ID: 927492691

View in Genome Browser
Species Human (GRCh38)
Location 2:23531073-23531095
Sequence CTCTACCTCACTGTGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927492691_927492699 2 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492699 2:23531098-23531120 GGTAAGCTGGGACTGTATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 132
927492691_927492697 -10 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492697 2:23531086-23531108 TGAGGTAGAGGGGGTAAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 195
927492691_927492700 8 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492700 2:23531104-23531126 CTGGGACTGTATCTGGGACTCGG 0: 1
1: 0
2: 1
3: 32
4: 319
927492691_927492698 1 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492698 2:23531097-23531119 GGGTAAGCTGGGACTGTATCTGG 0: 1
1: 0
2: 1
3: 6
4: 105
927492691_927492701 19 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492701 2:23531115-23531137 TCTGGGACTCGGCAGAAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927492691 Original CRISPR CTCTACCTCACTGTGCATCC AGG (reversed) Intronic