ID: 927490191 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:23516239-23516261 |
Sequence | CCGGGCCCAGCAGGTGCCCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 520 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 44, 4: 472} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927490191_927490201 | -2 | Left | 927490191 | 2:23516239-23516261 | CCATGGGCACCTGCTGGGCCCGG | 0: 1 1: 0 2: 3 3: 44 4: 472 |
||
Right | 927490201 | 2:23516260-23516282 | GGGACTGGGAAGGGCTGACCAGG | 0: 1 1: 0 2: 4 3: 61 4: 464 |
||||
927490191_927490202 | 14 | Left | 927490191 | 2:23516239-23516261 | CCATGGGCACCTGCTGGGCCCGG | 0: 1 1: 0 2: 3 3: 44 4: 472 |
||
Right | 927490202 | 2:23516276-23516298 | GACCAGGAGCAACTATTCGAAGG | 0: 1 1: 0 2: 0 3: 1 4: 32 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927490191 | Original CRISPR | CCGGGCCCAGCAGGTGCCCA TGG (reversed) | Intronic | ||