ID: 927490191

View in Genome Browser
Species Human (GRCh38)
Location 2:23516239-23516261
Sequence CCGGGCCCAGCAGGTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 472}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927490191_927490201 -2 Left 927490191 2:23516239-23516261 CCATGGGCACCTGCTGGGCCCGG 0: 1
1: 0
2: 3
3: 44
4: 472
Right 927490201 2:23516260-23516282 GGGACTGGGAAGGGCTGACCAGG 0: 1
1: 0
2: 4
3: 61
4: 464
927490191_927490202 14 Left 927490191 2:23516239-23516261 CCATGGGCACCTGCTGGGCCCGG 0: 1
1: 0
2: 3
3: 44
4: 472
Right 927490202 2:23516276-23516298 GACCAGGAGCAACTATTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927490191 Original CRISPR CCGGGCCCAGCAGGTGCCCA TGG (reversed) Intronic