCCCCACAGGTGCCCAGGG - Intronic
946016849 2:216610848-216610870 CCAGGCCCAGATGGTGACCACGG - Intergenic
946334575 2:219028568-219028590 CAGGGCACAGCAGGAGTCCAGGG + Intronic
946399173 2:219459839-219459861 CCGGGCAGAGGAGGGGCCCACGG - Intronic
947539320 2:230964310-230964332 TCGGGCGGAGCAGGAGCCCACGG + Intergenic
947583538 2:231336962-231336984 CCGGGTACAGCAGGATCCCAGGG - Intronic
947828680 2:233124168-233124190 CCGGGCCCCTCAGTTGGCCAGGG + Intronic
947962041 2:234247814-234247836 CCGGGCCCGGCAGCTGCAGAGGG + Intergenic
948376783 2:237525963-237525985 CCGGGGACGGCAGGTGTCCACGG - Intronic
948869652 2:240791717-240791739 CAGGGCACAGATGGTGCCCAAGG + Intronic
948983466 2:241506938-241506960 CCTGGCCCAACAGCTGCACATGG + Intronic
1168816244 20:739263-739285 CTGCGCACAGCAGCTGCCCAAGG - Intergenic
1169388497 20:5170592-5170614 CAGGGCCGAACAGGTGCCAACGG - Intronic
1170230840 20:14044897-14044919 TCGGGCCACGCAGGAGCCCATGG + Intronic
1170547066 20:17443493-17443515 CAGGTGACAGCAGGTGCCCAGGG + Intronic
1172185513 20:33028736-33028758 CAGGGGCCAGCAAGTGCACAAGG - Intergenic
1172304004 20:33868805-33868827 CAGGGCCCAGTCAGTGCCCACGG - Intergenic
1172656952 20:36543272-36543294 CCAGCCCCAGCTGGTCCCCAGGG - Intronic
1172660243 20:36563062-36563084 CAGGGCCCAGAGGATGCCCAAGG + Intergenic
1173539185 20:43838583-43838605 CCCAGCCCTGCAGGTGCTCAGGG + Intergenic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1173929411 20:46806362-46806384 CAGGGCCCATCACCTGCCCAGGG - Intergenic
1174363144 20:50040887-50040909 CCTGGCCCAGGAGGAGCACATGG - Intergenic
1174462254 20:50691310-50691332 CGGGGCGCAGCAGGTCCTCAAGG - Exonic
1175153672 20:56954881-56954903 TCGGGCACAGAAGATGCCCAGGG - Intergenic
1175414934 20:58794939-58794961 CTGGGCCCAGGAGGGGCCCCTGG - Intergenic
1175419036 20:58819907-58819929 TCAGGTCCAACAGGTGCCCAGGG + Intergenic
1175916207 20:62427181-62427203 CAGGGCCCAGGAAGTGTCCATGG - Intronic
1176091444 20:63320208-63320230 CGTGGCCCAGCAGGTGGGCAGGG - Intronic
1176286885 21:5023101-5023123 CCAAGGCCAGCTGGTGCCCACGG + Intronic
1176410784 21:6448393-6448415 GGGGGCCCAGCTGCTGCCCATGG + Intergenic
1176717807 21:10368203-10368225 CCGAGCCCTGCAGGTGGCTAGGG - Intergenic
1177225335 21:18245615-18245637 CCGGGCTCAGCACCTGCCAAAGG + Intronic
1178365624 21:31986815-31986837 CAGGGAACAGCAGGTGCCCATGG - Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179686277 21:43056715-43056737 GGGGGCCCAGCTGCTGCCCATGG + Intronic
1179711690 21:43267272-43267294 CCAGGGCCAGCAGGAGGCCAGGG - Intergenic
1179870296 21:44240374-44240396 CCAAGGCCAGCTGGTGCCCACGG - Intronic
1179888531 21:44324766-44324788 CCGGGGCCAGCAGGAGCACTGGG - Intronic
1179896696 21:44367155-44367177 CATGGCCCTGCTGGTGCCCAGGG + Intronic
1180081412 21:45489444-45489466 CTGGCCCCAGCAGGTGCTCACGG + Intronic
1180082159 21:45491875-45491897 CTGGGCCCTGCATCTGCCCAGGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180299034 22:11021109-11021131 CCGAGCCCTGCAGGTGGCTAGGG - Intergenic
1180948026 22:19707555-19707577 CCGTGGCCAGCACCTGCCCAGGG + Intergenic
1181313290 22:21956956-21956978 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1181346395 22:22223028-22223050 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1181469408 22:23128550-23128572 CCTGGCCCTGCAGGGGCCCTGGG - Intronic
1183253038 22:36743855-36743877 CCCTGCCCGGCAGGTCCCCAGGG - Intergenic
1183366380 22:37409273-37409295 CGGGGCCCAGGAGCTTCCCAGGG - Intronic
1183494501 22:38134928-38134950 CCGGGCCCCGCAGGTCCTCAGGG - Intronic
1183537737 22:38412991-38413013 CCGGGGCCCGCAGGGGCCCGCGG + Intergenic
1183739525 22:39662261-39662283 CCTGGCCGAGCTGGTGCCCGCGG + Exonic
1184041433 22:41946484-41946506 CCGTGCCCACCAGCTGCGCAGGG + Exonic
1184229118 22:43148895-43148917 CCGGGCCCAGCCTGTACCCCAGG + Intergenic
1184337432 22:43862115-43862137 CCCGGCCCAGCAGAAGCCCCGGG + Intronic
1184368520 22:44068043-44068065 CCCGACCCAGCAGGTGCTCCAGG - Intronic
1184431618 22:44444484-44444506 CAGGGTCCTGCAGGTGACCAAGG - Intergenic
1184729316 22:46364295-46364317 CACGGCCCAGCAGCTGCCCCCGG - Intronic
1185070531 22:48653391-48653413 TCAGGCCCAGCAGGTGGGCAGGG + Intronic
1185125236 22:49006911-49006933 CAGGACCCTGCAGGTGGCCATGG - Intergenic
1185224265 22:49644041-49644063 GGGGACCCAGTAGGTGCCCAGGG - Intronic
1185229080 22:49670273-49670295 TCGGGCCGCGCAGGAGCCCAGGG + Intergenic
1185231346 22:49685963-49685985 CCAGGCTCTGCAGGTGGCCAAGG + Intergenic
1185310493 22:50151627-50151649 CTGGGCCCAGCAGCTGCTCACGG - Intronic
949259015 3:2083916-2083938 CCGGGCCGCACAGGAGCCCACGG - Intergenic
950138569 3:10600160-10600182 ACAGGCCCAGCAGGGGCTCAGGG - Intronic
950400931 3:12768864-12768886 CTCGGCCCTGCAGGAGCCCATGG + Intronic
950417631 3:12877274-12877296 GGGAGGCCAGCAGGTGCCCATGG - Intergenic
953059374 3:39414493-39414515 TGGGACCCAGCAGCTGCCCATGG + Intergenic
953714661 3:45306977-45306999 TCGGGCCGCGCAGGAGCCCAGGG - Intergenic
953789516 3:45936725-45936747 CAGGGCCAAGCAGGTGGACAAGG + Intronic
953880481 3:46688776-46688798 CCGGCACCATCAGGTGCCCTAGG + Intronic
954390410 3:50265448-50265470 GCAGGCCCAGCTGGTGGCCAGGG + Intergenic
957083514 3:75658614-75658636 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
958548593 3:95588760-95588782 CCGGGGCCAGCAGCTGCGGAGGG - Intergenic
961268818 3:125671963-125671985 CGGGGCCATGCAGGAGCCCACGG - Intergenic
961268841 3:125672033-125672055 TCGGGCCATGCAGGAGCCCATGG - Intergenic
961371330 3:126433740-126433762 CTGGGCACAGCCAGTGCCCATGG - Intronic
961522820 3:127477139-127477161 TCGGGCCCACCAGCTGCCCCCGG - Intergenic
962280906 3:134051139-134051161 CAGGGCCCTGCTGCTGCCCACGG - Intronic
962530781 3:136277882-136277904 CCTGGCCCTGCAGGTGGCCTGGG - Intronic
962752325 3:138442572-138442594 CAGGGCCCTGTAGGAGCCCATGG - Intronic
962755869 3:138465122-138465144 CATGGCAGAGCAGGTGCCCAGGG - Intronic
963673473 3:148280637-148280659 TCGGGCCGCGCAGGAGCCCACGG + Intergenic
967881910 3:194307500-194307522 CCGGGCCCTGCAGGTGCTTCTGG - Intergenic
967895969 3:194396746-194396768 GTGGGCCCAGCCGGTGACCACGG - Exonic
968181554 3:196599108-196599130 CCGGGCCGCACAGGAGCCCACGG + Intergenic
968487005 4:867645-867667 CTGGGCCGAGGAGGTGCCGAGGG - Intronic
968589725 4:1451284-1451306 CTGGACGCAGCAGGTGCTCAGGG + Intergenic
968703905 4:2069401-2069423 CAGGGCCCAGGAGCTGCTCAGGG - Intergenic
968816711 4:2825184-2825206 CCGGGCTCACCTGGTGTCCAAGG - Exonic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
969303116 4:6309106-6309128 CTGGGCCGCGCAGGAGCCCACGG + Intergenic
969471655 4:7392693-7392715 ACGGGACAAGCAGATGCCCAGGG - Intronic
969778926 4:9381128-9381150 CCGGGCCCAGCGGGGGCACCCGG + Intergenic
969795450 4:9524532-9524554 TCGGGCCACGCAGGAGCCCACGG + Intergenic
971480919 4:27114407-27114429 CAGGGCCCAGCGTTTGCCCAGGG + Intergenic
971545213 4:27877607-27877629 CCTCGTCCAGCAGGTGACCATGG - Intergenic
973165779 4:47076177-47076199 CCAGGCCTAGCAGGTGGTCAGGG - Intronic
973854144 4:54993760-54993782 TCGGGCCGTGCAGGAGCCCACGG - Intergenic
973878116 4:55241617-55241639 CCGGGGCCAGCAGCTGCAGAGGG + Intergenic
976874402 4:89836624-89836646 CCTGGCCCAGCGGGTCCTCATGG + Intronic
978452021 4:108844535-108844557 CCAGGCCCACCAGGTCCCCATGG - Exonic
979403731 4:120283108-120283130 TCAGGCCCAGTTGGTGCCCATGG + Intergenic
979609055 4:122670502-122670524 TTGGGCCCTGCAGGAGCCCACGG - Intergenic
980063342 4:128155564-128155586 TGGGGCCCAGCAGTTGCCCCAGG + Intronic
982719643 4:158847019-158847041 CAGAGCTCAGCTGGTGCCCACGG + Intronic
984330876 4:178316317-178316339 GAAGGCCCAGCAGCTGCCCAAGG + Intergenic
985448027 4:190038302-190038324 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
985791462 5:1930749-1930771 CAGGGCCCAGGTGGTGACCAAGG + Intergenic
985849025 5:2374952-2374974 CAGAGCACAGCAGGGGCCCACGG + Intergenic
986273505 5:6253992-6254014 CAGGGACCTGCAGGTGCACAAGG - Intergenic
986317654 5:6601406-6601428 CCGCCTCCAGCAGGTCCCCAGGG + Intronic
987248786 5:16078506-16078528 CCCTGCCCTGCTGGTGCCCACGG + Intronic
988110562 5:26813542-26813564 CCAGGCGCAGCAGGAACCCAGGG + Intergenic
989003205 5:36782720-36782742 CCGGGGCCAGCAGCTGCAGAGGG + Intergenic
989606053 5:43245669-43245691 CTGAGGACAGCAGGTGCCCAGGG - Exonic
991630269 5:68649698-68649720 CAGGGCTCAGCAGATGCACAGGG - Intergenic
992500498 5:77338062-77338084 CTGGGCCCCGCAGTGGCCCACGG - Intronic
993376805 5:87158081-87158103 CCAGGCCCTGCAAGTGCCCAGGG - Intergenic
996567214 5:124892583-124892605 CCGGGGCCAGCAGCTGCGGAGGG + Intergenic
997659669 5:135579487-135579509 TCTGGCCCAGCAGGGGCCCTTGG - Intergenic
997827079 5:137116091-137116113 CCCAGCCCAGCTGGTGCCAAGGG + Intronic
998056536 5:139083015-139083037 CCAGGCCCTGCAGGGGCTCAAGG + Intronic
998484755 5:142491882-142491904 TCGCGACCACCAGGTGCCCAAGG + Intergenic
998499222 5:142617472-142617494 CAGAGCCCAGCAGGTCCTCAGGG + Intronic
999406725 5:151313107-151313129 CCACCCCCAGCAGGGGCCCATGG - Intergenic
999610386 5:153362738-153362760 CAGCTCCCAGGAGGTGCCCAAGG - Intergenic
1002122618 5:177017112-177017134 CCAAGCCCAGCAGGGGCCCAGGG - Intronic
1002160647 5:177312260-177312282 CCGGGCCCAGCCGCTGCACGTGG + Exonic
1002518969 5:179779913-179779935 CCAGCCCCAGAAGATGCCCAAGG + Intronic
1002616495 5:180459464-180459486 TCGGGCCGAGCAGGAGCCCACGG - Intergenic
1002665785 5:180823517-180823539 CCAGGTCCAGCAGGAGCCCCGGG + Intergenic
1002681574 5:180969494-180969516 CCGGTCCCATCAAGTGCCCAAGG - Intergenic
1003185451 6:3826470-3826492 CTGGGCCCTGCCTGTGCCCAAGG + Intergenic
1003299545 6:4865147-4865169 CAGGGCAGAGCAGGTGACCAGGG - Intronic
1003309513 6:4957284-4957306 CTGGGCACAGCAGGAGCCTAGGG + Intergenic
1003493515 6:6643914-6643936 CTGGGCCCAGCAGGTGGGAAAGG + Intronic
1003908172 6:10720879-10720901 TCGGGCCCTACAGGAGCCCACGG - Intergenic
1004169828 6:13287324-13287346 CAGGGCCCTGCTGGTGCCCTTGG - Exonic
1004452385 6:15758978-15759000 CCGGGGCCAGCAGCTGCGGAGGG - Intergenic
1005712045 6:28512076-28512098 TCGGGCCGCGCAGGAGCCCACGG - Intronic
1005749040 6:28866554-28866576 TCGGGCCGCGCAGGAGCCCATGG + Intergenic
1006978306 6:38124339-38124361 CCGGTCCCATCAACTGCCCAAGG - Intronic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007476480 6:42122915-42122937 ACTGGCCCAACAGGTCCCCAGGG - Intronic
1007788384 6:44295103-44295125 ACTGGCCCAACAGGTTCCCAGGG - Intronic
1008230783 6:48983501-48983523 TCGGGCCATGCAGGAGCCCATGG + Intergenic
1009930893 6:70176526-70176548 CGAGGCCCAGCAGGTCCCCCAGG + Exonic
1009933707 6:70207158-70207180 CCAGGCTCACCAGGTGCCCCAGG + Exonic
1010188051 6:73165504-73165526 CCTGGCCCAGCACATGGCCATGG + Intronic
1010822920 6:80436410-80436432 CCGGGCCCAGTAGGAGGCCAAGG - Intergenic
1012145061 6:95670332-95670354 TCCGGCCGAGCAGGAGCCCATGG - Intergenic
1013812211 6:114058021-114058043 CCTGGTCCAGCAGCTCCCCAAGG - Exonic
1018804844 6:167250362-167250384 CAGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018826282 6:167409928-167409950 TCGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018826312 6:167410050-167410072 CAGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1019068395 6:169321795-169321817 CTGGGCCCTGCAGGGGCGCAAGG + Intergenic
1019338583 7:496644-496666 AGGGCCCCAGCAGGTGTCCAAGG + Intergenic
1019443209 7:1057755-1057777 GGGGGCCGAGCAGGTGCACAGGG - Exonic
1019478835 7:1256841-1256863 CCTGGCCCACCCGGTGCCCTGGG - Intergenic
1019485710 7:1288338-1288360 CATGGCCCAGCTAGTGCCCAGGG - Intergenic
1019599671 7:1874947-1874969 CCAGGCCCAGCCGGGGCCCGGGG - Intronic
1019625897 7:2015483-2015505 CCAGACCCTGCGGGTGCCCATGG + Intronic
1019681952 7:2355278-2355300 CCGGGCCCAGGCGGTGTCCGAGG + Exonic
1019912739 7:4110577-4110599 CAGGTACCAGCAGGTGCACATGG + Intronic
1019999952 7:4749957-4749979 CCGGGCCTAGAAGGTGCCACTGG - Intronic
1020016354 7:4834304-4834326 CTGGGCCCAGCTGGACCCCAGGG + Intronic
1020070794 7:5225770-5225792 CCGGAGCCAGCAGCTGCCCCAGG - Intronic
1021133929 7:16943336-16943358 CCGGTCCCATCAACTGCCCAAGG + Intergenic
1022100589 7:27166811-27166833 CCGGGCCCCGTAGGTAACCAAGG - Intronic
1025019376 7:55468619-55468641 ATGGGCCCAGCAGGTGGCCCAGG + Intronic
1026898047 7:74021917-74021939 CCAGGCCCAGCAGGAGCCCCTGG + Intergenic
1027564001 7:79768035-79768057 TCGGGCCGCACAGGTGCCCATGG + Intergenic
1029478998 7:100801859-100801881 CCTGCCCCTGCAGGTGCCCGGGG + Intergenic
1032459909 7:132102747-132102769 CGGGATCCAGCAGGTGCACACGG - Intergenic
1033779366 7:144650715-144650737 TCGGGCCACGCAGGTGCCCATGG - Intronic
1033832413 7:145270048-145270070 CCAGGCCCAGCTGGTGCTCCTGG + Intergenic
1034338973 7:150340507-150340529 CCGGGGCCTGCAGGTGGCCCTGG - Exonic
1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG + Intergenic
1034491013 7:151392994-151393016 CTGGGGACAGAAGGTGCCCATGG - Intronic
1035460809 7:159037359-159037381 AGGGGCCCTGCAGGGGCCCAGGG + Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1036135100 8:6152997-6153019 TCGGGCCATGCAGGAGCCCACGG - Intergenic
1036695535 8:10972149-10972171 CCGGGCCCAGCTGGGGCCTCGGG + Intronic
1037961496 8:23101800-23101822 TGGGGCCTGGCAGGTGCCCAGGG + Intronic
1038176335 8:25184704-25184726 CCCGGCCCAGCAGGTGACCGCGG + Intronic
1038454876 8:27666733-27666755 CATGGCCCAGGAGGAGCCCATGG - Intronic
1038494206 8:27990179-27990201 GCTGGTCCAGCAGGAGCCCAGGG + Intronic
1038847566 8:31244219-31244241 TCGGGCCGCGCAGGAGCCCACGG + Intergenic
1040027694 8:42796743-42796765 CCCGGGCCAGCAGGTGCGGAGGG + Intergenic
1040323986 8:46331979-46332001 CCGGGCCTCACAGGAGCCCACGG - Intergenic
1040554986 8:48470180-48470202 CCGGGACCAGCGGGAGGCCAGGG + Intergenic
1040598985 8:48865838-48865860 CCAGGCCCAGCATGTACCCCAGG + Intergenic
1041919657 8:63168168-63168190 CCGGGCCTAGCAGGAGCCTTCGG - Intergenic
1043438903 8:80259873-80259895 CCTGCTCCTGCAGGTGCCCAAGG - Intergenic
1043982481 8:86658067-86658089 CCCGGCCCTGCAGGGGGCCATGG - Intronic
1048976849 8:139677983-139678005 CCCAGCCCAACAGGTCCCCACGG + Intronic
1048977668 8:139681990-139682012 CCAGGCCCTGCAGGTACCCTGGG + Intronic
1049024122 8:139976998-139977020 CCAGACCCAGTAGCTGCCCAGGG - Intronic
1049196585 8:141319073-141319095 CAGGGCTCAGCATGTGACCAGGG + Intergenic
1049212403 8:141392719-141392741 CCTGGGCCACCAGCTGCCCAGGG - Intronic
1049413117 8:142482430-142482452 CAGGGTTCAGCAGGTGACCAAGG - Intronic
1049413232 8:142483100-142483122 CAGGGTTCAGCAGGTGACCAAGG - Intronic
1049413352 8:142483741-142483763 CAGGGCTCAGCATGTGACCAGGG - Intronic
1049787662 8:144458783-144458805 CCGGGCCCAAGAGGTGGGCAGGG + Intronic
1049804781 8:144533920-144533942 CCGGGCCCAGGAAGAGCCCCCGG + Intronic
1055346622 9:75346357-75346379 CCTGGCTCAGAGGGTGCCCATGG - Intergenic
1055371684 9:75606507-75606529 CAGTGCCTAGCAGGTTCCCAGGG - Intergenic
1055762817 9:79627403-79627425 ACGGGCCAAGCAGGTGACCATGG + Exonic
1055985488 9:82054452-82054474 TCGGGCCACGCAGGAGCCCACGG + Intergenic
1056743791 9:89282714-89282736 TCGGGCCCCACAGGAGCCCATGG - Intergenic
1057168630 9:92947554-92947576 CCCGGCCCTCCAGGTCCCCAAGG + Exonic
1057183101 9:93040319-93040341 CAGGGACCACCAGGTGCCCCTGG - Intergenic
1058833409 9:108839218-108839240 CCAGGCTCAGCAGGTGTCTAAGG + Intergenic
1059324541 9:113496243-113496265 CTGGGCCTAACAGGTGCTCAAGG + Intronic
1059891416 9:118809330-118809352 TCGGGCCGCGCAGGAGCCCACGG + Intergenic
1060766067 9:126295880-126295902 TCCTGCCCAGCAGGTGCCCATGG + Intergenic
1060822817 9:126671390-126671412 CCGGGCTCAGCTGGGGCCCCTGG + Intronic
1060849283 9:126860938-126860960 CTGACCCCAGCAGGTGCCCGGGG - Intronic
1060986044 9:127819565-127819587 CCCGGCCCAGCAGCAGCCCCTGG + Intronic
1061062556 9:128257991-128258013 CCGGGCCCTGCAGGGGGCCATGG - Exonic
1061919732 9:133776222-133776244 CCTGGCCTGGGAGGTGCCCAAGG + Intronic
1061962376 9:133994553-133994575 CAGGGGGCAGCAGGTACCCATGG - Intergenic
1061964261 9:134004284-134004306 ATGGGCACAGCAGGTACCCAGGG + Intergenic
1062192375 9:135254624-135254646 TTGGGCTCAGCTGGTGCCCAGGG + Intergenic
1062253950 9:135612396-135612418 CAGGGCCCAGCTGCTGCCCTGGG - Intergenic
1062298964 9:135853307-135853329 CTGGGCCAAGCAGGTGCTCCTGG + Intronic
1062359967 9:136183023-136183045 GAGGCCCCAGCAGGTGCCCTGGG + Intergenic
1062447340 9:136600477-136600499 CCGGACCCGGCAGGGCCCCATGG - Intergenic
1062480539 9:136748851-136748873 CCAGGCCCGGCAGGAGGCCAAGG + Intergenic
1186283283 X:8017662-8017684 CAGGGACCAGCAAGAGCCCAGGG - Intergenic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1187056238 X:15743766-15743788 ACTGGCCAAGCAGATGCCCAGGG - Intronic
1189744565 X:44156964-44156986 CCTGGCCCATCAGCAGCCCATGG - Intronic
1193085601 X:77446264-77446286 CAGGGCCCAATAGGTGCCCCAGG + Intergenic
1193293895 X:79810360-79810382 CAGGACTCAGCCGGTGCCCATGG - Intergenic
1195460235 X:105115821-105115843 TCGGGCCGTGCAGGAGCCCATGG + Intronic
1195803107 X:108734828-108734850 CGGGGCTCAGGAGGTGGCCAGGG - Exonic
1197607927 X:128606744-128606766 CCGGGGCCAGCAGCTGCGGAGGG + Intergenic
1200047111 X:153409002-153409024 CAAGCCACAGCAGGTGCCCAGGG - Intergenic
1200089509 X:153627758-153627780 CCTGGCCCAGTGGGGGCCCAGGG - Intergenic
1200219565 X:154384412-154384434 CAGGGGGCAGCAGCTGCCCAAGG + Intergenic
1202372895 Y:24210326-24210348 CTGGGCCCTGCAGGAGGCCATGG - Intergenic
1202497887 Y:25459794-25459816 CTGGGCCCTGCAGGAGGCCATGG + Intergenic