ID: 927493736

View in Genome Browser
Species Human (GRCh38)
Location 2:23538132-23538154
Sequence ATCCTAGTTCTGCTACTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 19, 3: 87, 4: 427}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927493736_927493741 20 Left 927493736 2:23538132-23538154 CCAATAAGTAGCAGAACTAGGAT 0: 1
1: 1
2: 19
3: 87
4: 427
Right 927493741 2:23538175-23538197 CTCGTAGTCCAGGATTCCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 81
927493736_927493740 10 Left 927493736 2:23538132-23538154 CCAATAAGTAGCAGAACTAGGAT 0: 1
1: 1
2: 19
3: 87
4: 427
Right 927493740 2:23538165-23538187 TTTCTCTTGACTCGTAGTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927493736 Original CRISPR ATCCTAGTTCTGCTACTTAT TGG (reversed) Intronic
900512112 1:3065656-3065678 ATGGTAGTTCTGCTACTCAATGG + Intergenic
900835591 1:5000987-5001009 TTCCTAATTTTGCTACTTAGAGG - Intergenic
900865835 1:5268000-5268022 ATCCTAGTTCTGACACTTGCAGG + Intergenic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902181757 1:14694667-14694689 AGCCTGACTCTGCTACTTATAGG + Intronic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903004342 1:20288843-20288865 ATCCCAGCTCTGCCACTTCTTGG + Intergenic
903141014 1:21339174-21339196 GTTCTAGTTCTGCTACTGATTGG + Intronic
903630881 1:24769479-24769501 ATCACAGTACTGCTACTTACTGG - Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904111056 1:28126464-28126486 ATCCCAGGTCAGCTACTTCTTGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
906261818 1:44397948-44397970 ATCCTATTTCAACCACTTATTGG - Intergenic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906706230 1:47896741-47896763 ATCCTGGTACTGCCACTTCTTGG + Intronic
906780775 1:48571214-48571236 ATCCTAGTTTTGCCACTTCCAGG - Intronic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907376138 1:54042739-54042761 AGCTTAATTCTGTTACTTATTGG + Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
908025767 1:59950193-59950215 ATCCTGTTTCTCCTACTCATTGG - Intergenic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908471719 1:64450762-64450784 TTCCAGGTTCTGCTCCTTATAGG - Intergenic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
908833965 1:68209877-68209899 ACCCCAGTTCAGCCACTTATTGG - Intronic
910259606 1:85282894-85282916 ATCCCGGTTCTGCTACTTGGTGG - Intergenic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
912247252 1:107972490-107972512 ATGCTAGCTTTGCTACTTATTGG - Intergenic
912390608 1:109300143-109300165 ATCCTTGTTCTGGTGCTTACAGG - Intronic
912519630 1:110236320-110236342 ATCCCAGCTTTGCTACTTAATGG - Intronic
913278569 1:117163262-117163284 GTCCCAGCTCTGCCACTTATTGG + Intronic
914232984 1:145781728-145781750 ATCCTGTGTCTGCCACTTATTGG - Intronic
914877260 1:151521391-151521413 ATCCTGGTTCTGTTACTTGTTGG + Intronic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
915701400 1:157800303-157800325 GTCCTAGATCTGGTACTAATTGG - Intronic
915842121 1:159222339-159222361 ATCCCAACTCTGCTACTTATTGG + Intergenic
915938814 1:160105437-160105459 ATCCTAGGTCTACCACTAATTGG - Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916193702 1:162203668-162203690 ATCCCAGTTCTGCCACTCTTAGG + Intronic
916382267 1:164225296-164225318 ATCTCAGTTCTGCCACTTAATGG + Intergenic
916900008 1:169211691-169211713 ATCCCAGTTATGATACTTAATGG + Intronic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918150685 1:181795867-181795889 GTCCCAGTTCTGCCACTTAATGG - Intronic
918712873 1:187752828-187752850 ATCCAAGTTCTGACACTTACAGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919438550 1:197596010-197596032 ATCCCAGCTTTGCCACTTATTGG - Intronic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
919823470 1:201487561-201487583 ATCCTAGTTTTGCCATTTATTGG - Intronic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
921639823 1:217539552-217539574 ATCATAGGTCTGCTACTGAGGGG - Intronic
922691865 1:227699399-227699421 TTCCTAGATCGGCTACTTGTAGG + Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
923839281 1:237650581-237650603 ATTCTAGCACTTCTACTTATAGG - Intronic
923872154 1:238007273-238007295 ACTCTGGTTTTGCTACTTATGGG - Intergenic
924820776 1:247488162-247488184 TTCCAAGCTCTGCTACTTAAAGG + Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1067197363 10:44133640-44133662 ATCATGGCTCTGCCACTTATTGG - Intergenic
1068581464 10:58745261-58745283 ATGCTGGTTCCGCCACTTATTGG + Intronic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1069881466 10:71596350-71596372 ATCCTGGCTCTGCCACTTCTTGG - Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1070325864 10:75388578-75388600 ATCCCAGCTCTGCTACTTCTTGG + Intergenic
1070390534 10:75966751-75966773 ATCATGGCTCTGCTATTTATTGG + Intronic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1071873079 10:89816218-89816240 ATCCTAGATCTACTGCTTACTGG - Intergenic
1072595103 10:96864194-96864216 ATCCTCATTCTTCTACCTATTGG - Intronic
1073565972 10:104535998-104536020 ATCCTTGCTCTGTTACTTCTAGG + Intergenic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1074405338 10:113176516-113176538 ATCCCAGATCTGCCACTTTTTGG - Intergenic
1074551041 10:114442653-114442675 ATCCTAGTCTTGCTAGTTATTGG + Intronic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1075069362 10:119310567-119310589 TTTCCAGTTCTGCTACTTCTTGG + Intronic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1077692603 11:4360421-4360443 ATACTAGTTCTAATAGTTATTGG - Intergenic
1078873731 11:15373165-15373187 ATCCTAATTCTGCCACTGATTGG - Intergenic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079697668 11:23503083-23503105 ATCCCAGCTTTGCCACTTATTGG + Intergenic
1079721777 11:23824874-23824896 ATCCCAGTTCTACCACTTGTTGG + Intergenic
1079932047 11:26576178-26576200 ATCCTGGTTTTGCCACTTAATGG + Intronic
1080088139 11:28311164-28311186 ATCATTGTTTTGCTACTTAATGG + Intronic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080580747 11:33641683-33641705 ATCTCAGTCCTGCTAATTATGGG + Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1081954772 11:47081508-47081530 ATCTGAGCTCTGCCACTTATTGG - Intronic
1082864351 11:57884982-57885004 ATCCTGGTTCTGATATTTATTGG + Intergenic
1084033847 11:66496132-66496154 ATCCTGGCTCTGCCACTTAGTGG - Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085840854 11:80010174-80010196 ATCCTGGCTCTGCCACTTAGAGG + Intergenic
1086048007 11:82555782-82555804 ATTCTAGTCCTGCTACTTGCTGG - Intergenic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1087008184 11:93489154-93489176 ATCCTAGTTCTGCCGTTTATCGG + Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088050116 11:105502977-105502999 ATCCAAGTTCTACCATTTATAGG - Intergenic
1088148645 11:106716436-106716458 ATCCTGGCTCTACTACTTAACGG + Intronic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088609720 11:111565493-111565515 GTCCTATTACTGCTACTTACTGG + Intergenic
1088699379 11:112398333-112398355 CTCTTGGTTCTGCTGCTTATTGG + Intergenic
1088720056 11:112584408-112584430 GACCTAGTTCTGCTCCTTGTGGG + Intergenic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089372372 11:117970590-117970612 ATCTCACTTCTGCTACTTACTGG - Intergenic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1089881739 11:121780640-121780662 ATCCTAATTCTGCTCCTCAGGGG + Intergenic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1091168873 11:133503182-133503204 AACCTAACTCTGCTACTTAAAGG - Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1091914208 12:4256505-4256527 ATCCTGGCTCTACCACTTATTGG - Intergenic
1092119292 12:6032672-6032694 ATCTTGATTCTGCCACTTATTGG + Intronic
1092158443 12:6300826-6300848 ATCTTGGTTTTGCTGCTTATGGG - Intergenic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1094764963 12:33583839-33583861 ATACAAGTTCTGCTACTTACTGG - Intergenic
1096590205 12:52653237-52653259 GTCCCAGTTTTGCTATTTATTGG + Intergenic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097330342 12:58326224-58326246 GTCCCAGCTCTGCTACTTGTTGG + Intergenic
1097840956 12:64320675-64320697 ATCCTGGCTCTGCCACTTAATGG + Intronic
1097847082 12:64377946-64377968 ATTCTGGTTCTGCCACTTAATGG + Intronic
1099087705 12:78265976-78265998 ATCCAAGTTCTGTAACTTATTGG + Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100366933 12:93930272-93930294 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1101792194 12:107937806-107937828 ATCCCAGTTCTGCCATTTAATGG - Intergenic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102434708 12:112912025-112912047 ATTTTACTTCTGCTACTTATTGG - Intronic
1102823246 12:115925879-115925901 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1103236121 12:119374146-119374168 ATCCCAGCTCTGCCACTTAATGG + Intronic
1103715373 12:122942135-122942157 ATCCTGGCTCTGCCACTTCTAGG - Intronic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1108801656 13:54104151-54104173 ATCATTGTTCGGTTACTTATTGG + Intergenic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1111187894 13:84764704-84764726 CTCTGAGTTCTGCTACTTACTGG - Intergenic
1112481294 13:99777900-99777922 ATCTTGGTTCTGCTATTTAATGG - Intronic
1112867301 13:103920622-103920644 ATCAGAATTCTGCTCCTTATTGG + Intergenic
1113287980 13:108874578-108874600 ATGCTAGCTCTGCCACTCATGGG - Intronic
1113336027 13:109376777-109376799 ATTCTATTGCTGGTACTTATTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1116474622 14:45325659-45325681 CTCCCAGTTATGCTACTTGTGGG + Intergenic
1117832743 14:59769050-59769072 ATTCTTCTTCAGCTACTTATAGG - Intronic
1117903101 14:60555959-60555981 GTCCTAGTTCTGGTACTTGCAGG + Intergenic
1118264486 14:64281376-64281398 ATCAAAGTTCTGCTAATTTTTGG - Intronic
1118372108 14:65146085-65146107 ATCCTGCCTCTGCCACTTATTGG - Intergenic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118760429 14:68877678-68877700 ATCCCAGTTCTGCTGCTTCCTGG - Intronic
1118928610 14:70217819-70217841 ATCTAAGCTCTGCTACTTATTGG - Intergenic
1119277829 14:73375406-73375428 ATTCCAGCTCTGCTACTTAGAGG - Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1119862234 14:77944513-77944535 ATCCTAGTTCTACTACCACTGGG + Intergenic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120391860 14:83918800-83918822 ATTCTAGTTCTCATGCTTATGGG + Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121844029 14:97157721-97157743 ATCCCATTTCTGCTACTTCCTGG + Intergenic
1122139832 14:99656327-99656349 ATCCCAGCTCTGCTACCTGTGGG + Intronic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125859039 15:42980403-42980425 ATATTAGTTCTACTTCTTATTGG + Intronic
1126222090 15:46225823-46225845 TACCTAGTTCTGCTAGTTCTAGG - Intergenic
1126669033 15:51099540-51099562 ATCCTGGTGCTGCTATTTAAAGG - Intronic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128366043 15:67003942-67003964 ATCCCAGTTCTGCCGCTTATTGG + Intergenic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128616849 15:69117013-69117035 ATCCTGGTTCTGCCCATTATTGG + Intergenic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1128692106 15:69732559-69732581 ATCCTGGTGCTGTTACTAATGGG + Intergenic
1129262411 15:74375983-74376005 ATCCCAGATTTGCTTCTTATTGG - Intergenic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129490381 15:75919494-75919516 ACTCTAGTTCTGCTACTTTCTGG + Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129748222 15:78039849-78039871 ATCCCAGTCCTGCTACTTATTGG - Intronic
1130745690 15:86651498-86651520 ATTCCAGCACTGCTACTTATTGG + Intronic
1130904358 15:88229320-88229342 ATCCTAGTTCTCCTGCTCATGGG - Intronic
1131409173 15:92191918-92191940 ATCCTCATTCTGCTAAATATTGG + Intergenic
1131452401 15:92554606-92554628 TTCCTACTTCTGCTAGTTTTGGG - Intergenic
1131687787 15:94789128-94789150 ATCATGGTTCTGCTAATTCTTGG + Intergenic
1131857818 15:96617394-96617416 ATCCTAGTTCTGGTACAAATGGG + Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1133699094 16:8292433-8292455 ATTCTGGCTCTGCCACTTATTGG + Intergenic
1133709391 16:8386596-8386618 ATCCTGGTTCTGTCCCTTATTGG + Intergenic
1134305088 16:13024637-13024659 ATCTTATTTTTGCCACTTATGGG + Intronic
1134612033 16:15616997-15617019 GCCCTAGTTCTGCTTTTTATAGG - Intronic
1134617837 16:15665355-15665377 ATTCCAGCTCTGCTACTTATTGG - Intronic
1134679476 16:16114132-16114154 ATCCCAGTTCTGCTTCTGCTAGG + Intronic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135484402 16:22851427-22851449 ATTCTAGTTTTGCCAATTATTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1136017061 16:27407152-27407174 ATTCTTCTTCAGCTACTTATGGG + Intronic
1136018761 16:27426192-27426214 ATCCCAGCTCTGCCACTTATAGG - Intronic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1138166304 16:54804843-54804865 ATCCCAGCTCTGCCACTTGTTGG + Intergenic
1138190234 16:55008757-55008779 ATCCCAACTCTGCCACTTATGGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138542220 16:57695330-57695352 ATCCCAGACCTGCTACTTACTGG + Intronic
1140545885 16:75808542-75808564 ATCCTAGCTTTGCCAATTATTGG + Intergenic
1142928103 17:3258910-3258932 TTCCTAGTTCTACTACTAATGGG - Intergenic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1144085302 17:11802937-11802959 ATCCTTGTTCTGCCACAAATTGG + Intronic
1144116476 17:12097755-12097777 ATCCCATCTCTGCTACTTGTTGG - Intronic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1144959211 17:19035474-19035496 ATGCTAGTTCTGCCACTTCCTGG - Intronic
1144975948 17:19139050-19139072 ATGCTAGTTCTGCCACTTCCTGG + Intronic
1145967875 17:28933424-28933446 GTTCCAGTTCTGCTACTTAGTGG - Intronic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146541330 17:33698261-33698283 ATCCCAGTTCTACTTCATATGGG + Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147266759 17:39238960-39238982 ATCTCAGTTCTGCTACTTGCTGG - Intergenic
1148354562 17:46967246-46967268 ATCCCAGCTCTGCCACTTATTGG + Intronic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1149089403 17:52760539-52760561 ATCTTGACTCTGCTACTTATTGG + Intergenic
1149606388 17:57927950-57927972 ATCCTTCCTCTGCTACTTGTGGG - Intronic
1149712785 17:58757364-58757386 ATCCCAGTTCTGGTTTTTATAGG + Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1153652325 18:7252137-7252159 ATTCCAGTTCTGCTAATTTTTGG + Intergenic
1155674372 18:28411651-28411673 ATGCTAAATCTGCTACTTATTGG - Intergenic
1157676494 18:49572478-49572500 GTCCCAGCTCTGCTACTTATAGG - Intronic
1157802054 18:50628664-50628686 GCCCTAGTTCTGCTCCTGATGGG - Intronic
1158268494 18:55686487-55686509 GTCCTAGTTCTGTTACTAACTGG - Intergenic
1158514576 18:58120317-58120339 GTCCTGGTTCTGCTATTCATTGG + Intronic
1158535377 18:58303822-58303844 ATCCTAGTCCTGCCACTTTCTGG + Intronic
1159001111 18:62975942-62975964 ATCTTAGCTCTGCCACTTGTAGG + Intronic
1159380777 18:67655602-67655624 ATTCTAGTTCTGATGCTTACTGG + Intergenic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1164132268 19:22374980-22375002 ATCCCAGTTCGGCCACTTAACGG - Intergenic
1164186463 19:22873349-22873371 ATCTCAGTTCTGCTATTTATGGG + Intergenic
1164217727 19:23164290-23164312 ATCTCAGTTCTCCCACTTATGGG + Intergenic
1164867110 19:31613848-31613870 ATCCTACTTCTGCCATTTATTGG - Intergenic
1165744919 19:38224809-38224831 ATCCTAGCTCTGCCACTTGGTGG + Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167135926 19:47615508-47615530 ATCCCAGTTCTGCTATTTGCTGG + Intronic
1167564623 19:50248655-50248677 ATCCCAGCTCTGCCACTTAGGGG - Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1167812971 19:51851332-51851354 AATCTATTTCTGCTACTCATTGG - Intergenic
925995159 2:9286713-9286735 ATCCTAATTCAGCTATATATAGG - Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927219363 2:20693041-20693063 ATCTTGGTTCTGCCATTTATTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
928497926 2:31853481-31853503 ATACTGGTTCAGCCACTTATCGG + Intergenic
928959163 2:36905825-36905847 ATTTTAGTTCTGCTACTCTTAGG - Intronic
930011760 2:46942700-46942722 ATCCTGGTTCCACAACTTATTGG - Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
930798042 2:55413467-55413489 GTTCTAGCTGTGCTACTTATTGG - Intronic
932060035 2:68487397-68487419 ATCCTGGCCCTACTACTTATTGG + Intronic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
935495804 2:103780242-103780264 ATCCTAATTCTGTCACTTACTGG - Intergenic
936066128 2:109333726-109333748 ATCCCAGCTCTGCCACGTATTGG + Intronic
938100881 2:128497535-128497557 ATCCTAGGCCTGCTTCTTATCGG + Intergenic
939647390 2:144717349-144717371 ATCAGAGATCTGCTACTTTTAGG + Intergenic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941262182 2:163311274-163311296 ATCCTAGTTCTACCACTCGTTGG - Intergenic
942244291 2:173992733-173992755 GTCCTACTTCTACTCCTTATAGG + Intergenic
942297991 2:174535772-174535794 ATCCCTGTTCTGCCACTTAATGG - Intergenic
943995354 2:194757496-194757518 ATTCTAATTCTGTTAATTATGGG - Intergenic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
945323278 2:208452155-208452177 AGGCTTGTTCTGCTACTTCTTGG + Intronic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
945993561 2:216416647-216416669 ATCCCAGTTGTACAACTTATTGG - Intronic
946521882 2:220474745-220474767 ATCCCAGTTCTGCCACTAATCGG - Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
946915148 2:224511833-224511855 ATACTTGTTCTGCTATTTTTTGG - Intronic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
948136255 2:235638642-235638664 CTCCTAGTTCTCCTACTAATTGG - Intronic
1169096392 20:2902947-2902969 ATCCCATCTCTGCTACTTTTTGG + Intronic
1169303350 20:4465936-4465958 ATCCTAGATCTTCTGCTTCTTGG + Intergenic
1169727205 20:8748361-8748383 ACCCTAGTTCTTCAACTCATTGG - Intronic
1169758298 20:9066668-9066690 AGCCTAGTGATGCTACTTCTTGG + Intergenic
1169866041 20:10201219-10201241 TTTCTAATTCTGCTATTTATTGG + Intergenic
1170430513 20:16271832-16271854 ATACTAGTTTTCCTCCTTATAGG + Intergenic
1171011869 20:21513391-21513413 AGCCAAGTTTTGCTACTTACGGG + Exonic
1171244407 20:23599659-23599681 GTCTCAGTTCTGCTATTTATTGG + Intergenic
1172040632 20:32042297-32042319 ATCCCAGCTCTGGCACTTATTGG + Intergenic
1172189859 20:33055400-33055422 TTCCTCCTTCTGCTCCTTATAGG + Intergenic
1172373163 20:34412028-34412050 ATTACAGTTCTGCTACTTACTGG + Intronic
1172588003 20:36098280-36098302 GTCCTAGGTCTGCTACTCAAAGG + Intronic
1172970174 20:38867429-38867451 ATCCTAGCTCTGTTGCCTATTGG + Intronic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173075606 20:39816246-39816268 ACCTTAGTGCTGCTAATTATTGG + Intergenic
1173192941 20:40889978-40890000 ATCCCAGCTCTGCTAGTTAGTGG - Intergenic
1173406488 20:42770835-42770857 ATTCTAGTTCTGGAACTTTTAGG + Intronic
1173894494 20:46540427-46540449 ATCCTGGCTCTGCGGCTTATTGG + Intergenic
1173968035 20:47128678-47128700 ATCCCAGCTCTGCCACTTATTGG + Intronic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1175500582 20:59447503-59447525 ATCCCAGTGCTGCCACTTATTGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178331132 21:31692754-31692776 ATCCTAGTTCTGCTGTTCATTGG - Intronic
1179119141 21:38526938-38526960 ATCCCAGTTCTGCAAGTAATGGG + Intronic
1181531209 22:23518542-23518564 ATCCCAGTTCTTCTGCTAATTGG + Intergenic
1181623752 22:24108211-24108233 ATCCCAGATCTGCCACTTAGGGG - Intronic
1182640885 22:31766445-31766467 ATCAGAGTTCTGCTACTGAATGG + Intronic
1182779859 22:32858890-32858912 AGTCTAATTCTGCTACTTACTGG + Intronic
1182787808 22:32922269-32922291 ATCCTAGCTTTGCCACTTATTGG + Intronic
1182937821 22:34242705-34242727 ATCCCAGTTCTGCCAATTGTGGG - Intergenic
1182968194 22:34544001-34544023 ATCATATTTCTGGAACTTATAGG - Intergenic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1184349891 22:43936593-43936615 ATCCTGGCTCTGCTATGTATTGG + Intronic
949382765 3:3464410-3464432 ATTCCAGCTCTGCTACTTCTTGG + Intergenic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
951985042 3:28610011-28610033 AACCTAAGACTGCTACTTATTGG - Intergenic
952553801 3:34508869-34508891 TTTCTAGCTCTGCTACTTCTTGG - Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
954837558 3:53483069-53483091 ATCTTAGTTCTGCCATGTATTGG + Intergenic
955825562 3:62943191-62943213 ATCCCAGTTCTGCCATTTATTGG + Intergenic
955941730 3:64152462-64152484 ATCTCAGATCTGCCACTTATTGG + Intronic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
956893338 3:73634831-73634853 ATCCTGATTCTACTACCTATTGG + Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
957128627 3:76195703-76195725 ATCCTTATTCTTCTCCTTATTGG - Intronic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
958709447 3:97699518-97699540 ATCCTAGCTCCACAACTTATGGG - Intronic
959177868 3:102939509-102939531 AGCCTAGTTCTGTTACTTTAAGG - Intergenic
959406406 3:105966556-105966578 CTCCTAGTACTGCTACTGGTCGG - Intergenic
960034425 3:113088203-113088225 ATCCTGGCTCTGCCATTTATTGG - Intergenic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960614184 3:119581868-119581890 ATCCCAGCCCTGCCACTTATTGG + Intronic
960945045 3:122960479-122960501 ATCCTACTTCTGGTTCTTGTGGG - Intronic
960987595 3:123290831-123290853 ACCCCAGCTCTGCCACTTATTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
961837983 3:129680470-129680492 ATCCTGACTCTGCTGCTTATTGG - Intronic
962889876 3:139662285-139662307 ATCCTGGTTCTGTCACTGATGGG + Intronic
963284539 3:143420434-143420456 ATCCTAGTTCTGCCTCATCTTGG + Intronic
964222271 3:154360553-154360575 ATTCCAGTTCTACCACTTATTGG - Intronic
964444561 3:156745086-156745108 ATCCTAGTTCTGCCATTAAATGG - Intergenic
964557924 3:157961252-157961274 ATCCTAGTTCTGATTCTGACAGG + Intergenic
964558354 3:157965529-157965551 ATCCTGGCTCTGCTGCTTAAGGG + Intergenic
965677891 3:171218180-171218202 ATCCTAGTTCTGACACTTCATGG - Intronic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
965936120 3:174114965-174114987 ATCCAATTGCTGCTCCTTATTGG - Intronic
966054641 3:175670173-175670195 ATCCTAGTTTTGCTACTTTCTGG - Intronic
966113556 3:176432933-176432955 ATCATAGCTCTGCCACTTAGGGG - Intergenic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
966571668 3:181450964-181450986 ATCCCAACTCTGCCACTTATTGG + Intergenic
966598929 3:181755565-181755587 ATTCTAGTTCTTCCACTTGTTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
970394369 4:15651251-15651273 TTACTAGTTCTGCTACTTATTGG - Intronic
970799468 4:19954930-19954952 CTCCTTGTTCTGGTACTTCTTGG - Intergenic
971140126 4:23915983-23916005 ATCCTGGCTCTGCCATTTATAGG + Intergenic
971959464 4:33467196-33467218 ACCCTAGCTCTTCTCCTTATTGG + Intergenic
972156923 4:36174789-36174811 ATTCTTGTTCTGCTACTAATTGG - Intronic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
974240623 4:59241313-59241335 ATTGTAGGTCTGCCACTTATTGG - Intergenic
976003784 4:80402664-80402686 ATCCTACTTCTGCCTTTTATTGG - Intronic
976128613 4:81859737-81859759 ATCCCAGCTCTGCCACTTATTGG - Intronic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977145569 4:93435731-93435753 ATCCTGGTTCTTCCAGTTATTGG - Intronic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
978661075 4:111127075-111127097 ACCCTATTCCTGCTACTTTTGGG + Intergenic
978742230 4:112149540-112149562 GACCTAGTTCTTCTACTTCTAGG - Intronic
978944640 4:114480976-114480998 ATCATAATTCTTCTATTTATTGG + Intergenic
979411289 4:120383100-120383122 ATCCTGGTTCTGCCACTATTGGG - Intergenic
979672455 4:123374136-123374158 ATCCCAGTTTTGATACTTACTGG + Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982841536 4:160193972-160193994 ATCCTGGTTCTGCCACTTGGTGG + Intergenic
982943747 4:161591896-161591918 ATCCTAGCTCCGCTAATTAGAGG - Intronic
983514507 4:168642035-168642057 ATCCTGGCTGTGCTCCTTATGGG - Intronic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
987422543 5:17737526-17737548 CTCCGAGTTGTGCTACTTACCGG - Intergenic
989273385 5:39558137-39558159 ACCCTGGCTCTGCTATTTATTGG + Intergenic
990942986 5:61222235-61222257 ATCCTTGTTCTGCTACCTGCTGG + Intergenic
991401238 5:66253963-66253985 ATCCCAGCTCTGCCACTTAGGGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
992277161 5:75131728-75131750 CTCCTAGTTATGCTACTTGGGGG - Intronic
992359462 5:76022007-76022029 CTCCTTGTTCTGTTAATTATAGG - Intergenic
993961241 5:94298777-94298799 ATCCCACTGCTGCTACTTTTTGG - Intronic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
998166880 5:139849215-139849237 ATCCCAGCTCTGCCACTTCTTGG - Intronic
998841013 5:146253814-146253836 ATCCTAGTTGTGCTGCTTATTGG + Intronic
998998387 5:147892515-147892537 ATCCTCTTTCTGTCACTTATTGG + Intronic
999385323 5:151150172-151150194 CTCCTAGTTCTGTTCCTTTTAGG - Intronic
999674549 5:153985994-153986016 ATCCTGGTTCTACCACTTGTTGG + Intergenic
1000011314 5:157235902-157235924 ATGCTAAGTTTGCTACTTATTGG - Intronic
1000106954 5:158068862-158068884 ATCCCGGCTCTGCCACTTATTGG - Intergenic
1000246822 5:159455062-159455084 ATCCCAGTTCTGCCATTTTTTGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1001833733 5:174811866-174811888 ATCCTCCTTCTGCCACTTATGGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1003448788 6:6211088-6211110 ATTCAGGTTCTGCCACTTATTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004316314 6:14591212-14591234 ATCCTGCCTCTGCTACTTATTGG + Intergenic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1005466833 6:26123937-26123959 AGCGGATTTCTGCTACTTATAGG + Intergenic
1006838614 6:37014312-37014334 ATCCCAGTTCTGCTACTCTCTGG - Intronic
1008389641 6:50935157-50935179 ATCCTAATTCTTCCACTTAATGG - Intergenic
1008455407 6:51705183-51705205 CTCCTGGTTCTTCTACTTCTCGG - Intronic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010499827 6:76584011-76584033 GTCCTAACTCTGCTACTTATTGG - Intergenic
1010704959 6:79096756-79096778 ATACTAGTCCTGCAACTCATGGG + Intergenic
1011361762 6:86533624-86533646 ATCTTAGTTCTTCTACTGAGTGG + Intergenic
1011742006 6:90371351-90371373 GCCCTGGTTCTGCGACTTATTGG - Intergenic
1011973286 6:93256553-93256575 TTCTTAGTTTTGCTACTGATAGG + Intronic
1013138964 6:107311713-107311735 ATCTTAGATCTGCTACTTTATGG + Intronic
1013260498 6:108436714-108436736 ATCCTGGTTCTGTCACTTTTGGG + Intronic
1015313342 6:131789519-131789541 ATCCTACTCCTGCTACAGATTGG + Intergenic
1015498773 6:133908697-133908719 ATCCAAGATCTCCTATTTATAGG + Intergenic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1015943380 6:138474636-138474658 ATACTACTTCAGTTACTTATAGG + Intronic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1016584533 6:145668637-145668659 ATGGCAGTTCTGCTACTTATTGG + Intronic
1016708491 6:147142104-147142126 ACCTTAGTTCTGCAACTTAATGG - Intergenic
1017058713 6:150460706-150460728 GTCCTGGCTCTGCTACTTATGGG - Intergenic
1017698310 6:157041696-157041718 ATCCCAGTTCTGTTACTGATTGG - Intronic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1018784153 6:167094892-167094914 ATCCTAGTTCTGTTAACAATTGG + Intergenic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021936826 7:25639310-25639332 ACCCTGGCTCTGCTGCTTATTGG + Intergenic
1022146424 7:27546562-27546584 AGCCTACTTCTGTTATTTATAGG - Intronic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022543830 7:31166596-31166618 ATCCTCTTTCTACAACTTATGGG - Intergenic
1022689963 7:32639512-32639534 ATGCTAGTTTTGCTGTTTATGGG - Intergenic
1022955686 7:35378074-35378096 ATCCCAGCTCAGCGACTTATTGG + Intergenic
1023473996 7:40556631-40556653 ATCCCAGTTCTACCACTTAGTGG + Intronic
1023640479 7:42251767-42251789 ATTCTAGTTTTGCCAATTATTGG - Intergenic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025110196 7:56210059-56210081 TTCCTACTGCTGCTACTAATAGG + Intergenic
1025225618 7:57158901-57158923 ATCCTGGTTCTGACACTTATGGG - Intergenic
1025267715 7:57478522-57478544 ATCCTGGTTCTGTCACTTATGGG + Intergenic
1025582873 7:62742197-62742219 CTCCTAGTTATGCTACTTGGGGG + Intergenic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1025820498 7:64958468-64958490 ATTCCAGTTCTGCCATTTATGGG - Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1028676030 7:93461631-93461653 ATCCAAGTGCTGCTGCTTCTTGG + Intronic
1028683511 7:93566455-93566477 CTCCTAATTCTGTTACTTACAGG + Intronic
1028850980 7:95537165-95537187 AATCTTATTCTGCTACTTATTGG + Intronic
1030275325 7:107714726-107714748 GTCCTCATTCTGCTACTTACTGG + Intronic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1034872935 7:154699769-154699791 TGCCTAGTTCTGCCCCTTATGGG + Intronic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039496105 8:37981593-37981615 AGCCTACTTCTTCTATTTATGGG + Intergenic
1039518231 8:38150658-38150680 ATCCTAGTTGTGCCTCTTACTGG - Intronic
1042325460 8:67523081-67523103 ATCCCAGCTCTGCCACTTGTAGG + Intronic
1043526094 8:81097952-81097974 ATCCAATTTCTGCAAATTATAGG - Intronic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044092668 8:88021738-88021760 ACCCAGGTTCTGCTACATATGGG - Intergenic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1044906672 8:97011595-97011617 ATCCTGGCTCTGACACTTATTGG + Intronic
1045238271 8:100375253-100375275 ATCCTACTTTTGCCACTTAGTGG - Intronic
1045943520 8:107767789-107767811 ATCCCAGCTTTGCTACTTATAGG - Intergenic
1046700724 8:117397740-117397762 ATACAAATTCTACTACTTATTGG + Intergenic
1046901541 8:119528912-119528934 AGCCAAGTTCTACTGCTTATAGG + Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1048999323 8:139814628-139814650 GTTCTAGCCCTGCTACTTATTGG - Intronic
1050164402 9:2748753-2748775 TTCCTAGTTCTGCTATTAATTGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050446425 9:5727966-5727988 CTCCCAGTTAGGCTACTTATGGG + Intronic
1051640566 9:19221069-19221091 AGCCTGGTTCTGCTTTTTATTGG - Intergenic
1052781756 9:32788788-32788810 ATACTAGTTCTGGTCCTGATGGG - Intergenic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1055122514 9:72678172-72678194 ATCTTGGTTATGCCACTTATTGG + Intronic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1057983741 9:99688397-99688419 ATTCTGGTTCTGCCACTTATTGG - Intergenic
1058106533 9:100978218-100978240 CTTCTAGTTCTGCTTCTTACTGG - Intergenic
1058418411 9:104811854-104811876 ATCCTGACTTTGCTACTTATTGG - Intronic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1061168943 9:128940914-128940936 ATCCACACTCTGCTACTTATGGG + Intronic
1061224664 9:129273932-129273954 GTCACAGCTCTGCTACTTATTGG + Intergenic
1061384557 9:130281246-130281268 ATCCCAGCACTGCCACTTATTGG + Intergenic
1061527242 9:131176238-131176260 GTCTGGGTTCTGCTACTTATTGG - Intronic
1186017723 X:5216966-5216988 AGCCTAGCTCTGTTTCTTATAGG - Intergenic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1187763175 X:22609882-22609904 CTCCTAGTTAGGCTACTCATGGG - Intergenic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1189167286 X:38872722-38872744 ATCCCAGCACTGCCACTTATTGG - Intergenic
1189604690 X:42664155-42664177 ATTTTAGCTCTGCTACTTCTAGG + Intergenic
1190172843 X:48125370-48125392 CTCCTGGTTCTTTTACTTATTGG + Intergenic
1190608688 X:52171484-52171506 CTCCTAGTTAGGCTACTTAGGGG - Intergenic
1191654564 X:63582024-63582046 ATCCTGGTTCTTCGACTTAGAGG + Intergenic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1192200384 X:69062798-69062820 GTCCTAGTGCTGCTATTTATTGG - Intergenic
1193722814 X:85006382-85006404 AACCTAGTTCTTCCACTTAGTGG - Intronic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196749460 X:119101836-119101858 ATCCTAGCTATACCACTTATTGG + Intronic
1196928838 X:120661063-120661085 ATCCTAGCTCTGCAACATATTGG - Intergenic
1197882257 X:131179131-131179153 AACCTAGTTCTCCTATTCATTGG + Intergenic
1197968781 X:132093503-132093525 AGCCTAGTCCAGCTACTTGTTGG + Intronic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1198637486 X:138715257-138715279 ATCCTATCTCTGCCACTAATTGG + Intronic
1198815339 X:140583961-140583983 TTCTTAGTTCTGCTATTTATTGG + Intergenic
1199907415 X:152247502-152247524 ATACCAGCTCTGCCACTTATTGG + Intronic