ID: 927490456

View in Genome Browser
Species Human (GRCh38)
Location 2:23517845-23517867
Sequence GGAAGGCCAATGTATCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927490456_927490460 -3 Left 927490456 2:23517845-23517867 CCTCTAAGATACATTGGCCTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 927490460 2:23517865-23517887 TCCATTCTTTGAGCCTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 184
927490456_927490459 -4 Left 927490456 2:23517845-23517867 CCTCTAAGATACATTGGCCTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 927490459 2:23517864-23517886 TTCCATTCTTTGAGCCTTGTGGG 0: 1
1: 1
2: 1
3: 19
4: 174
927490456_927490462 9 Left 927490456 2:23517845-23517867 CCTCTAAGATACATTGGCCTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 927490462 2:23517877-23517899 GCCTTGTGGGGTTAATGAGATGG 0: 1
1: 0
2: 2
3: 11
4: 152
927490456_927490458 -5 Left 927490456 2:23517845-23517867 CCTCTAAGATACATTGGCCTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 927490458 2:23517863-23517885 CTTCCATTCTTTGAGCCTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 211
927490456_927490464 22 Left 927490456 2:23517845-23517867 CCTCTAAGATACATTGGCCTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 927490464 2:23517890-23517912 AATGAGATGGAGAGTGAAGTAGG 0: 1
1: 0
2: 0
3: 42
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927490456 Original CRISPR GGAAGGCCAATGTATCTTAG AGG (reversed) Intronic
902197724 1:14810207-14810229 GGGAGGCCGAGGTACCTTAGAGG + Intronic
909132406 1:71754341-71754363 GAAACGCTAATGTATCTTAAAGG - Intronic
910182366 1:84499384-84499406 GGAAGGCCAAAGTATTATATTGG + Intronic
912224949 1:107722743-107722765 AGAAGCCCAAGGTATCTTAAAGG - Intronic
914666840 1:149839770-149839792 GGAAGTCCAAGGCCTCTTAGTGG - Exonic
914668927 1:149854020-149854042 GGAAGTCCAAGGCCTCTTAGTGG + Exonic
916166003 1:161968009-161968031 GGAAGGACAGTGTATATTTGTGG - Intergenic
916166208 1:161969362-161969384 GGAAGGACAGTGTATATTTGTGG - Intergenic
919038610 1:192350599-192350621 GGAAGGCAAATTTCTCTGAGTGG + Intronic
923166094 1:231363691-231363713 GGAAAGCCAATGTATGATAAAGG + Intergenic
1068333337 10:55600832-55600854 AGAAGGGCAATGCAGCTTAGTGG - Intronic
1069967026 10:72128117-72128139 GGAAGGCAAATATATCTTCAAGG - Exonic
1072562907 10:96592791-96592813 TGGAGGCCAATTTACCTTAGGGG + Intergenic
1075635442 10:124027269-124027291 GGATGGGAAATGTATGTTAGGGG + Intronic
1076011489 10:126992848-126992870 GGAAGCCCAATGCATCTATGAGG - Intronic
1085339234 11:75720444-75720466 GGCATGCCTATGTATCTTAAAGG + Intronic
1093336408 12:17911095-17911117 GGAAGAGGTATGTATCTTAGGGG - Intergenic
1095197689 12:39341371-39341393 GGAAGGCAAATGTAGGTCAGTGG + Intronic
1095271739 12:40226460-40226482 AGAAAGCCAATGTTTCTTAATGG + Intronic
1096670461 12:53195548-53195570 GGACGGAGAATGTATCTTTGGGG + Intronic
1099293674 12:80803777-80803799 GGAAAGCTAATGCATCTTTGAGG + Intronic
1104085232 12:125468477-125468499 GGAAGCCCAATGTATGTTCCAGG + Intronic
1107778928 13:43878648-43878670 GGAAGGCCAGTGTATGGTAAAGG - Intronic
1117361214 14:54976122-54976144 GGAAAGCCAATGTGGCCTAGTGG - Intronic
1120686403 14:87542927-87542949 GGTATGCCTATGTATCTTAGTGG + Intergenic
1126271269 15:46820101-46820123 GGATGGCCAATGTCTTTTGGTGG - Intergenic
1126402857 15:48292345-48292367 GGAAGGCCTATGAATTTTGGGGG + Intronic
1127074309 15:55310816-55310838 TGAAGGCCAACTAATCTTAGAGG - Intronic
1131758161 15:95588765-95588787 GGAAGGCCATGTTAGCTTAGAGG + Intergenic
1134398052 16:13883538-13883560 GGAAGGCCACTGTTTCTGAATGG + Intergenic
1150888823 17:69120997-69121019 GTAAGCTCTATGTATCTTAGGGG + Intronic
1156595860 18:38546904-38546926 GGGAGGACAGTGTTTCTTAGGGG - Intergenic
1168545325 19:57245079-57245101 GGAAGGTCAATGTCTCCTTGGGG - Intronic
926506808 2:13726273-13726295 TGAAGGCTGATGTATTTTAGGGG - Intergenic
927490456 2:23517845-23517867 GGAAGGCCAATGTATCTTAGAGG - Intronic
928258331 2:29744244-29744266 GGAAGGACACTGTACCATAGTGG - Intronic
929938555 2:46313115-46313137 GGAAGGACAAGGTATCTTTTAGG - Intronic
933691209 2:85180948-85180970 GGAAGGCCACCGTCTGTTAGGGG - Intronic
940660858 2:156543602-156543624 GGAAGGCCATTGTGTCTAAAAGG + Intronic
941644486 2:168025338-168025360 GGAAGGGAAATGTATCTGAGAGG - Intronic
944863096 2:203834176-203834198 AGAATGCTAATGTATCTCAGAGG + Intergenic
945335715 2:208590645-208590667 GAAATGCCAATGTATCTAAATGG + Intronic
946476863 2:220015306-220015328 GGAAAGCAAATGTTTCCTAGCGG + Intergenic
947325510 2:228971244-228971266 GTAAGCCAAATGTATTTTAGTGG - Intronic
1170005654 20:11666166-11666188 TGAGGGCCAATGATTCTTAGAGG + Intergenic
1172610687 20:36249601-36249623 GGCAGGCAAATTTATCATAGTGG - Intronic
1177263523 21:18756860-18756882 TGAAGGCCAATTAATCTTAAAGG - Intergenic
1179128673 21:38614737-38614759 GGAAGGCCAATTTATCTGATCGG + Intronic
949939038 3:9139830-9139852 GGAAGGACAATGTGTTGTAGAGG + Intronic
951574194 3:24097028-24097050 TCAAGGCCAATGCATATTAGTGG - Intergenic
955112342 3:55961204-55961226 GGAAGGCCAGTGTAGCTTGGGGG - Intronic
955112424 3:55961951-55961973 GGAAGGCCAGTGTGGCTTGGCGG - Intronic
956633482 3:71339381-71339403 GGAATGATAATGTACCTTAGAGG - Intronic
957189832 3:76993350-76993372 GAAATTCAAATGTATCTTAGAGG + Intronic
963928243 3:150974645-150974667 AGAATGCCAATGTACCTTCGGGG + Intergenic
967983348 3:195078414-195078436 GGAAGGCCCGTGTAGCTCAGTGG - Intronic
969197827 4:5577258-5577280 GGAGAGACAATGTAGCTTAGTGG - Intronic
974345504 4:60676268-60676290 GGAATGCCCAAGTCTCTTAGTGG - Intergenic
975698743 4:77041458-77041480 TGAATGGCAATCTATCTTAGGGG - Intergenic
976036610 4:80830596-80830618 GGAAGGCCAAACTATCTCAAGGG + Intronic
976442401 4:85089984-85090006 GGAAGGCAATTGTATCATGGGGG + Intergenic
978311086 4:107385675-107385697 GGAAGGCCAATATCTCTCCGAGG - Intergenic
980304678 4:131043186-131043208 TTAAAGCCAATGTATCTCAGTGG - Intergenic
985046737 4:185948351-185948373 GGAGGGCTAATGTATATTAGGGG - Intronic
990646229 5:57847740-57847762 GGAAGGCCAATGCAATTTCGGGG - Intergenic
993994874 5:94710823-94710845 ACAAGGACAATGTATCTCAGCGG + Exonic
995289234 5:110430889-110430911 GAAAGGCCAATGTATCAGAGAGG + Intronic
995924459 5:117353908-117353930 GGAAGGCAATTGAATCATAGGGG + Intergenic
996759970 5:126976962-126976984 GGAAGGTCTATGTATATGAGAGG + Intronic
997878642 5:137570850-137570872 GGAAGAAAAATGTATCTTGGTGG + Intronic
1000484517 5:161823938-161823960 GGAATGCCAATGAATTTTAAAGG - Intergenic
1000969028 5:167693429-167693451 GGAAACCCAATGCATCTTACAGG - Intronic
1002418689 5:179134526-179134548 GGGAGGCCAATGTCACTGAGAGG - Intronic
1003709263 6:8570723-8570745 TGAAGACCCATGTATTTTAGAGG - Intergenic
1004844686 6:19626639-19626661 GAAAGGCCAAAGAATCTTACCGG + Intergenic
1009050704 6:58272797-58272819 TGAAGGCCAGTACATCTTAGCGG + Intergenic
1009239717 6:61169584-61169606 TGAAGGCCAGTACATCTTAGCGG - Intergenic
1009357021 6:62763033-62763055 GGAAGGTGAATGGATCATAGGGG + Intergenic
1010855035 6:80827196-80827218 GAAGGGCCAAATTATCTTAGGGG - Intergenic
1011189790 6:84716917-84716939 GGAAGGCCAACTAATCTTAAAGG - Intronic
1012625472 6:101399595-101399617 GGAGGGCCAATGTGTGGTAGTGG + Intronic
1014308176 6:119767652-119767674 GAAAGGCCAATGTCTCTCCGAGG + Intergenic
1016444730 6:144120001-144120023 TGAAGGCCAACCTATCTTAAAGG - Intergenic
1029314224 7:99696790-99696812 GGAAGGCGATTGTATCTTAGGGG + Intronic
1033544823 7:142390362-142390384 GGAAGCAGAATGTATCTTTGGGG - Intergenic
1036093185 8:5691825-5691847 GGAAGGCAAATGTGCCCTAGTGG - Intergenic
1037062297 8:14529518-14529540 TGAGGGCTAATGTATCTTACTGG - Intronic
1038541415 8:28393222-28393244 GAAATTACAATGTATCTTAGTGG + Intronic
1038706404 8:29897996-29898018 GGCAGGGCAATGTGTCTTTGGGG + Intergenic
1046217122 8:111163354-111163376 GAAAGGCCACTGAATCTTTGTGG - Intergenic
1048232856 8:132660651-132660673 GGAAGACCAATTTATCTGATAGG + Intronic
1050410843 9:5363338-5363360 GGAAGGCCACTGGATCCCAGAGG - Intronic
1052636642 9:31115081-31115103 GGAAGGGCTATGTATGTTGGGGG + Intergenic
1057873146 9:98733087-98733109 GGAACCCCACAGTATCTTAGAGG - Exonic
1191908589 X:66122756-66122778 GGAAAGTCAATGTAGCTTAATGG + Intergenic
1193578371 X:83231678-83231700 CCAAGGCCAAAGTCTCTTAGGGG + Intergenic
1194170609 X:90575833-90575855 GCAGTGCCAATGTATGTTAGCGG + Intergenic
1201135113 Y:10984629-10984651 TGGAGTCCAATGTATCATAGTGG - Intergenic