ID: 927500470

View in Genome Browser
Species Human (GRCh38)
Location 2:23579577-23579599
Sequence AAGTGGGACTGGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 586}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927500470_927500477 -5 Left 927500470 2:23579577-23579599 CCCTTTTCCCTCCAGTCCCACTT 0: 1
1: 0
2: 4
3: 58
4: 586
Right 927500477 2:23579595-23579617 CACTTCCACTGCCATAGTCCAGG 0: 1
1: 0
2: 1
3: 28
4: 242
927500470_927500484 18 Left 927500470 2:23579577-23579599 CCCTTTTCCCTCCAGTCCCACTT 0: 1
1: 0
2: 4
3: 58
4: 586
Right 927500484 2:23579618-23579640 CCCATCATATCTCACTTGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 110
927500470_927500481 16 Left 927500470 2:23579577-23579599 CCCTTTTCCCTCCAGTCCCACTT 0: 1
1: 0
2: 4
3: 58
4: 586
Right 927500481 2:23579616-23579638 GGCCCATCATATCTCACTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 84
927500470_927500482 17 Left 927500470 2:23579577-23579599 CCCTTTTCCCTCCAGTCCCACTT 0: 1
1: 0
2: 4
3: 58
4: 586
Right 927500482 2:23579617-23579639 GCCCATCATATCTCACTTGAGGG 0: 1
1: 0
2: 3
3: 31
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927500470 Original CRISPR AAGTGGGACTGGAGGGAAAA GGG (reversed) Intronic
900971624 1:5995211-5995233 GAGGGGGACTGGCGGGAACATGG - Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
901757457 1:11449920-11449942 AAGGGGGACTGAAGGGCACACGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
904731984 1:32600151-32600173 AAGTGGTACAGGAGGGAACCAGG + Exonic
904956768 1:34291096-34291118 AAGTGGGATTGGGGGAACAATGG + Intergenic
905854811 1:41302591-41302613 AAATGGGACAGGAGGGTCAATGG - Intergenic
905922937 1:41731106-41731128 AAGTGTGACTGCCGGGAAAAAGG + Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
908186537 1:61657784-61657806 TGGTGGGACTAGAGGGAAAGTGG + Intergenic
908218697 1:61981593-61981615 AAGTATGACTGGAGGACAAAAGG + Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
908841460 1:68284276-68284298 AAGTATGACTGGAGGACAAAAGG - Intergenic
910530046 1:88225524-88225546 AAATGGTACTAGAGGGATAAAGG - Intergenic
911123920 1:94322803-94322825 AATTGGGACGGGAGGGACAGAGG + Intergenic
911582287 1:99647859-99647881 AAGGTACACTGGAGGGAAAAAGG - Intronic
912118110 1:106432776-106432798 AAGTGGCATTGGAAAGAAAAAGG + Intergenic
913162510 1:116157073-116157095 AGGTGGGAGTGGAGGGGCAAGGG - Intergenic
913303789 1:117401513-117401535 AAGTAGGGCTGGGTGGAAAACGG + Intronic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914431002 1:147620179-147620201 AACTGGTATTCGAGGGAAAATGG - Exonic
914956216 1:152165028-152165050 AAGTGGGAGTGGAGGAAATGGGG + Intergenic
914980508 1:152410695-152410717 AAGTGGGAAGGGCGGGGAAAGGG - Exonic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
916955860 1:169833789-169833811 AAGTGGGACTGGGAGGGAAAGGG + Intronic
918103740 1:181398729-181398751 AAGTGAGACAGGATGGAAAGTGG - Intergenic
918488416 1:185054100-185054122 AAGTGAAACTGCCGGGAAAAAGG + Intronic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919651271 1:200151082-200151104 AGGTGGGGCTGGGAGGAAAATGG + Intronic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
922779994 1:228244446-228244468 AAGTGGGCATGGAGGTCAAAGGG + Exonic
923723499 1:236487060-236487082 AAGTGGGCCTGGGTGGAAATGGG - Intergenic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1062989422 10:1802068-1802090 AAATGGTACCTGAGGGAAAAAGG + Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065531794 10:26677618-26677640 AATTTGGACTGAAGAGAAAAAGG - Intergenic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1069567345 10:69472628-69472650 AAGAGGGTCTGAAGGGGAAATGG + Intronic
1069689865 10:70343351-70343373 AAAAGGGACAGGTGGGAAAAGGG + Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071736235 10:88303772-88303794 AAGTGGGAGTGAAGGGGAAGGGG - Intronic
1072669582 10:97419548-97419570 AAGGGGCAGTGGAGGGTAAAAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072900744 10:99404432-99404454 AGGTGGGACTGGGGGGAATCTGG + Intronic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1073875135 10:107914402-107914424 AAGTGGGCTTGGAGGGTCAAGGG - Intergenic
1074506148 10:114072512-114072534 AAGTGGATCTGGAGGGATAGAGG - Intergenic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074793790 10:116920374-116920396 AGATGGGACTGGAAGGAGAAGGG - Intronic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075676329 10:124298202-124298224 AAGTGGGGCTCTGGGGAAAAGGG - Intergenic
1075875035 10:125799097-125799119 AGGTGGTACTGGATGGAAAGGGG - Intronic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1077180305 11:1209282-1209304 AAGGGGGACAAAAGGGAAAAGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077671371 11:4160859-4160881 AAGTAGATCTGGAGGGACAAAGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078310988 11:10241979-10242001 AAGTGGGTCTGCAGGGAGTAGGG - Intronic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1079645938 11:22863909-22863931 AAGTGGCACTGGAAGGAGACTGG - Intergenic
1079993871 11:27274764-27274786 AGGTGGGACAGGAGGAGAAAAGG + Intergenic
1079993980 11:27275779-27275801 AGGTGGGACAGGAGGAGAAAAGG - Intergenic
1080269846 11:30439626-30439648 AAGTGGCAGTGGAGACAAAAGGG + Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1081400743 11:42639927-42639949 ATGTGGGACAGGAGGGGAACAGG - Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082698039 11:56395051-56395073 TAGTTGAACTGGGGGGAAAATGG + Intergenic
1083214286 11:61208750-61208772 AAGTGGTACTGAGGGGGAAATGG - Intronic
1083217170 11:61227579-61227601 AAGTGGTACTGAGGGGGAAATGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085402501 11:76243202-76243224 AAGTGGGCCTGGTGGGAGAGAGG + Intergenic
1085781305 11:79411612-79411634 AAGAAAGACTGGAGGGAGAAGGG - Intronic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086553781 11:88085351-88085373 AGGTGTCACTGAAGGGAAAAAGG + Intergenic
1088015552 11:105054705-105054727 AAGGGAGACGGGAGGGTAAAAGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088788927 11:113207246-113207268 AGGTGGCACTGAAGGAAAAAAGG - Exonic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090697175 11:129258508-129258530 AAGTTTGGCTGTAGGGAAAATGG - Intronic
1090916448 11:131168188-131168210 AGATGGGACTGGAGGTAAATGGG + Intergenic
1092798210 12:12135354-12135376 AAGTGGGAGAGAAGAGAAAAAGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092973768 12:13724374-13724396 AAGTTAGACTGGAGGTAGAATGG + Intronic
1093971108 12:25376854-25376876 AAGAGGGAAGGGAGGGAAAGGGG + Intergenic
1094313631 12:29113875-29113897 AAAGGGAACAGGAGGGAAAATGG + Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095817623 12:46441660-46441682 GAGTGGAACTGGATAGAAAAAGG + Intergenic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096377918 12:51129768-51129790 AAGCTGCACTGGAAGGAAAATGG + Intronic
1096866298 12:54565665-54565687 AAATGGGACAGAAGGGAAAGTGG - Intronic
1097015680 12:55985286-55985308 TAGTGGGACTGGAGTTAAACTGG - Intronic
1097025856 12:56054965-56054987 ATGGGTGACTGGAGGGCAAATGG + Intergenic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1099228857 12:80000328-80000350 TAGTGGTACTTGATGGAAAAGGG - Intergenic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102803464 12:115758388-115758410 ATCTGGGACTGGAGCGAAAGCGG + Intergenic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1103855008 12:123961315-123961337 AATAAGGACTGGAGTGAAAAAGG + Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1103949082 12:124541725-124541747 GAGTGGAACTGGAGGGAGATGGG + Intronic
1104289600 12:127455702-127455724 AGGGGGGACTGCAGGGAAAGGGG + Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106310404 13:28549205-28549227 AGGTGAGACAGGAGGGAACAAGG + Intergenic
1106982788 13:35309267-35309289 AAGTGAGACTGCAGGTATAAGGG - Intronic
1107367130 13:39693272-39693294 AAGAGGGAAAGGAGGGAGAAAGG - Intronic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1109411052 13:61969993-61970015 AAATGGGACAGAAGTGAAAATGG + Intergenic
1110497750 13:76189615-76189637 AGGTAAGAATGGAGGGAAAAGGG - Intergenic
1110585754 13:77189896-77189918 AAGTGAGATTGCAGGGAAGATGG - Intronic
1111031200 13:82601633-82601655 AAGTAGGATTGGAGGTACAAAGG - Intergenic
1111067937 13:83122216-83122238 AAGTGGGACTGGCTTCAAAACGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112318744 13:98388481-98388503 AAGTGGTCCTGGCGGGAAAGGGG + Intronic
1112611055 13:100955074-100955096 AGCTAGGACTGGAGGGGAAAAGG - Intergenic
1112833193 13:103478827-103478849 TAGTGGGATTGTTGGGAAAAAGG + Intergenic
1113103990 13:106752773-106752795 AACTCAGACTGGTGGGAAAATGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113586889 13:111471995-111472017 AAGAGGGCCTGGAAGGAGAAAGG + Intergenic
1114055148 14:18962019-18962041 AGGAGAGACTTGAGGGAAAAGGG - Intergenic
1114107394 14:19439759-19439781 AGGAGAGACTTGAGGGAAAAGGG + Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114484289 14:23053871-23053893 AGGTGGCACTGGAGGGACAGTGG + Intronic
1115936811 14:38561440-38561462 ATCTGGGACTGGAGCAAAAAAGG + Intergenic
1116026332 14:39519923-39519945 TGGTGGGACTGCAGAGAAAAAGG + Intergenic
1117230148 14:53708591-53708613 AAGTGGGCCATGAGGGAAATTGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1118536064 14:66766021-66766043 AAGCAGGACTTGAGGGATAATGG + Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119519625 14:75276709-75276731 GAGGGGGACGGGAGGGAAAGGGG - Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120441137 14:84541581-84541603 AACTGGGACTGCAGGCAAAAAGG - Intergenic
1120539708 14:85737435-85737457 AAGGGAGAATGGAGGGAGAATGG + Intergenic
1120571483 14:86122636-86122658 TAGAGGGATTGGAGGGGAAAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122244524 14:100392881-100392903 AAGTGGGACTGCTGGGTCAAAGG + Intronic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1124088864 15:26579000-26579022 AAGTGGCACTGCATAGAAAAAGG + Intronic
1124483892 15:30099763-30099785 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124490268 15:30151082-30151104 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124519687 15:30397461-30397483 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124538966 15:30568760-30568782 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124753265 15:32387247-32387269 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124759683 15:32438812-32438834 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124975005 15:34522947-34522969 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1125362314 15:38877047-38877069 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1125394188 15:39229039-39229061 AGAAGGGACTGGAGGGCAAAAGG - Intergenic
1126257461 15:46644437-46644459 AAGTGGAAAGGGAGGGGAAATGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127226816 15:56940024-56940046 ATGTGAGACTGAGGGGAAAATGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128637793 15:69314301-69314323 AGGAGGGACAGGAGGGAGAAGGG - Intronic
1128917175 15:71573553-71573575 AGGTGGCATTTGAGGGAAAAAGG - Intronic
1129210440 15:74064994-74065016 AAGAGAGGCTGGAAGGAAAAGGG - Intergenic
1129403575 15:75300379-75300401 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1129840254 15:78739345-78739367 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1129919948 15:79311443-79311465 ACCTGGGAGTGGAGGGAGAAGGG - Intronic
1129922559 15:79332432-79332454 AAGTGGGAGTAGAGGGCAATTGG + Intronic
1130114628 15:80996048-80996070 AAGTGGGGCTGGGGAGGAAATGG + Intergenic
1130275941 15:82476409-82476431 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130462370 15:84168746-84168768 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130468302 15:84203801-84203823 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130473989 15:84247668-84247690 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130481402 15:84361736-84361758 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130490302 15:84426039-84426061 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130495964 15:84469741-84469763 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130501894 15:84504797-84504819 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130590595 15:85208399-85208421 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130596271 15:85252309-85252331 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131838571 15:96414115-96414137 AATTGGAGCTGGAGAGAAAAGGG + Intergenic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132496717 16:266829-266851 GGGTGGGGCTGGAGGGAGAAGGG + Intronic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1133545847 16:6805840-6805862 AAGTGTGACTGTAAGGAGAAAGG - Intronic
1133559460 16:6937288-6937310 ATGTGGGAATGAAGGTAAAAAGG - Intronic
1133749478 16:8713305-8713327 AAGAGGCCCTGGAAGGAAAAAGG + Exonic
1135527480 16:23225112-23225134 AAATGTGAATGGAAGGAAAATGG - Intergenic
1135795532 16:25438136-25438158 AAGAGCAACTGGGGGGAAAAAGG - Intergenic
1136153417 16:28366586-28366608 AAGGGTGACAGGAGGGAAACGGG + Intergenic
1136209669 16:28748681-28748703 AAGGGTGACAGGAGGGAAACGGG - Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1137534757 16:49311585-49311607 AAAGGGGGTTGGAGGGAAAAAGG - Intergenic
1137592806 16:49704070-49704092 AAGAGGGCCTGGAGGCAGAAAGG + Intronic
1137699401 16:50485775-50485797 AAGTGGGACTGCTGGGTGAAAGG - Intergenic
1137820138 16:51436397-51436419 AACTGGGGCTTGAGGGATAAAGG + Intergenic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1143129888 17:4671632-4671654 AGGTGGGGCTGGCGGGAGAAGGG - Intronic
1143181982 17:4989063-4989085 AATTGGGAGTGGAGGGTTAAAGG - Intronic
1143451141 17:7037396-7037418 TAATGGGACTGGAGTGTAAAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144411080 17:15002413-15002435 AAGAGGGACTGAAAGGAACAGGG - Intergenic
1145087677 17:19956489-19956511 AAGTGGGAATGAAGGGTGAAAGG + Intronic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146181909 17:30703858-30703880 AAGTGGGATACGAGGGAAAGAGG - Intergenic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1148606167 17:48930605-48930627 AGGTGTTCCTGGAGGGAAAAGGG + Exonic
1148649449 17:49239115-49239137 AAGTGGGACTGGAGTCAGATAGG - Intergenic
1150142789 17:62744166-62744188 AAGAGAGGCTGGTGGGAAAAGGG - Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151377900 17:73704001-73704023 AAGGGGGAAGGGAGGGAGAAAGG - Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1153083937 18:1261531-1261553 AAGTGGGATTGCTGGGTAAACGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154027340 18:10720995-10721017 ATGTGGGACCTGAGGGAGAAAGG - Intronic
1155148676 18:23105164-23105186 AAATAGGACTGGAAGGGAAAAGG + Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156632531 18:38987119-38987141 TAGTGAGACTGCAGGAAAAAGGG + Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157457238 18:47843377-47843399 AAGTGGGACAGGGGAGAACAGGG - Intronic
1157531284 18:48423073-48423095 AGGAGAAACTGGAGGGAAAAGGG - Intergenic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1157788567 18:50509033-50509055 AAATGGGGGAGGAGGGAAAAAGG - Intergenic
1158499424 18:57986850-57986872 GAGTGGGACTGGAGAAAAAGGGG - Intergenic
1159691055 18:71487775-71487797 AAGTAGGTCTGAATGGAAAAAGG - Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1161803497 19:6429341-6429363 AAGAGGGAGAGGAGGGAGAAAGG + Intronic
1161880802 19:6950591-6950613 AAGTTGGAAGGGAGGAAAAATGG + Intergenic
1162812455 19:13172476-13172498 AAGTGGGACATGAGGGCAGAAGG - Intergenic
1162976929 19:14211933-14211955 AAGTGGGATACGAGGGAAAGAGG + Intergenic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1164529669 19:29038798-29038820 AAGTGGACCTGAGGGGAAAAAGG + Intergenic
1165367746 19:35379624-35379646 AAAGGGGAGGGGAGGGAAAAGGG - Intergenic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
1165460964 19:35944269-35944291 TGGTGGGACTAGAGTGAAAATGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
925516417 2:4688569-4688591 AATTGAGACTCGAGGGAAATAGG - Intergenic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
925745997 2:7044298-7044320 AACTGGGGGTGGAGGGAGAAAGG + Intronic
925938417 2:8790484-8790506 AAATGTGATTGGAGGGAGAAGGG - Intronic
926002570 2:9345721-9345743 ACCAGGGACTGGAGGGACAAGGG - Intronic
926459079 2:13105681-13105703 AAGTGGGATTGCAGGGTCAAAGG + Intergenic
926901509 2:17755335-17755357 AAGTGAGACTGCAGATAAAAAGG - Intronic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927550305 2:23992371-23992393 AAGTATGATTGGAGGGCAAAAGG + Intronic
927816790 2:26224212-26224234 AAACGGTACTGGGGGGAAAAAGG + Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931267545 2:60673870-60673892 AAGAGTTAGTGGAGGGAAAATGG + Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
931946387 2:67313237-67313259 TAGTGGGACTGGAGACAATATGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932199985 2:69817558-69817580 GAATGGCACAGGAGGGAAAATGG + Intronic
932478892 2:72026880-72026902 AAAAGGGACTGGAAGGAAAGAGG + Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933137790 2:78759128-78759150 AAGGGGGAATGGAGGGTGAAAGG - Intergenic
935412974 2:102785276-102785298 GAGTGGGACTGGCCTGAAAATGG - Intronic
936776069 2:115974996-115975018 AAGAGATACTGGAGTGAAAAGGG - Intergenic
938234959 2:129698655-129698677 AAGTGGTACAGAAGGGAACATGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939969369 2:148643259-148643281 AAGAGGAACAGGAGGAAAAAGGG + Intergenic
940007262 2:149019396-149019418 AGGTGGGACTGCAGGGAGAGAGG + Intronic
940768132 2:157811566-157811588 AAATGGGAATGGAGGAAATAAGG - Intronic
941322767 2:164075793-164075815 AAGTGGGACTCAAAGGATAAAGG - Intergenic
942174355 2:173317357-173317379 AAGTGGGACTGCAAAGAAGAAGG - Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942534441 2:176948596-176948618 AAGTGTGATTGGAGGACAAAAGG - Intergenic
942592223 2:177558360-177558382 AAGTAGGAATCGAGGGAATAGGG + Intergenic
943184547 2:184590405-184590427 AAGGGGTAAGGGAGGGAAAAAGG - Intergenic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943663766 2:190587379-190587401 AATTGGGACTTGAGGAACAAAGG + Intergenic
945199507 2:207267063-207267085 AAGTGGGAGTGGGGAGACAATGG + Intergenic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945807626 2:214509550-214509572 AAGTGGGAGTAGAGGGTAAGAGG + Intronic
946625149 2:221603706-221603728 AAGAGTGAGTGGTGGGAAAATGG + Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947831752 2:233146413-233146435 AAAGGTGACTGGAGGGATAAGGG - Exonic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
948734632 2:239993800-239993822 AAGGGGGTCAGCAGGGAAAAAGG + Intronic
948885251 2:240878985-240879007 AGGTGCCACTGGAGGGAAAAGGG - Exonic
948920994 2:241065869-241065891 AAGTGGGACTGGGGAGGAATGGG + Intronic
1168861628 20:1049812-1049834 AGGTGAGACTGGAAGGATAAAGG - Intergenic
1169434379 20:5572656-5572678 AAGTGAAACTAGGGGGAAAATGG - Intronic
1169589767 20:7127506-7127528 AGGTGTGATTGGAAGGAAAATGG + Intergenic
1169794552 20:9447615-9447637 AAGTGGGAGTGGATGCAGAAAGG + Intronic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170798287 20:19569423-19569445 AAGTGGGACAGGAGGGCCACAGG - Intronic
1171252902 20:23663050-23663072 AGGTGGGAATGGAGGTAGAAAGG - Intergenic
1171259385 20:23718367-23718389 AGGTGGGAATGGAGGTAGAAGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172466679 20:35160753-35160775 AATTGGGACTGGATGGGCAATGG + Intergenic
1172838884 20:37890162-37890184 AAGTGGGGTTTGAGGGGAAAGGG + Intergenic
1173337513 20:42124844-42124866 AAGGGGAAATGGAGGGACAAAGG - Intronic
1173784733 20:45784336-45784358 AGGTTTGACTGGAAGGAAAAAGG + Intronic
1174800652 20:53560550-53560572 ATTTGGCCCTGGAGGGAAAAGGG - Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1175921385 20:62451979-62452001 AAGAGGGAGAGGAGGGAGAAGGG + Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178598657 21:33977136-33977158 AATTAGGACTGGAAAGAAAACGG + Intergenic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1179215880 21:39366851-39366873 AAGGGGGAAGGGAAGGAAAAAGG - Intergenic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1180473630 22:15684569-15684591 AGGAGAGACTTGAGGGAAAAGGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181567131 22:23745895-23745917 GAGTGCGACTGGAGGGTAGAGGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181893186 22:26082929-26082951 AGATGGGAGTGGAGGGCAAATGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184630966 22:45779421-45779443 AAGACGGACTGGAAGGAAGAGGG + Intronic
1184640702 22:45868487-45868509 ACGTGAGACTGGAGAGAAAGAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949791426 3:7796571-7796593 AGGGGAGACTGAAGGGAAAATGG - Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
950728625 3:14936635-14936657 AGGCTGGACTGGAGGGAAAAAGG - Intergenic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
952127696 3:30321128-30321150 AAGAGGCAATGGAAGGAAAATGG + Intergenic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954110592 3:48430739-48430761 AAGTGGGAGTGGAGGAAAAGGGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
955160185 3:56457825-56457847 AAGTGTCACTGAAGGGTAAATGG - Intronic
955281716 3:57600426-57600448 AAGGGGGAAGGGAGGGGAAAAGG - Intergenic
955398992 3:58577786-58577808 AAATGGCTCTGGGGGGAAAAGGG + Intronic
955691233 3:61592444-61592466 AAGAGGCACTGGGGGAAAAAAGG + Intronic
955720078 3:61871090-61871112 AACAGGGAATGTAGGGAAAATGG - Intronic
955878783 3:63522015-63522037 AAGTAGATCTGGAGGGACAAAGG + Intronic
956839105 3:73120698-73120720 AAATTGGACTGGGGAGAAAAAGG + Intergenic
957714323 3:83905666-83905688 AAGTGGGACAGCAGGTCAAAAGG - Intergenic
958433644 3:94071885-94071907 ACCTGGGGCTGGAGGGAAAGTGG - Intronic
959289534 3:104456289-104456311 AAGAGAGACTTGAGGGAATAAGG + Intergenic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
960203780 3:114870429-114870451 ATATGGGATTGGAGGGAGAATGG - Intronic
960462599 3:117954896-117954918 AAGTGAAACTTGAGGGGAAAGGG + Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961031053 3:123604344-123604366 AAGTTGGACTGGAGAGACCACGG - Intergenic
961400734 3:126640441-126640463 AAGAGAGACTGGGGGGGAAATGG - Intronic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
962265682 3:133942773-133942795 AAGAGGAAGGGGAGGGAAAAAGG + Intronic
962304452 3:134273215-134273237 AGGATGGACTGGAGGGGAAATGG + Intergenic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
962452849 3:135535288-135535310 AGGTGGGACAAGAGGGAAAGAGG + Intergenic
962627188 3:137237460-137237482 AAGTGGGGGTGGATGGGAAAAGG + Intergenic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
967872977 3:194247738-194247760 AAGAGAGTCTGGAGGGACAAAGG - Intergenic
967873825 3:194252832-194252854 AACTGGGAATGGAGAGAAACCGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
969450113 4:7268212-7268234 AAGTGGGAGTGAAGGGATGAAGG + Intronic
969590335 4:8118403-8118425 AAACTGGGCTGGAGGGAAAAGGG - Intronic
970451324 4:16168907-16168929 GAGTGAGTCTGGAGGGAAAGAGG + Intronic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
970718529 4:18957782-18957804 TAGTGGGCCTGGAAGGAAAATGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971033443 4:22666680-22666702 AAGTGTGATTGGAGGACAAAAGG + Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971256181 4:25015675-25015697 AAATGAGGATGGAGGGAAAATGG - Intronic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972316961 4:37935767-37935789 AGGTAAGACTGGAGGGGAAACGG - Intronic
973223098 4:47751447-47751469 AAATGGGAGAGAAGGGAAAATGG - Intronic
973633247 4:52838896-52838918 AATTGGGACTGGAGATCAAAGGG + Intergenic
974251955 4:59395985-59396007 AAATAGGACTGCAGGGAAAAAGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974684132 4:65202379-65202401 AAGTGGGACAGGCTGTAAAATGG - Intergenic
975706959 4:77121180-77121202 AAGTGGTAATGGAGGGATACGGG + Intergenic
976561326 4:86504907-86504929 AAGAGGGACTGTAGGCAAACTGG - Intronic
977225485 4:94387905-94387927 AAGGGAGAATGGAGGGAGAATGG + Intergenic
977688759 4:99878995-99879017 AAGTGGAATTGCAGGGCAAAAGG + Exonic
978555220 4:109972659-109972681 AAGTGGCACTGGAGTAGAAATGG + Intronic
978976716 4:114885008-114885030 AAGGCAGACAGGAGGGAAAATGG - Intronic
979154670 4:117369305-117369327 AGGTGGGGCAGGAGGGGAAATGG - Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
980080305 4:128337290-128337312 AAGTGGGGCATGAGGGGAAATGG + Intergenic
981086491 4:140689515-140689537 AAGGGGGAATGGAAGGGAAAAGG - Intronic
981249539 4:142583337-142583359 AAGTGGGGCAGGAAAGAAAAGGG - Intronic
981733206 4:147921750-147921772 GGGAGGGACTGGAGGTAAAACGG - Intronic
982691624 4:158553761-158553783 AAGTGGAACAGGAGAAAAAAGGG + Intronic
984881336 4:184412415-184412437 AAATGGGACTTCAGGGACAAGGG - Intronic
984961657 4:185103281-185103303 AAGTGTGAGTTGAGGGAGAATGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985026470 4:185744010-185744032 AAATGGGAGAGGAGGGAAAGGGG - Intronic
985310094 4:188588495-188588517 AAATTGGACTGGAGGACAAAGGG + Intergenic
985314806 4:188645948-188645970 AAGTGTGATTGGAGGACAAACGG + Intergenic
985891982 5:2723282-2723304 AGAGGGGACTTGAGGGAAAATGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986309433 5:6541244-6541266 AAATGGAAGTGGAGGGAAAGTGG + Intergenic
986464776 5:8010386-8010408 AAGTGGAGCTGCATGGAAAATGG - Intergenic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987012309 5:13780030-13780052 AAGTGGGAATGGAAGAGAAATGG - Intronic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
988182851 5:27819686-27819708 ATGTGGGACAGGAAGGAAAGAGG + Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990013255 5:51025969-51025991 AAGTGGAAGTAGAGTGAAAAAGG + Intergenic
991648269 5:68823472-68823494 GAGTGAGACTGGAAGCAAAATGG - Intergenic
991907852 5:71530135-71530157 AGTTGGGACTGGATGGGAAAAGG - Intronic
992013338 5:72552503-72552525 AAGAGGGAGTGTAGGGAGAAAGG + Intergenic
993730645 5:91418118-91418140 AAGTGGGACGGGTGGGATAGTGG - Intergenic
993735069 5:91466515-91466537 AAGAGGGAAAGAAGGGAAAAAGG - Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994717918 5:103346320-103346342 AAGTGGGACAGGATGGCTAAAGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995493623 5:112719100-112719122 AAGTGGGACTGTATGGAGGAGGG + Intronic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996352683 5:122563072-122563094 AAGTCTGACAGAAGGGAAAAGGG + Intergenic
996440262 5:123482183-123482205 AAATGGGACAGAGGGGAAAAAGG + Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998395331 5:141814487-141814509 AAATGGGGCAGGAGGGAAAGGGG - Intergenic
998549109 5:143059559-143059581 TAATGGGACTGGAGGGGGAAAGG - Intronic
998891267 5:146748480-146748502 GATGGGGACTGGAGGGAAACTGG - Intronic
998937085 5:147240836-147240858 AAATGGGAAGAGAGGGAAAAAGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999371725 5:151059582-151059604 AAGTGGGAAGGAAGGGAGAATGG + Intronic
999713164 5:154336676-154336698 GGGTGGGACTGGAGGGGAATTGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1000574457 5:162959711-162959733 AAGCGGGTCTGGAAGGAGAAAGG + Intergenic
1000694348 5:164361266-164361288 AAGTGGGGCTGGAAGAAAAGGGG + Intergenic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001845602 5:174918171-174918193 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1001919421 5:175588685-175588707 AAGTGGGAGGGGAGGAGAAAAGG + Intergenic
1001939902 5:175733042-175733064 CAGCGGGACTGGACAGAAAAGGG + Intergenic
1001951951 5:175822536-175822558 AAGATGGCCTGAAGGGAAAAGGG + Intronic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002453198 5:179331276-179331298 AAGGGAGAATGGAGAGAAAAGGG + Intronic
1003477614 6:6498549-6498571 GAGTGGGAGTGGAGGATAAAGGG - Intergenic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1005114608 6:22321795-22321817 AAGAGGTACTGGACAGAAAATGG - Intergenic
1005246584 6:23892595-23892617 ATGTGGAATTGGAGGAAAAAAGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005774062 6:29110059-29110081 AAGTGGGAGGGGCAGGAAAATGG - Intergenic
1005825299 6:29628369-29628391 GAGTGGGACGGGAGAGAAACGGG + Intronic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1007640276 6:43332916-43332938 AAGTCTGGCTGGAAGGAAAAAGG + Intronic
1008308622 6:49937025-49937047 ATGTGGCACTGGAGGGAATGAGG + Intergenic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1010021128 6:71161181-71161203 AAGTGGGACCTGAGGGACCATGG - Intergenic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013581090 6:111535395-111535417 AAGTGGTATTGGAGTGGAAATGG + Intergenic
1013678988 6:112501860-112501882 AAGTGGAAATGGAGGGGGAAGGG - Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015385909 6:132623132-132623154 AAATGGGATTGTAAGGAAAAAGG + Intronic
1015836493 6:137425954-137425976 AAGTGTGATTGGAGGACAAAGGG + Intergenic
1016163970 6:140916959-140916981 AAAGTGGACTGGAGGGAAAGAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017706843 6:157131582-157131604 AAATGGGGCTGAAGGGAGAAAGG + Intronic
1018274574 6:162117161-162117183 AAGTGGGAAGGGAGAGAAAGTGG + Intronic
1019256412 7:55241-55263 TAATGTGACTGGAGGGAAAGTGG - Intergenic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021925034 7:25526048-25526070 AACTGGGGCTGGAGGGAAAGGGG + Intergenic
1022465791 7:30652628-30652650 AGGGGAGACTGGAGGGCAAAGGG + Intronic
1022776859 7:33535756-33535778 AAAGGAGACTTGAGGGAAAAGGG + Intronic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1024338405 7:48232883-48232905 AAGTGGGACTCTAAGAAAAAGGG + Intronic
1024878349 7:54054003-54054025 ATGTGGGACTGTAAGAAAAAGGG + Intergenic
1025775697 7:64558932-64558954 AAGTGGGAGGGGAAGAAAAAAGG + Intronic
1026102752 7:67396336-67396358 AAGTGAGACTGGAAAGAACAAGG - Intergenic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1027240782 7:76326675-76326697 AAGTTGGATTGGCAGGAAAAAGG - Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1029100273 7:98124187-98124209 AGGTGAAGCTGGAGGGAAAAGGG - Intronic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029865575 7:103624409-103624431 GAGTGGGACATGAGGAAAAAAGG - Intronic
1030218120 7:107067332-107067354 AAGTGGAAATGGAGGGATATGGG + Intronic
1030509588 7:110468320-110468342 GATTGGGACTAGAGGGAGAAGGG - Intergenic
1031451626 7:121927844-121927866 AAGAGGGACTGGAGTCAGAAAGG - Intronic
1031456549 7:121987541-121987563 TAGTGAGGCTGCAGGGAAAAGGG - Intronic
1032099348 7:128960458-128960480 AAGTGGGACAAGATGTAAAAAGG + Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032824072 7:135552146-135552168 AGGTGAGACTGGAGGCAGAAGGG + Intergenic
1033041564 7:137923956-137923978 AAGTGGGACAGGCTGGAGAAGGG - Intronic
1033321735 7:140346037-140346059 TAGTGAGACTAGAGGGCAAATGG - Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1034470588 7:151252292-151252314 AAGCGAGACTGGAGGGAGAACGG + Intronic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035387361 7:158483078-158483100 AAGTGTGATCGGAGGGCAAAGGG - Intronic
1035835828 8:2750671-2750693 AATTGGGACAGGAGGAAAAATGG + Intergenic
1035917417 8:3640110-3640132 AAGTGGGACAGGTGGAAAAAAGG - Intronic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037572028 8:20166092-20166114 AAGTGGGACTGTTGGGTCAAAGG - Intronic
1037712051 8:21362551-21362573 AAGTGGGAGTGAAGAGCAAAGGG + Intergenic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038370401 8:26983420-26983442 AAATCAGGCTGGAGGGAAAAAGG + Intergenic
1039819639 8:41124503-41124525 AAGGAGGACAGGTGGGAAAAAGG + Intergenic
1040063448 8:43124530-43124552 AAGGAGGACTGGAGAGACAATGG + Intergenic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042311953 8:67387678-67387700 AAGTGTGACTGCAGTGAAATGGG - Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1042795885 8:72662753-72662775 GAGTGGGACAGGAGGGCTAATGG + Intronic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1045883288 8:107065512-107065534 CATTGGGACTGGTGGGACAATGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048503915 8:135003752-135003774 AAGAAAGACTGGAGGTAAAAGGG + Intergenic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048787169 8:138062838-138062860 AAGGGGAACTGTCGGGAAAAGGG + Intergenic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703331 8:144024699-144024721 AAGAGGGCCTTCAGGGAAAAGGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050429187 9:5544459-5544481 AGGGTGGACTGGAGGGAGAAGGG - Intronic
1050522602 9:6517316-6517338 AAGTAGGACTGAAGAGGAAAGGG - Intergenic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1052025664 9:23570879-23570901 AAATGGGACTGGATAGATAATGG - Intergenic
1052316731 9:27123179-27123201 AAGTGGGAAGGGAGGGAGATGGG + Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052383799 9:27801599-27801621 GGCTGGGACTGGAGGGAATAAGG - Intergenic
1052848781 9:33362604-33362626 AAGAGGGACAGGGTGGAAAAGGG + Intronic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1053549175 9:39057380-39057402 AAGTGGGACTGAATTAAAAAGGG + Intergenic
1053813303 9:41877464-41877486 AAGTGGGACTGGATTAAAAAGGG + Intergenic
1054617292 9:67309975-67309997 AAGTGGGACTGGATTAAAAAGGG - Intergenic
1055945981 9:81690869-81690891 AAGTGGAACTTGAGTTAAAAGGG + Intergenic
1058091685 9:100813014-100813036 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059416956 9:114168324-114168346 AGGTCGGACTGGAAGGTAAAAGG - Exonic
1060210541 9:121707478-121707500 AACTGGGACAGTAGGGAGAAGGG - Intronic
1060465441 9:123900460-123900482 AAGTGCGGCAGGAGGGTAAAGGG + Intronic
1060745463 9:126127998-126128020 AAGAGGGAGTGGTGGGGAAAGGG + Intergenic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1062202426 9:135310629-135310651 AAGTGTTACTGGAGATAAAAAGG + Intergenic
1062255868 9:135620210-135620232 AAGGGGGAGTAGGGGGAAAAGGG - Intergenic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1186276817 X:7948412-7948434 AAGTGGGAGTGGAGGAAGATTGG + Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186565197 X:10654801-10654823 AGTGGGGACTGGAGGGACAAAGG + Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188997151 X:36899448-36899470 AACTGGGAATGGATGGATAACGG + Intergenic
1189030894 X:37449047-37449069 AAGTGATACTCTAGGGAAAATGG - Intronic
1189725992 X:43968784-43968806 AAGTGGTAGTGGAGGGGAATTGG + Intronic
1189756663 X:44278778-44278800 AACTGTGACTGGAGGACAAAAGG - Intronic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1191796773 X:65029690-65029712 ATGTGAGACTGGAGGAATAAGGG + Intronic
1191852529 X:65596187-65596209 AACTGGGACTGAATGGAAACTGG + Intronic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1192441761 X:71179786-71179808 GAATGGGGCTTGAGGGAAAAGGG - Intergenic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1193039143 X:76986557-76986579 AAGAGGAAGAGGAGGGAAAATGG - Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1194589746 X:95785197-95785219 TAGTGGGAGTGCAGGGAAAGTGG + Intergenic
1194597692 X:95879016-95879038 AAGTGGAACTGGAAGGTAAAAGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195619638 X:106939984-106940006 AAGTGAGACTGCAGGGAATGAGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196375924 X:115032383-115032405 AAGTGGGGCTAGAGGGTAAGAGG - Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1198008614 X:132526117-132526139 AAATGGGACTGGAAACAAAATGG - Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198703392 X:139420948-139420970 AATTGGGATTAGAGGGTAAAGGG - Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1202376922 Y:24246384-24246406 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1202493858 Y:25423737-25423759 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic