ID: 927491722

View in Genome Browser
Species Human (GRCh38)
Location 2:23525562-23525584
Sequence GCAGTGGGATGGAGCTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927491706_927491722 27 Left 927491706 2:23525512-23525534 CCTCTCTCTCCTGCGTGACCAGC 0: 1
1: 0
2: 1
3: 21
4: 233
Right 927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG 0: 1
1: 0
2: 3
3: 16
4: 295
927491712_927491722 2 Left 927491712 2:23525537-23525559 CCAAGGGACAGTTCCTTCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 185
Right 927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG 0: 1
1: 0
2: 3
3: 16
4: 295
927491708_927491722 18 Left 927491708 2:23525521-23525543 CCTGCGTGACCAGCAGCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG 0: 1
1: 0
2: 3
3: 16
4: 295
927491710_927491722 9 Left 927491710 2:23525530-23525552 CCAGCAGCCAAGGGACAGTTCCT 0: 1
1: 0
2: 2
3: 15
4: 182
Right 927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG 0: 1
1: 0
2: 3
3: 16
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927491722 Original CRISPR GCAGTGGGATGGAGCTAAGG GGG Intronic
900667019 1:3822450-3822472 GCAGGTGGCAGGAGCTAAGGAGG + Intronic
901962833 1:12840978-12841000 GCAGTGTGTGGGAGCTAGGGTGG - Intergenic
901990023 1:13105281-13105303 GCAGTGTGTGGGAGCTAGGGTGG - Intergenic
902481026 1:16711961-16711983 GCAGTGGGAGGGAGGGAGGGAGG - Intergenic
902511409 1:16968922-16968944 GCAATGGGATGGGGCCCAGGTGG + Intronic
902595491 1:17506786-17506808 TCAGTCTGATGGGGCTAAGGAGG - Intergenic
902880368 1:19368255-19368277 GTGGTGGGATGGAGCGCAGGCGG + Intronic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
904054038 1:27658699-27658721 GCAGAGGGAAGGAGGCAAGGAGG + Intergenic
906699309 1:47846376-47846398 GCAGTGAGAAGGAGCTGATGTGG + Intronic
907448520 1:54526556-54526578 GGAGGTGGATGTAGCTAAGGAGG + Intergenic
908498746 1:64721938-64721960 GGAGTGAGAGGGAGGTAAGGGGG - Intergenic
908787150 1:67746511-67746533 GCATTCGGAGGGAGCTATGGGGG + Intronic
910207098 1:84759147-84759169 GCAGCAGTATGGAGCGAAGGGGG - Intergenic
910288627 1:85579860-85579882 GCAGTGGGCTGGAACTAAAGTGG + Intergenic
910768445 1:90806726-90806748 GCAGGGGGATGGAGAAAAAGTGG - Intergenic
916588108 1:166165895-166165917 GCAGTAGGAAGGAGCTGGGGAGG + Intronic
916908878 1:169322362-169322384 GCAGTGGGAGGAAGATAGGGAGG + Intronic
916992278 1:170256990-170257012 GCAGTGGGATAGAGATAAGTGGG - Intergenic
917118700 1:171627052-171627074 GCCGTGTGCTGGGGCTAAGGTGG + Intergenic
918125669 1:181581226-181581248 GGTGTGGGATGGAGCTCAGTTGG - Intronic
921001006 1:211042941-211042963 CCTGTGGGATGCAGCAAAGGTGG + Intronic
922789854 1:228305616-228305638 GCAGTGGGAGGGAAACAAGGTGG - Intronic
1063800345 10:9570288-9570310 GCAGGAGAATGGAGCCAAGGGGG - Intergenic
1064933834 10:20657719-20657741 GCCAGGGGTTGGAGCTAAGGAGG - Intergenic
1064991402 10:21259834-21259856 GCAGGGGGGTGGATCTAAGGTGG + Intergenic
1065867188 10:29924522-29924544 GCAGTGGGATGGGAGGAAGGGGG + Intergenic
1067218372 10:44322695-44322717 TCAGGGGAATGGAGCTATGGTGG - Intergenic
1067851164 10:49755437-49755459 GCAGTGAGCGGGGGCTAAGGGGG + Intronic
1068152034 10:53145025-53145047 GAAGTGGGAGGGAGGAAAGGGGG - Intergenic
1070553446 10:77509975-77509997 GCAGTGGGATTGTGCTAATTGGG - Intronic
1070557943 10:77544483-77544505 GCAGTGGGATGGGGCATATGAGG - Intronic
1070805242 10:79266968-79266990 ACAGTGGAATGGGGCTGAGGAGG + Intronic
1071016101 10:80998657-80998679 GCAGTGGGATGAAGGAGAGGGGG + Intergenic
1071228847 10:83562742-83562764 GCAGCGGGTGGGTGCTAAGGCGG + Intergenic
1072770014 10:98130046-98130068 GCAGAGGGATGGAGAGAAGTGGG - Intergenic
1073062946 10:100743075-100743097 GGAATGGGCTGGAGCTAATGGGG + Intronic
1073063199 10:100744310-100744332 GCGGGGGGAGGGAGCGAAGGAGG + Intronic
1074413539 10:113247693-113247715 GCAGTGGGCTGGAGCACAGGGGG + Intergenic
1074538454 10:114345573-114345595 GCTGTGGGAATGGGCTAAGGAGG + Intronic
1075567502 10:123515277-123515299 GCAGTGGCCTGGAGGTCAGGAGG + Intergenic
1076496281 10:130899765-130899787 GCAGTGGGTTGAAGCTGGGGTGG + Intergenic
1077092872 11:787634-787656 GCAGTGGGACGGACCTGGGGTGG - Exonic
1077476968 11:2795098-2795120 GCTGTGGGGTGGAGCTGAGTGGG - Intronic
1078396454 11:10986138-10986160 GCAATGGGACGGGGCTGAGGAGG - Intergenic
1078491829 11:11776634-11776656 GCAGTGAGATAGAGTCAAGGTGG - Intergenic
1081461623 11:43277752-43277774 TAAATGGGATTGAGCTAAGGGGG + Intergenic
1082112448 11:48292431-48292453 CCAGAGGGGTGGAGCTAAGATGG + Intergenic
1083214858 11:61212091-61212113 GCAATGGGATGGGGCTGCGGGGG + Intronic
1083217742 11:61230920-61230942 GCAATGGGATGGGGCTGCGGGGG + Intronic
1083220738 11:61250670-61250692 GCAATGGGATGGGGCTGCGGGGG + Intronic
1084125581 11:67096821-67096843 GCAGTGGGATGTGGCACAGGAGG + Intergenic
1085015875 11:73173821-73173843 GCAGTGGGAGGAGGCTAGGGAGG - Intergenic
1086424882 11:86673228-86673250 GCAGTGGGAGGGAACCAAGTGGG - Intergenic
1089690013 11:120181316-120181338 GCAGTGCTATGGAGCTCATGGGG - Intronic
1090024572 11:123156732-123156754 TCTGTGGGATGGAGCAAAGCTGG - Intronic
1090273892 11:125406242-125406264 GCCGTGGAATGGAGACAAGGAGG - Intronic
1090462273 11:126902107-126902129 TCAGTTGGAAGGAGCTATGGAGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091107850 11:132939562-132939584 GCGGTGAGATGGAGGCAAGGTGG - Intronic
1091412441 12:252950-252972 GGGGTGGGAGGGAGCCAAGGGGG + Intronic
1091600728 12:1916203-1916225 GCAGGGGGAATGAGCTGAGGAGG + Intronic
1091842342 12:3630110-3630132 GCAGTGAGATGGAGGTATGACGG + Intronic
1092748856 12:11699671-11699693 GCTGTAGGATGGAGGTAAAGAGG + Intronic
1093450313 12:19306395-19306417 GCAGTGGGGTAGAGAAAAGGTGG + Intronic
1094501567 12:31025867-31025889 GCTCTGGGATACAGCTAAGGCGG + Intergenic
1095502681 12:42857757-42857779 GTAGGTTGATGGAGCTAAGGTGG - Intergenic
1096199672 12:49672711-49672733 GCAGTGGGAAGGAAATGAGGAGG - Intronic
1096217977 12:49808975-49808997 GCAGGGGGAGGGAGAGAAGGAGG + Intronic
1098752734 12:74316518-74316540 GCAGTGTGATTTAGATAAGGTGG - Intergenic
1100866862 12:98866512-98866534 GCAGTGGGCTGGAGCCAGGTGGG - Intronic
1101706832 12:107228382-107228404 GCAGTGGGATTGAGATGAGAAGG - Intergenic
1101782725 12:107849967-107849989 GCAGTGGGATGGGAATATGGAGG - Intergenic
1101998334 12:109540939-109540961 GCGGTGGGCGGGAGCTGAGGTGG + Intergenic
1103733727 12:123045244-123045266 GAAGCGGGATGGTGCCAAGGAGG - Intronic
1104725204 12:131071475-131071497 TGAGTGGGGTGGAGTTAAGGGGG + Intronic
1105480278 13:20769018-20769040 TCAGTGGGATGGATCTAGGTGGG + Intronic
1105706516 13:22970862-22970884 GCAGTGGGAGCCACCTAAGGAGG + Intergenic
1106135032 13:26967547-26967569 GCAGTGGGATAGGGGGAAGGAGG + Intergenic
1106413755 13:29528767-29528789 GCCGTCAGATGTAGCTAAGGGGG + Intronic
1107187880 13:37546072-37546094 GCAGTGGGGTGGAGCGCGGGGGG + Intergenic
1107373073 13:39773130-39773152 GCATTAGGATGGAGGGAAGGTGG - Intronic
1107443419 13:40448503-40448525 GCAGTGGAATAGAGTGAAGGAGG - Intergenic
1107911427 13:45108932-45108954 GCACTGGGGTGGAGCTACAGAGG - Intergenic
1108746368 13:53398906-53398928 TCAGAGGGAAGGAGATAAGGGGG - Intergenic
1112245577 13:97730408-97730430 GCAGTGGGGAGGAGCCAAGATGG + Intergenic
1112865526 13:103891906-103891928 GACATGGGATGGAGCTCAGGTGG - Intergenic
1113582705 13:111440188-111440210 TCAGTGGGATGGGGCTATGAAGG - Intergenic
1113680686 13:112242227-112242249 ACAGAGGGATGGAGGGAAGGAGG + Intergenic
1113811349 13:113144334-113144356 CCAGTGGGAAGGGGCTGAGGGGG - Intronic
1122883113 14:104698982-104699004 TCAGTGGGGTGGAGCCACGGTGG - Intronic
1123468265 15:20531658-20531680 GCAGTCGGATGGAAAGAAGGGGG + Intergenic
1123649851 15:22469406-22469428 GCAGTCGGATGGAAAGAAGGGGG - Intergenic
1124694024 15:31848328-31848350 GCTGTGGGATTGAGATGAGGGGG + Intronic
1131672891 15:94639284-94639306 GTGGTGGGATGGGGGTAAGGAGG + Intergenic
1131850829 15:96541584-96541606 TCAGTGAGATGGAGTGAAGGTGG + Intergenic
1133002924 16:2860190-2860212 GCAGTGGGGTGGGGCGCAGGAGG - Intergenic
1133329093 16:4960161-4960183 GCAGAGGGATGCAGCCAAGAAGG - Intronic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1137898398 16:52238289-52238311 GCAGTGGGATGGGGCTTATAGGG + Intergenic
1138441079 16:57035368-57035390 GCAGTGGGAAGGAGTGAAGGGGG - Intronic
1139306563 16:65991335-65991357 GCAGGGGCATGGAGGTTAGGTGG - Intergenic
1142742285 17:1938062-1938084 GCTGTGGGGTGGAACTAAGGAGG - Intronic
1143105926 17:4530545-4530567 GCAGGGGGAGGGAGCAAAGTGGG + Intronic
1143843092 17:9750333-9750355 GCAGTGGAATGGAACAAAGCTGG + Intergenic
1144269438 17:13602053-13602075 GGGGTGGGATGGAGAAAAGGTGG + Intergenic
1144817528 17:18046209-18046231 GCAGTGGAAAGGAGCTGGGGTGG + Intronic
1146660583 17:34662841-34662863 GCACTGGGCTGGAGCAAAGTTGG + Intergenic
1147350695 17:39840866-39840888 GCAGTGTGAATGAGGTAAGGAGG + Intronic
1147395870 17:40142357-40142379 GCACTGGGATAGGGCTAAGTAGG + Intronic
1148687803 17:49510343-49510365 GCAGTGGGTTAGAGCTAAAAGGG + Intronic
1148924335 17:51069985-51070007 GCAGTGGCATGCACCTGAGGTGG + Intronic
1150324941 17:64249334-64249356 ACTGTGGGAAGGAGCTCAGGAGG + Intronic
1151690945 17:75684995-75685017 GCAGTGCAATGGAGCCAAGGAGG - Intronic
1152024989 17:77803033-77803055 GTGGTGGGATGGAGCGAGGGAGG - Intergenic
1152795621 17:82304687-82304709 GGAGAGGGAAGGAGATAAGGGGG - Intergenic
1152993346 18:383359-383381 GCAATGAGATGGAGGTGAGGAGG + Intronic
1153707472 18:7760862-7760884 GCAGCAGAATGGAGCTAGGGTGG - Intronic
1155326868 18:24673123-24673145 GCAGTGGGGGGGAGCAAGGGCGG - Intergenic
1156932277 18:42660315-42660337 GCATTGGGGTGGAGCCAAGATGG + Intergenic
1157183517 18:45518821-45518843 CCAGGGAGAAGGAGCTAAGGTGG - Intronic
1159035930 18:63277032-63277054 GCAGTGGGAGGGAGGGAAAGTGG - Intronic
1160436928 18:78858942-78858964 GCAGTGGGAGGGAGGGAGGGAGG + Intergenic
1163759856 19:19130307-19130329 GCTGGAGGCTGGAGCTAAGGAGG + Exonic
1164609743 19:29623985-29624007 GCAGGGGCATGGCGCTGAGGAGG + Intergenic
1164633609 19:29777396-29777418 GCAGTGAGAGGGAGGCAAGGGGG - Intergenic
1164861001 19:31562182-31562204 GCAGTGGCATGGAGAGATGGAGG - Intergenic
1165136691 19:33674145-33674167 GCACTGGGATGGAGGGATGGAGG + Intronic
1165239813 19:34457000-34457022 AGAGTGGCATGGAGCTAAGCAGG - Intronic
1165904594 19:39186016-39186038 GCATGGGGAAGGAGGTAAGGTGG - Intergenic
1166795757 19:45424413-45424435 GCCGTGGGATGGGGGTCAGGGGG + Intronic
1168110726 19:54190169-54190191 TCAGTGGGGCGGAGCCAAGGTGG + Intronic
926819409 2:16836073-16836095 GCATTGGAGTAGAGCTAAGGAGG + Intergenic
926931643 2:18046970-18046992 GCGATGGGGTGGAGCTGAGGAGG + Intronic
927489707 2:23512977-23512999 GCTGTGGGATGTGGCTCAGGAGG + Intronic
927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG + Intronic
928329757 2:30348616-30348638 GGAGAGGGTTGGAGCAAAGGCGG - Intergenic
929344062 2:40859152-40859174 GCAGTGGCATGTAGCTTGGGGGG + Intergenic
929666968 2:43840776-43840798 GGAGTGGGATGGAGCTGAGGGGG - Intronic
929915389 2:46131409-46131431 TCAGTGTCATTGAGCTAAGGTGG - Intronic
930931736 2:56892990-56893012 GCTGTGGGGTGGAGGGAAGGGGG - Intergenic
931951581 2:67369334-67369356 CCAATGGGATGCAGCAAAGGTGG + Intergenic
932137241 2:69242186-69242208 GCAGAGGGATGGAGATGGGGTGG - Intronic
932295234 2:70618715-70618737 GCAATGGAAAGGTGCTAAGGAGG + Intronic
933051230 2:77605150-77605172 GCAATGGGAAGGAAGTAAGGCGG - Intergenic
933695394 2:85213675-85213697 GCAGTGCCAAGGAGCTAAGGTGG + Intronic
933721085 2:85398230-85398252 ACAGTGGGAGGGACCTAGGGAGG - Intronic
933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG + Intergenic
934859226 2:97749867-97749889 GCAGTGGCAAGGAGCTCAGGAGG + Intergenic
935088010 2:99867350-99867372 CCAGTGGGTTTGAGATAAGGCGG + Intronic
936418691 2:112343856-112343878 TCAGTGGGTATGAGCTAAGGAGG + Intergenic
936584226 2:113739392-113739414 GCAGTTGGTTGGATCCAAGGAGG + Intronic
936686114 2:114828785-114828807 GCACTGGGATGCAGCTATGCAGG + Intronic
936775920 2:115973008-115973030 GGAGGTGGATGGAGCTCAGGTGG + Intergenic
937068990 2:119047773-119047795 CCTGTGGGATACAGCTAAGGCGG - Intergenic
937314440 2:120922019-120922041 AGAGGGGGATGAAGCTAAGGAGG - Intronic
937872096 2:126793213-126793235 GCAGTGTGGTTGGGCTAAGGTGG + Intergenic
937987044 2:127642616-127642638 GCAGTGGAAGGGACCTGAGGGGG - Intronic
939662301 2:144905047-144905069 GAAGTGGGATGCAGGTAAGTAGG + Intergenic
940992732 2:160114513-160114535 GCAGGGGGGTGGAGCCAAGATGG + Intronic
941771288 2:169348812-169348834 GCACTGGGGTGGAGAAAAGGGGG + Intronic
944219167 2:197285237-197285259 GCAGTGGGTTGGGGCTGGGGAGG - Intronic
946014280 2:216591552-216591574 GCAGTGGGAAGGGGCTCAGTTGG - Intergenic
946199668 2:218064478-218064500 GTTGTGGGATGGAGCGAGGGAGG - Intronic
946511524 2:220362136-220362158 GCTGTTGGATGCAGCTAAAGTGG + Intergenic
947152344 2:227128697-227128719 GCAGTGGGAGGAAGGTAAGATGG - Intronic
947366753 2:229404169-229404191 GTAGTTGGATGGAGGTAAGAGGG + Intronic
948263510 2:236621502-236621524 ACAGTTGGATGGAACGAAGGTGG - Intergenic
948591720 2:239054642-239054664 GCAGTGGGATGGAGAAGAGCTGG + Intronic
948701464 2:239763234-239763256 GCAGGGGGAGTGAGCTGAGGAGG - Intronic
948704237 2:239779255-239779277 GCAGTGGGAGGTAGCAAAGGCGG + Intronic
1171111836 20:22491230-22491252 GCAGCAGGAGGGAGCTCAGGGGG - Intergenic
1172023754 20:31934313-31934335 ACTGTGGGATGGAGCTGGGGAGG - Intronic
1173881308 20:46414513-46414535 GCAGTGGGGTGGAGGGTAGGGGG + Intronic
1174347130 20:49938414-49938436 GCAGTCGGTTGGAGCTAGCGGGG - Intronic
1174717836 20:52778883-52778905 GGAGTGGGATGAAGCTAGAGGGG - Intergenic
1175908214 20:62392183-62392205 GCAGTGTGATGGGGCCACGGGGG + Intronic
1176096420 20:63346491-63346513 GCAGTGGCTTGGAGCAGAGGTGG - Exonic
1180049395 21:45324418-45324440 GGAGTGGGAGGGAGGTGAGGGGG + Intergenic
1180617485 22:17137996-17138018 GCAGTGCGGTGGAGGTGAGGGGG - Exonic
1181745049 22:24950427-24950449 GCAGGGGGAACCAGCTAAGGTGG + Intergenic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1182002275 22:26929582-26929604 GCTGGGGGAAGGAGCCAAGGGGG - Intergenic
1182772853 22:32808371-32808393 GCAGTGGGATGGTCACAAGGAGG + Intronic
1183121459 22:35733111-35733133 GAAGTGGGATGGAGCTGGGATGG - Intergenic
1183591629 22:38782554-38782576 GCAGTGGGAGGAAGTTAAGAAGG - Intronic
1184671468 22:46014109-46014131 GCGGTGGGAGGGAGGGAAGGTGG - Intergenic
1185233739 22:49699286-49699308 GCAGACGGATGGAGCTGAGCAGG + Intergenic
1203309562 22_KI270736v1_random:133161-133183 GCAGTGGAATGGAGTTGAGTTGG + Intergenic
949300671 3:2580319-2580341 GCAGTGGCAGAGAGCTGAGGAGG + Intronic
949347267 3:3088237-3088259 GCAGTGGGGTGGTGCAGAGGAGG + Intronic
949925530 3:9037994-9038016 GGAGTGGGATGGGGCTGGGGAGG - Intronic
952324135 3:32305772-32305794 CCAGTGGCATGGAGGAAAGGAGG - Intronic
952606925 3:35158860-35158882 GTAGTAGGATGTGGCTAAGGGGG - Intergenic
954217093 3:49130701-49130723 GCAGAGTGCTGGAGCTATGGAGG + Intronic
955892067 3:63660718-63660740 GAGGTGGGATGGAGGTAGGGAGG + Intronic
956289603 3:67647708-67647730 GCAGTGGGGAGGAGCTCATGGGG - Intronic
956865677 3:73366577-73366599 GCAATTGGATGGAACCAAGGTGG - Intergenic
956941223 3:74163095-74163117 TCAGGGGGGTGGAGCCAAGGTGG - Intergenic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
959262791 3:104102854-104102876 GCTGTGGGATTAAGCCAAGGGGG + Intergenic
959568415 3:107856485-107856507 GCAGAGGGCTGGAGGAAAGGTGG - Intergenic
960213009 3:114993738-114993760 CCTGTGGGATGCAGCTAAAGTGG + Intronic
961333449 3:126156402-126156424 GCAGTGGCCAGGAGCTGAGGAGG + Intronic
962110756 3:132444108-132444130 GGAGGTGGATGGAGCTCAGGCGG - Intronic
962278532 3:134033230-134033252 GCAGTGGGATGGTGGTAGGAAGG + Intronic
962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG + Intronic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
963301699 3:143604601-143604623 GAAGTGGGGTGGAGTGAAGGTGG + Intronic
964519955 3:157554358-157554380 GCAATGGGCTGGAGCTGAGAAGG - Intronic
964823199 3:160796288-160796310 GCAGAGGGCTGGAGGTTAGGTGG + Intronic
965045352 3:163571272-163571294 GCTGTGGGAGGGACCCAAGGGGG + Intergenic
966207867 3:177423340-177423362 TCAGTGAAATGGAGTTAAGGAGG + Intergenic
966599213 3:181758845-181758867 GCAATGGGATGGGGGTCAGGGGG - Intergenic
967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG + Intronic
967360416 3:188624077-188624099 GCAGAACAATGGAGCTAAGGAGG - Intronic
968598248 4:1496325-1496347 GCGGTGGGGTGGAGCTGGGGGGG - Intergenic
968612123 4:1561989-1562011 ACAGTGGGCTGGGGCCAAGGAGG + Intergenic
969215946 4:5722631-5722653 GGAGTGGGATGGAGAGACGGAGG - Intronic
970840656 4:20464506-20464528 TCAGTGGGATGGAGCTGCCGAGG - Intronic
971254874 4:25005129-25005151 GCTGTGGGATGGGGCAAATGAGG + Intronic
971595331 4:28520073-28520095 TCAGTGGGATGGAGCAAATAAGG - Intergenic
973169997 4:47130271-47130293 GCAGTGGTATGGGGCTGTGGAGG - Intronic
976111599 4:81680601-81680623 GCAATGGGATGGAGAAAAGCAGG + Intronic
976178950 4:82381198-82381220 GCTGTGGGTGGGAGCTAAAGGGG - Intergenic
976471443 4:85433824-85433846 ACAGTGGGATGGGGCTGAGAGGG + Intergenic
977726820 4:100305724-100305746 GCAGTGGGATGTAGCTCCGGTGG + Intergenic
979469015 4:121072659-121072681 GCAGCGGGAGGGAGAGAAGGAGG - Intronic
981005109 4:139866433-139866455 GCAGAGGGATGGTGCAAAGAAGG - Intronic
981660263 4:147158312-147158334 GCAGAGGGACGCAGCTCAGGGGG - Intergenic
982750201 4:159151933-159151955 GCAGTGGGAAGGAGCTGTTGAGG + Intronic
983494140 4:168424355-168424377 GTAGTGGGATAGAGATAAAGAGG - Intronic
983919714 4:173333469-173333491 GGAGAGGGACGGAGCTCAGGGGG - Intronic
987241565 5:16005402-16005424 GCTGTGTGATGCAGGTAAGGAGG + Intergenic
988505651 5:31820228-31820250 GGAGTGGGATGGAATTAAGAAGG - Intronic
989188427 5:38646623-38646645 GCACTGGGATGAACCTATGGGGG - Intergenic
991965180 5:72083625-72083647 GCAGTAGGTTGGAGATAAAGTGG + Intergenic
992378204 5:76210540-76210562 GCACTGGGATGGTGGTGAGGCGG - Intronic
992662931 5:78979519-78979541 GCACTGGGGTGGAGCCACGGAGG + Intronic
992790840 5:80212206-80212228 GCAGTGGGATGGGGCACAGTGGG + Intronic
993250090 5:85510777-85510799 GCTCTGGGATGCAGCAAAGGTGG - Intergenic
994943222 5:106351589-106351611 GCAGTGCAATGGAGCAAAGGTGG - Intergenic
999112821 5:149136967-149136989 GCAGAAGGAAGGAGCTGAGGTGG - Intergenic
999241206 5:150128481-150128503 GCTATGGGATGGAGCTACAGGGG - Intronic
999704169 5:154256214-154256236 GCAGTTGGCAGGAGCTAAGTTGG - Intronic
1000278711 5:159763642-159763664 TCAGCTGGCTGGAGCTAAGGAGG + Intergenic
1002060252 5:176621459-176621481 GAAGTGGGATGGAGGTGAAGGGG + Intronic
1002831911 6:830147-830169 TGTGTGGGATGGAGCTAAGCAGG + Intergenic
1002899556 6:1399481-1399503 GCAGGGGGAGGGAGGTAAGGAGG + Intergenic
1003091997 6:3112137-3112159 GCAGTGGGGTGGAGTAAAGGAGG + Intronic
1007923199 6:45629243-45629265 CCAGTGGGATGGAGGTGAGCAGG + Intronic
1008654945 6:53602291-53602313 TCAGTGAGATGGAGCTGAGAAGG + Intronic
1009993128 6:70868455-70868477 GCAGTGGGATGAGCCTATGGAGG - Intronic
1011299943 6:85863418-85863440 TCAGGGGGATGGAGCCAAGATGG - Intergenic
1014021623 6:116597125-116597147 GCAGTGGGTTGCTGCAAAGGAGG + Exonic
1015269192 6:131322284-131322306 GCAGTGGGAGGCAGGAAAGGGGG - Intergenic
1015803175 6:137080970-137080992 ACAGTGGGATGGAGCCACAGAGG - Intergenic
1016801328 6:148172152-148172174 ACAGTGGGATGGTGCTGAGTGGG - Intergenic
1018704289 6:166451064-166451086 GCAGTGGGTTGGGGGTAAGAGGG - Intronic
1019059095 6:169242828-169242850 GCAGTGGGAAGGTGGGAAGGTGG - Intronic
1019059134 6:169242944-169242966 GCAGTGGGAAGGTGGGAAGGTGG - Intronic
1019059174 6:169243067-169243089 GCAGTGGGAAGGTGGGAAGGTGG - Intronic
1019359166 7:595913-595935 ACAGTGGGAAGGAGAAAAGGAGG + Intronic
1019587280 7:1812493-1812515 GCAGTGGGAGGGAGGGAGGGAGG + Intergenic
1019896595 7:3988094-3988116 GCAGTGGGAAGAAGTTAAGCTGG - Intronic
1020498221 7:8883644-8883666 GCCGGGGGTTGGAGGTAAGGAGG + Intergenic
1020555890 7:9669877-9669899 GCATGGGGGTGGAGCTGAGGTGG - Intergenic
1021913269 7:25407250-25407272 GAAGTGGGAGGGAGCTCAGATGG - Intergenic
1022100942 7:27168791-27168813 GCTTTGGGAAGGAGATAAGGAGG + Intronic
1022376136 7:29813165-29813187 GCAATGGGATAGAGCCAAGGAGG - Intronic
1023943073 7:44782432-44782454 GCAGTTGGATAGGACTAAGGAGG + Intergenic
1023986344 7:45099361-45099383 ACAGTGGGGTGGAGCTGAGATGG - Intergenic
1024300472 7:47883692-47883714 GCAGTTGGAAGCAGCTGAGGAGG + Intronic
1026510713 7:71025205-71025227 GCAATGGGCTGGAGAAAAGGGGG + Intergenic
1029542898 7:101194974-101194996 GCATTGGGATGGAGTTAGGAGGG - Intergenic
1030624475 7:111829467-111829489 GCTGTGGGATGGGGTTGAGGAGG + Intronic
1031392977 7:121238500-121238522 GCACTGGGAAGAAGCTAAGCTGG - Intronic
1031975362 7:128090206-128090228 GCAGGGAGATGGGGCTCAGGAGG - Intronic
1032128660 7:129212149-129212171 GCAGGGGGGTGAAGCTCAGGGGG - Exonic
1032525008 7:132573476-132573498 GAAGTGGGAGAGAGCTAAAGGGG - Intronic
1032552577 7:132798641-132798663 GCAGGGGGAAGGAGGTGAGGAGG + Intronic
1034266301 7:149782698-149782720 GCAGGGGTAGGGAGCTCAGGTGG + Intergenic
1034357946 7:150468133-150468155 GGAGTGGGATGGAGAGAAGCAGG - Intronic
1036653810 8:10662739-10662761 GGACTGGGATGGAGGAAAGGCGG - Intronic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1038745891 8:30254398-30254420 GGAGGTGGATGGAGCTCAGGCGG + Intergenic
1039776790 8:40745024-40745046 GCAGAGGCATGAAGCCAAGGGGG + Intronic
1039920523 8:41891048-41891070 GCAATGGGGTGGGGGTAAGGAGG + Intronic
1040439111 8:47422739-47422761 GCAGAGGGGTGGAGCCAAGATGG - Intronic
1043377637 8:79668254-79668276 GGGCTGGGATAGAGCTAAGGTGG + Intergenic
1044907781 8:97023787-97023809 GCAGTGGGAGGGATCTCAAGAGG - Intronic
1047641535 8:126826468-126826490 GGCGTGGGATGGAGGTAGGGAGG + Intergenic
1048578115 8:135708918-135708940 GAAGTTGGGTGGAGCTGAGGAGG + Intergenic
1048580958 8:135729467-135729489 GCTGTGGGGTGGAGCCAGGGTGG + Intergenic
1050153597 9:2642347-2642369 GCAGTGGTATTGACCTCAGGAGG - Intronic
1051314708 9:15817205-15817227 ACAGTGGGGTGGAGCCAAGATGG + Intronic
1052783196 9:32802080-32802102 GCAGGAGGCTGGAGCTCAGGTGG + Intergenic
1053039516 9:34857739-34857761 TCAGGGGGATGGGGCAAAGGCGG - Intergenic
1053206246 9:36188853-36188875 GCAGAGGTATGGAGCTGAGTGGG - Intergenic
1053305950 9:36985083-36985105 GCAGTGGAATGGGTCTAAGCTGG - Intronic
1055760859 9:79605931-79605953 GCAGTGGAAGGGAGGTATGGGGG + Intronic
1056852464 9:90096003-90096025 GCAGTGGGACAGAGCTAGGGAGG - Intergenic
1057189273 9:93077391-93077413 TCAGTGGGTAGGAGCCAAGGAGG + Intronic
1061181739 9:129028407-129028429 GCAGTGGGGCGGAGCTAGAGGGG + Intergenic
1061392487 9:130325597-130325619 GCAGTGGGATGGATTCTAGGTGG - Intronic
1062003242 9:134227181-134227203 GCAGGGGGATGGTGCTGGGGGGG + Intergenic
1188533462 X:31168055-31168077 GCAGTGTGATGGAGGATAGGTGG + Intronic
1189259745 X:39669933-39669955 GTAGTGGGATGGGGCTTGGGAGG - Intergenic
1191003599 X:55687166-55687188 GCATTGGGAAGGAGCCAAGATGG - Intergenic
1192142617 X:68658788-68658810 CCAGAGGGATGGAGTTGAGGAGG - Intronic
1192849181 X:74935996-74936018 GTTATGGGATGGAGCTCAGGTGG + Intergenic
1194647106 X:96471373-96471395 GCACTGGGATTCAGCTAAGCAGG + Intergenic
1196070269 X:111513180-111513202 GATGTGGGATGGAGATAAGATGG - Intergenic
1196975312 X:121152381-121152403 GCAGTAGGATGGAAATCAGGGGG + Intergenic
1198388216 X:136147928-136147950 GCAGTGGGGTGGAGGTGGGGGGG + Intronic