ID: 927495847

View in Genome Browser
Species Human (GRCh38)
Location 2:23551182-23551204
Sequence CAGCGTAAACTGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927495847 Original CRISPR CAGCGTAAACTGAGGGAAGA AGG (reversed) Intronic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902972416 1:20063402-20063424 CAGTGGAAACTGTGGGGAGAGGG + Intronic
903049377 1:20589397-20589419 CAGCGGAGACTGGGGGAAGAAGG - Intronic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
907011520 1:50968319-50968341 CAGCGTACGCTGCGGGAAGGCGG - Exonic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
908756757 1:67475851-67475873 CAGAATAAACTGGGGAAAGAAGG + Intergenic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
914877111 1:151520331-151520353 AAGGGTAAAATCAGGGAAGATGG - Intronic
916839917 1:168589037-168589059 CAGCTTATACTTTGGGAAGAAGG + Intergenic
919061386 1:192638300-192638322 CGGCTTAAACTGAAGGAAAAAGG - Intronic
919566903 1:199200198-199200220 ACGCGTTCACTGAGGGAAGAGGG - Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078905559 11:15684979-15685001 CAGAGTAAACTGGGGTAAAATGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087988506 11:104715961-104715983 CAGCACAAAATGGGGGAAGAGGG - Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1092848674 12:12607733-12607755 CATCCTAAACTTGGGGAAGAAGG - Intergenic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1100182713 12:92102864-92102886 CAGTTCAAACTGGGGGAAGAGGG + Intronic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1107022870 13:35769118-35769140 CAGCTTAAACTGAAGGATTAGGG + Intronic
1107342175 13:39419300-39419322 CAGCTTAAACTTAGGGACTAGGG - Intronic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1114151804 14:20048914-20048936 CACCTAAAAGTGAGGGAAGATGG + Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118917753 14:70122140-70122162 CAGAGAAAACTGGGGGACGAGGG + Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1126753077 15:51897189-51897211 CAGTGTAGACTGAGAAAAGAAGG - Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1129129362 15:73479050-73479072 CAGCATAATCTGTGGGAAGCGGG - Intronic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130013264 15:80168658-80168680 CAGCATAAGCTGAGACAAGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1139341432 16:66270412-66270434 AAGCGCAAACTGAGGCCAGAGGG + Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141473962 16:84259446-84259468 CAACCTCACCTGAGGGAAGAGGG + Intergenic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1148615408 17:48997101-48997123 CAGCCCAAACTGGGGGAGGATGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1155272656 18:24155861-24155883 CAGCATAAACTGATGGAAACTGG - Exonic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1163779934 19:19240735-19240757 AAGGGTAAACTGAGGCCAGATGG - Intronic
1165064117 19:33219230-33219252 CAGCGAAGGCTCAGGGAAGAGGG - Intronic
1165455233 19:35907016-35907038 CAGCTTAAAATGTGTGAAGAGGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167368000 19:49064828-49064850 CGGAGGAAACTGAGGCAAGAGGG - Intronic
925204722 2:1996320-1996342 CAGCCCACACTGAGGCAAGACGG - Intronic
925736141 2:6965548-6965570 AAGCGCAAACAGCGGGAAGATGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926341489 2:11908364-11908386 AAGAGGAAACTGAGGGTAGAGGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
929731181 2:44494414-44494436 GTACGTAAACAGAGGGAAGAGGG - Intronic
930733937 2:54756040-54756062 CAGCCTAAACTTAAGGAAGAGGG - Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935523232 2:104135489-104135511 CAAAGTAAATTTAGGGAAGATGG + Intergenic
938956490 2:136303666-136303688 CAGCCTAAACTGGGGGCAGGGGG - Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
943374331 2:187055860-187055882 CATGGAAAACTGAGGGAAGTGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1170197187 20:13701481-13701503 TAGAGTAAAATGATGGAAGAAGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171327739 20:24310581-24310603 CAGGGGAAACTGAGGAAAGGGGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1178238095 21:30867399-30867421 CCTCGGAAGCTGAGGGAAGAGGG + Intergenic
950396140 3:12735559-12735581 CAGCCTAAACTTCTGGAAGAGGG + Exonic
951958900 3:28292406-28292428 AAGGGTAAAATCAGGGAAGAAGG - Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956219890 3:66891249-66891271 TAGCAGAAACTGAGGGAAAATGG - Intergenic
958706385 3:97661971-97661993 CAGTATATACTGGGGGAAGAGGG - Intronic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959116496 3:102184469-102184491 GAGGGTAAACTGAGGCAAGTGGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
969227620 4:5809254-5809276 CAGAGTACACTGAGGTCAGAGGG - Intronic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
971680045 4:29686879-29686901 CAGCCTTAATTGAGGGAAAATGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
975543244 4:75535768-75535790 CAGCATAAACTGGGTAAAGATGG + Intronic
975727453 4:77305866-77305888 GAGGGGAAACTGAGGAAAGATGG + Intronic
976445090 4:85121112-85121134 CAGCCTAAACTGTGGCTAGAAGG + Intergenic
977941329 4:102862934-102862956 CTGCTTACACTGAGGGCAGAAGG + Intronic
978589182 4:110305480-110305502 CAGCTTACACTGAAGGAATACGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
981582569 4:146264830-146264852 CAGTGAAAACTGAGGGGAAAAGG - Intronic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
987480084 5:18442351-18442373 CACAGGAAACTGAGAGAAGATGG + Intergenic
987692665 5:21287426-21287448 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
990917458 5:60925498-60925520 CAGCTCAAACTGGGAGAAGATGG - Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
991747690 5:69762621-69762643 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991750039 5:69792703-69792725 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991799268 5:70342475-70342497 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991801612 5:70372508-70372530 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991826984 5:70637518-70637540 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991829329 5:70667561-70667583 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991891627 5:71341902-71341924 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
993687821 5:90961563-90961585 CGTAGTAAACTGAGGGAGGAGGG + Intronic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1001707729 5:173753821-173753843 CTGCGTCAACTGGGGGAAGGTGG - Intergenic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1007975712 6:46099131-46099153 CACACAAAACTGAGGGAAGAAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1012630004 6:101454080-101454102 TACCGTAGACTGAAGGAAGAAGG + Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1022957954 7:35398712-35398734 CAAGGTAAACGGTGGGAAGAAGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1026937487 7:74266748-74266770 CAGCTTAGAATGGGGGAAGAGGG + Intergenic
1027388456 7:77681522-77681544 CAGCCCAAACTGACTGAAGATGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1032196261 7:129790502-129790524 CAGCTTCAACTGAGGCCAGATGG + Intergenic
1034630496 7:152526807-152526829 CAGCTGAAACTGTGGAAAGAGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1040472480 8:47746124-47746146 CAACATAAAGTGTGGGAAGAGGG + Intergenic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1040652704 8:49466563-49466585 CAGGACAAAATGAGGGAAGAGGG + Intergenic
1042262199 8:66871083-66871105 AAGCGTTAAGTGAGGGAACAGGG - Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045521473 8:102906518-102906540 CAGCTAAAATTCAGGGAAGAAGG + Intronic
1048849843 8:138634500-138634522 CAGCCTACACTGAAGGCAGAGGG + Intronic
1051397091 9:16634843-16634865 CAGTGTACACTGAGGGGAGGGGG + Intronic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1056198597 9:84252703-84252725 CAGCCAAAACTTAGGGGAGATGG - Intergenic
1060627492 9:125126966-125126988 GAGATTATACTGAGGGAAGAAGG + Intronic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061615238 9:131774849-131774871 CGGCGGAGACTGAGGGAAGCTGG + Intergenic
1187348845 X:18493101-18493123 CAACATAAACTCATGGAAGAAGG - Intronic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1200235184 X:154464662-154464684 CATCGGGAACTGAAGGAAGAAGG - Intronic