ID: 927492701

View in Genome Browser
Species Human (GRCh38)
Location 2:23531115-23531137
Sequence TCTGGGACTCGGCAGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927492691_927492701 19 Left 927492691 2:23531073-23531095 CCTGGATGCACAGTGAGGTAGAG 0: 1
1: 0
2: 1
3: 33
4: 199
Right 927492701 2:23531115-23531137 TCTGGGACTCGGCAGAAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927492701 Original CRISPR TCTGGGACTCGGCAGAAGCC TGG Intronic