ID: 927498457

View in Genome Browser
Species Human (GRCh38)
Location 2:23565886-23565908
Sequence GCGCACTGCCTAGCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927498457_927498465 3 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498465 2:23565912-23565934 GTGAACATCACGTGCCCTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 69
927498457_927498463 1 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498463 2:23565910-23565932 GGGTGAACATCACGTGCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 73
927498457_927498466 7 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498466 2:23565916-23565938 ACATCACGTGCCCTGGGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 116
927498457_927498464 2 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498464 2:23565911-23565933 GGTGAACATCACGTGCCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 115
927498457_927498467 8 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498467 2:23565917-23565939 CATCACGTGCCCTGGGGGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 256
927498457_927498462 0 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498462 2:23565909-23565931 AGGGTGAACATCACGTGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 106
927498457_927498468 9 Left 927498457 2:23565886-23565908 CCCCTCTTGGCTAGGCAGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 927498468 2:23565918-23565940 ATCACGTGCCCTGGGGGCTGGGG 0: 1
1: 1
2: 2
3: 20
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927498457 Original CRISPR GCGCACTGCCTAGCCAAGAG GGG (reversed) Intronic
901767900 1:11515512-11515534 GCGCACTGCCATGACAACAGAGG - Intronic
906699511 1:47847711-47847733 GTGCACAGCCCAGTCAAGAGGGG + Intronic
907392433 1:54167008-54167030 GCTCAGTGCCTAGCCCACAGGGG - Intronic
917078985 1:171237282-171237304 CCCCTCTGCCTAGCCAAGGGGGG + Intergenic
1064067837 10:12198251-12198273 GCTCACTGCCAACCCAAGAATGG + Intronic
1077035790 11:494000-494022 CTGCCCTGCCAAGCCAAGAGGGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079622042 11:22567043-22567065 GGGCACTGCCTAGTGAAGAGTGG + Intergenic
1080393815 11:31871868-31871890 ACACACTGCCTAGCCCAGAAAGG - Intronic
1084290244 11:68160524-68160546 GCACACTGCCCAACCAAGTGAGG + Intronic
1084495349 11:69500228-69500250 GCGCCCTGCCCTGCCAAGTGGGG - Intergenic
1085792590 11:79508685-79508707 TCGCAGTGACTAGCCAAGGGGGG - Intergenic
1089372363 11:117970474-117970496 GCCCACTGCCTAGCACACAGTGG + Intergenic
1091489985 12:924624-924646 TCACACTGCCTTGCCATGAGTGG - Intronic
1109228529 13:59726634-59726656 CCTCAATGCCTGGCCAAGAGGGG + Intronic
1111657874 13:91175238-91175260 GCGCAGTGCCCAGCCCCGAGGGG + Intergenic
1113413196 13:110108096-110108118 GGGCACAGCCTAGCGGAGAGTGG + Intergenic
1113500801 13:110772551-110772573 GAGCAAAGCATAGCCAAGAGAGG - Intergenic
1118133173 14:62990885-62990907 GAGAAGTGCCGAGCCAAGAGGGG + Intronic
1119149744 14:72347634-72347656 GAGCAGTGCCTGGCCCAGAGTGG + Intronic
1119752919 14:77093121-77093143 GGGGACTGCTTGGCCAAGAGGGG + Intergenic
1119866876 14:77981360-77981382 GCGCCCTGCCCTGCCGAGAGCGG - Intergenic
1129327408 15:74808221-74808243 GGGCACTGCCCAGCCAAAGGTGG + Intergenic
1132087731 15:98921850-98921872 CAGGACTGCCTGGCCAAGAGTGG + Intronic
1137587358 16:49671534-49671556 CCGCCCTGCATGGCCAAGAGTGG + Intronic
1139551629 16:67676328-67676350 GGGCCCTGCCTAGGCAACAGAGG - Intronic
1140891016 16:79285335-79285357 GGGCACTGTTTAGCCACGAGTGG + Intergenic
1143426129 17:6840007-6840029 GCGCTCAGCCTAGGCAACAGAGG - Intergenic
1148866741 17:50632771-50632793 GTGCACTGCCTGGCCAACTGTGG + Intergenic
1149475739 17:56959789-56959811 GCACAGTGCCTAGCTAAGCGCGG + Intronic
1153484739 18:5585682-5585704 GCACAGTGCCTAGCAAAGAAAGG - Intronic
1160128955 18:76206807-76206829 AAGCACTGACTATCCAAGAGAGG - Intergenic
1161595787 19:5150438-5150460 GCGCACTCACCAGCCGAGAGCGG - Exonic
1164557031 19:29261189-29261211 CCTCACTGCTTAGCAAAGAGTGG + Intergenic
1165388599 19:35526028-35526050 CTGCACTGCCCAGCCAGGAGAGG - Intronic
925579457 2:5395881-5395903 GCTGACAGCCTAGCCTAGAGAGG - Intergenic
927498457 2:23565886-23565908 GCGCACTGCCTAGCCAAGAGGGG - Intronic
927531224 2:23804386-23804408 GCAGACTGCCTATCCAGGAGGGG + Intronic
931146702 2:59527197-59527219 GAGGACTGCCAAGCCCAGAGTGG + Intergenic
934906227 2:98206722-98206744 CCTCACTCCCTAGCCAAGAGTGG + Intronic
942627985 2:177923879-177923901 GCGCAATACCTAGCACAGAGTGG + Intronic
946034647 2:216732134-216732156 GCGCAGTGCCTGGGCAGGAGGGG - Intergenic
1170589104 20:17757776-17757798 GCCCAGGGCCCAGCCAAGAGAGG + Intergenic
1171295796 20:24015833-24015855 GCCCACTCCCTATACAAGAGTGG + Intergenic
1173433981 20:43016242-43016264 GGGCACTGTGGAGCCAAGAGTGG + Intronic
1176668612 21:9711177-9711199 GAGAAGTGCCTAGCAAAGAGGGG - Intergenic
1180899386 22:19359591-19359613 GCAGACTGGCTGGCCAAGAGAGG + Intronic
1181923993 22:26343092-26343114 GGGCACTGCCCAGAAAAGAGCGG - Intronic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
958889810 3:99770920-99770942 GCGCACTGCCTTCGCCAGAGTGG + Intronic
961611724 3:128144872-128144894 GTGCTCTGCCTAGCCAGGTGTGG - Intronic
966489301 3:180509139-180509161 GCTCACTGTTTAGCAAAGAGGGG + Intergenic
968454434 4:689704-689726 GCGGACTGCCTACCCCAGGGTGG - Intergenic
996415587 5:123206855-123206877 GCCCACTCCCTAGCAAGGAGGGG - Intergenic
997564548 5:134876884-134876906 GCTGACTGCCTAGGGAAGAGTGG - Intronic
998447727 5:142211417-142211439 GCGCAGTGCCTGGCGCAGAGGGG + Intergenic
1002580555 5:180207640-180207662 GCGCACTGCCGGGGCAGGAGAGG - Intronic
1002664245 5:180810823-180810845 GGGCCCTGCCTCGTCAAGAGAGG - Intronic
1003520370 6:6853529-6853551 GCACCGTGCCTAGCCAAGACAGG - Intergenic
1005170530 6:22980230-22980252 CCCCACCCCCTAGCCAAGAGAGG + Intergenic
1007550108 6:42722583-42722605 GCGCCCTTCCCAGCCAAGAAGGG + Intergenic
1007781952 6:44259443-44259465 GGGCTCTGCCAAGCCCAGAGGGG - Intronic
1007843753 6:44737551-44737573 GTGCACTCGCTAGCTAAGAGAGG - Intergenic
1014184655 6:118421352-118421374 GTGAACTGCCTAGCCAAGCATGG - Intergenic
1023559596 7:41459907-41459929 GTGCCCTGCCCAGCCAACAGAGG + Intergenic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1032925532 7:136599755-136599777 GCTCATTGCCAAGCCAGGAGTGG + Intergenic
1037886914 8:22600108-22600130 GCCCACTTCCTTGCCCAGAGGGG + Intronic
1038531251 8:28319551-28319573 GCTCACTGCCTGGCACAGAGTGG - Intronic
1041183996 8:55279404-55279426 GCCCTCTGCCAAGCCGAGAGTGG - Intronic
1047981988 8:130192794-130192816 GAACACTGCCTAGCACAGAGAGG + Intronic
1060978498 9:127779140-127779162 GCGAAATGGCCAGCCAAGAGTGG - Intergenic
1203657255 Un_KI270753v1:9767-9789 GAGAAGTGCCTAGCAAAGAGGGG + Intergenic
1188921157 X:35979264-35979286 GCTCCGTGCCTGGCCAAGAGTGG + Intronic
1193318474 X:80092631-80092653 CCACACTGCTTAGCCAAGAGTGG + Intergenic