ID: 927503170

View in Genome Browser
Species Human (GRCh38)
Location 2:23595792-23595814
Sequence GTGGAGAGACAGCATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 511}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927503170_927503179 2 Left 927503170 2:23595792-23595814 CCCTTCCCATGCTGTCTCTCCAC 0: 1
1: 0
2: 2
3: 46
4: 511
Right 927503179 2:23595817-23595839 GGATCCCAGCTCTCCCAGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 295
927503170_927503176 -2 Left 927503170 2:23595792-23595814 CCCTTCCCATGCTGTCTCTCCAC 0: 1
1: 0
2: 2
3: 46
4: 511
Right 927503176 2:23595813-23595835 ACCAGGATCCCAGCTCTCCCAGG 0: 1
1: 0
2: 1
3: 41
4: 308
927503170_927503182 10 Left 927503170 2:23595792-23595814 CCCTTCCCATGCTGTCTCTCCAC 0: 1
1: 0
2: 2
3: 46
4: 511
Right 927503182 2:23595825-23595847 GCTCTCCCAGGGTGGCTGCTAGG 0: 1
1: 0
2: 4
3: 32
4: 278
927503170_927503178 -1 Left 927503170 2:23595792-23595814 CCCTTCCCATGCTGTCTCTCCAC 0: 1
1: 0
2: 2
3: 46
4: 511
Right 927503178 2:23595814-23595836 CCAGGATCCCAGCTCTCCCAGGG 0: 1
1: 0
2: 0
3: 32
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927503170 Original CRISPR GTGGAGAGACAGCATGGGAA GGG (reversed) Intronic
900754812 1:4426104-4426126 GAGGAGGCACAGCACGGGAAGGG - Intergenic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
901779626 1:11585104-11585126 GTGGAGAGGGAGCATGGAGAAGG + Intergenic
902298336 1:15483508-15483530 TTGGAGAGACAGGATGGCATAGG + Intronic
902507847 1:16949321-16949343 GTTCAGAGACTGGATGGGAACGG - Intronic
902619470 1:17642531-17642553 GTGGGGAGAGGGCATGGGAGGGG + Intronic
903125681 1:21245906-21245928 GTAGAGAGAAAGCATGGGGGAGG - Intronic
903225773 1:21893516-21893538 GTGGGGAGAGAGGATGGGGAGGG + Intronic
903277569 1:22231648-22231670 GTGACCAGACAACATGGGAATGG + Intergenic
903795576 1:25926818-25926840 GTGGAGAGACAGGAGAGGACTGG - Intergenic
904988957 1:34576154-34576176 GTGGAGGGAGAACATAGGAAAGG - Intergenic
905252770 1:36660136-36660158 TTGGAGAGAGTGAATGGGAAGGG - Intergenic
905362347 1:37429725-37429747 GGGGAGAGACAGAGAGGGAAGGG - Intergenic
906298705 1:44665259-44665281 GTGGAGAGACAGATAGGGAGGGG + Intronic
907159116 1:52358467-52358489 GGAGAGAGACAGCATGGGAGGGG + Intronic
907309842 1:53532989-53533011 GTGGAGCGTCTGCATGGGAGAGG - Intronic
907351782 1:53838077-53838099 GTGGAGAGAACGCGTGGGGAAGG - Intronic
907474360 1:54695646-54695668 GTGGAGAGACAGGGAGGGGAGGG - Intronic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
907822133 1:57980546-57980568 GTGGAGAAGCAACATGGGATAGG - Intronic
907961084 1:59282322-59282344 GGGGAGATAAAGAATGGGAAAGG - Intergenic
910561558 1:88597414-88597436 CTGGAGAGCAGGCATGGGAATGG + Intergenic
911269945 1:95788909-95788931 GAGGAGAGAGAGCAAGTGAAGGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911636177 1:100238346-100238368 GTGATGAGACAGGACGGGAAGGG - Intronic
911883277 1:103268202-103268224 CTGGAGAACAAGCATGGGAATGG + Intergenic
912130201 1:106590324-106590346 CTGGAGAACAAGCATGGGAATGG - Intergenic
912344746 1:108954054-108954076 GTGGAAAGACTGCACAGGAATGG + Intronic
912387679 1:109280358-109280380 GTAGGGAGACAGGATGGGCAAGG + Intronic
913001522 1:114585190-114585212 GTAGAGAGACATGATGGAAATGG - Exonic
913043866 1:115056885-115056907 GTGAGGAGACAGCACGGGAAGGG - Intronic
913087127 1:115449485-115449507 GAGGGGAGACAGGAAGGGAAGGG - Intergenic
913662995 1:121021246-121021268 GAGGAGATACAATATGGGAATGG - Intergenic
914014376 1:143804511-143804533 GAGGAGATACAATATGGGAATGG - Intergenic
914653001 1:149713069-149713091 GAGGAGATACAATATGGGAATGG - Intergenic
914686394 1:149983555-149983577 TTGGAGAGACAAATTGGGAAAGG + Intronic
914901461 1:151713385-151713407 GATGAGAGACAGCCTGGGGATGG - Intronic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915331500 1:155115539-155115561 GTGGAGAGAGAACATGGGATTGG + Intergenic
916091044 1:161308243-161308265 CTGGAGAGTCAGGAAGGGAAGGG + Intronic
916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG + Intergenic
917028055 1:170663420-170663442 GGGGAGAGAGAGAAGGGGAAAGG + Intronic
917742432 1:177973966-177973988 GTGGAGAGACTGGAGGAGAAGGG + Intronic
919706567 1:200681907-200681929 GTGGAAATAAACCATGGGAAAGG + Intergenic
919944163 1:202307672-202307694 GTGGATAGAGAGGATGGGGATGG - Intronic
920267410 1:204734411-204734433 TTGGAGACACAGCATGGAAGTGG + Intergenic
920993417 1:210962404-210962426 ATGGAGAGATAGCAGGGGACAGG - Intronic
922091621 1:222400883-222400905 GATGAGTGACAGCATGGGTAGGG - Intergenic
922593153 1:226794068-226794090 CTGGGGGGATAGCATGGGAATGG - Intergenic
922721125 1:227900778-227900800 GTGGAGAGACAGGACGTGGAGGG - Intergenic
1062801974 10:387614-387636 GTGGACAGACAGTGTGGGGAGGG + Intronic
1062801982 10:387646-387668 GTGGACAGACAGTATGGGGAGGG + Intronic
1062947872 10:1474697-1474719 GGGGAGAGAATGCGTGGGAATGG + Intronic
1062971633 10:1653280-1653302 TTGGGGAGACAGCATGGAACAGG + Intronic
1064145938 10:12826566-12826588 GTGGAGAGGACCCATGGGAAGGG - Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1066198951 10:33127924-33127946 GGGGAGAGAACGCAAGGGAAGGG - Intergenic
1066252601 10:33649068-33649090 GTGGATATACAGCAGGGGGATGG + Intergenic
1066628584 10:37435714-37435736 TGGGAGAGTCAGCATGGGACAGG + Intergenic
1067570757 10:47369253-47369275 ATGGAGAGTCTGCAGGGGAAGGG + Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1070105586 10:73427769-73427791 CTGCAGAGACAGCATGGAGAAGG + Intronic
1070797948 10:79228028-79228050 GGGCACAGACAGGATGGGAATGG - Intronic
1072299939 10:94050301-94050323 GGAGAGAGAAAGCATGTGAAGGG + Intronic
1072743546 10:97924469-97924491 GAGGAGAGACAGCATGGCACAGG + Intronic
1072909488 10:99487106-99487128 TTGGAGAGGCTGCATGGAAAAGG + Intergenic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073527947 10:104203357-104203379 GCGGAGAGTCTGCATGGAAATGG + Intronic
1074111623 10:110426860-110426882 GTGGAGAGACGTCATTGGAATGG + Intergenic
1074385730 10:113015234-113015256 CTGCAGAGACAGCAGAGGAATGG - Intronic
1074442746 10:113493168-113493190 GTGGAAAGACAGAGTGTGAAGGG - Intergenic
1075064205 10:119278555-119278577 CTGAAGAGACAGCCTGGGATCGG + Intronic
1075370093 10:121928198-121928220 GCGGAGAGACAGAGCGGGAAGGG + Intronic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075425058 10:122335483-122335505 GTGGAGAGTCCGCAGGTGAACGG + Intronic
1076434313 10:130429670-130429692 GTGGAGAGAGGACATGGGTAAGG + Intergenic
1076577511 10:131479529-131479551 TTGGAGACACAGCAGAGGAAAGG - Intergenic
1076598913 10:131644534-131644556 GTGGAGAGGCAGCACGGAGAGGG + Intergenic
1077451917 11:2653579-2653601 ATGGATAGAGAGCAAGGGAAAGG - Intronic
1078373017 11:10766729-10766751 GTGGAGTGAAAGGATGGGATGGG - Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1079100603 11:17539271-17539293 GTGGGGAGACAGGAGGGTAAAGG - Intronic
1079338180 11:19589611-19589633 CTGGATAGACAGCATGCAAATGG + Intronic
1080451625 11:32382969-32382991 GTGGAGAGACTGCATGTAAATGG + Intergenic
1080593359 11:33743832-33743854 GTGGAGAAACAGCAGAGTAAAGG - Intronic
1080867952 11:36212289-36212311 AATGAGAGACAGCACGGGAAGGG - Intronic
1080976551 11:37349564-37349586 CTGGAGAGCAGGCATGGGAATGG + Intergenic
1081781418 11:45715764-45715786 GTGGACAGACAGCCTGGAGAAGG - Intergenic
1081842356 11:46211846-46211868 GGGGAGAGACAGCAGTGGACTGG - Intergenic
1081913976 11:46719299-46719321 GTGCACAGCCAGCATGGTAAGGG + Exonic
1081989455 11:47329921-47329943 AGGGAGAGACAGCCTGGGTATGG + Exonic
1082879310 11:58022614-58022636 ATAAAGGGACAGCATGGGAATGG - Intergenic
1083420809 11:62552032-62552054 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1083920357 11:65778984-65779006 GTGGGGAGCCAGCATGGGCCGGG + Exonic
1084890045 11:72232348-72232370 GTGTAAAGAGACCATGGGAAAGG - Intronic
1084938989 11:72602312-72602334 GGGGAGAGACAGGGTGGAAAAGG - Intronic
1085820093 11:79783240-79783262 GTGGGGAGACAGCTGTGGAAGGG + Intergenic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087057683 11:93949588-93949610 GCAGAGAGACAGCAAGGGATAGG + Intergenic
1088196248 11:107277108-107277130 GTGGAGAGGGAGGATGGAAAAGG - Intergenic
1088264849 11:107979259-107979281 GTGGAGAACAGGCATGGGAATGG + Intergenic
1089329897 11:117681917-117681939 GTGGAGAGAGAGACTGGGACAGG - Intronic
1089602982 11:119626553-119626575 GTGGGGAGAGTGCAGGGGAAGGG + Intronic
1090362315 11:126182211-126182233 GGGGAGGGACAGCCTGGGAGGGG - Intergenic
1090362327 11:126182240-126182262 CTGGAGGGACAGCCTGGGAGGGG - Intergenic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090583013 11:128180675-128180697 GTGGAATTTCAGCATGGGAATGG - Intergenic
1091728584 12:2863345-2863367 GTGTAGAGAGAGCATGCTAATGG - Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092138449 12:6166416-6166438 GTGGAGAGGGAGCATGGAAGGGG - Intergenic
1092532976 12:9360502-9360524 GTGGAGTGGCAGCCAGGGAATGG - Intergenic
1092557840 12:9576822-9576844 GCGCAGAGACAGCATTGCAAAGG + Intergenic
1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG + Intronic
1093035952 12:14332748-14332770 CTGGAGAACAAGCATGGGAATGG + Intergenic
1093101654 12:15036384-15036406 GGGGAGAGACAACCTTGGAATGG + Intergenic
1093715157 12:22373421-22373443 GAGGAGAGACAGGATTAGAAAGG + Intronic
1093890720 12:24517192-24517214 GTCAAGAGGCAGCAAGGGAAAGG - Intergenic
1094513453 12:31111088-31111110 GCGCAGAGACAGCATTGCAAAGG - Intergenic
1096212314 12:49776160-49776182 GTGGAGGCACGGCATGGGGAGGG + Intergenic
1096423569 12:51481551-51481573 GTGGGGAGACAGCAGGGGGCAGG + Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1096968497 12:55647367-55647389 GTGGAGAGACTACATGAGGAGGG + Intergenic
1096996684 12:55842624-55842646 GGGCAGAGAGAGCAAGGGAAAGG + Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097466976 12:59938402-59938424 GTGGAGGGACAGAGAGGGAAGGG + Intergenic
1098384462 12:69904168-69904190 GTGGGGAGACAGAAAGGAAAAGG - Intronic
1098450844 12:70616703-70616725 GTGGGGAGAGAGAATGGCAATGG - Intronic
1098994065 12:77097817-77097839 GGCGAGAGACAGCATGTGCAGGG + Intergenic
1100537019 12:95521044-95521066 GTGGTGATGCACCATGGGAAAGG - Exonic
1100539523 12:95544427-95544449 TTGGAAAGAAAGCATGGAAAGGG + Intronic
1100608656 12:96172199-96172221 GTGGTAAGACAGAATGAGAATGG - Intergenic
1102030159 12:109735671-109735693 CTGGAGAAACAACATGGAAATGG - Intronic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1102709721 12:114915455-114915477 GTGGAGAGGTAAGATGGGAAAGG + Intergenic
1104737072 12:131141822-131141844 GTGGAAAAGCAGCATGGGTAAGG - Intergenic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1106674262 13:31941185-31941207 ATGGAGAGAGGGGATGGGAAAGG - Intergenic
1107568570 13:41631938-41631960 ATTGAGAGACAGCATGGGTAGGG + Intronic
1107675082 13:42787458-42787480 GAGGAGAGACAGCAGAGGATGGG - Intronic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1111030193 13:82587033-82587055 GAGGAGAGACAACATGGGTTAGG + Intergenic
1112207235 13:97336952-97336974 GGTGAGAGACTGCAGGGGAATGG - Intronic
1113173224 13:107530116-107530138 GTGGAGAGAGAACAAGGTAAAGG - Intronic
1113757730 13:112825322-112825344 GTGAAGAAACAGAATAGGAAGGG - Intronic
1114353240 14:21878021-21878043 CTGAAGAGGTAGCATGGGAAAGG - Intergenic
1114716449 14:24830731-24830753 GCATAGAGACAGAATGGGAATGG + Intronic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119578876 14:75756156-75756178 ATGGATAGAAAACATGGGAAAGG + Intronic
1119716493 14:76863336-76863358 GTGGAGAGACAGTAAGGGCCAGG - Intronic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1120888024 14:89467134-89467156 GTGGAGAGCCACCGTGAGAAGGG - Intronic
1121660302 14:95630308-95630330 GTGGAGTGAGAGCGTGGGCATGG + Intergenic
1121852029 14:97230117-97230139 GTGGAGACACAGCATCTGGAAGG - Intergenic
1122448936 14:101788036-101788058 TTGGTGAGACAGCAAGGAAAGGG + Intronic
1122907807 14:104810292-104810314 GTGGGGTGACAGCCAGGGAAGGG - Intergenic
1122916223 14:104860226-104860248 GTGGAGATGGAGCATGGAAATGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124899089 15:33805938-33805960 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1126113110 15:45187179-45187201 GTGGAGAGCCAGCCCGGGAGGGG + Intronic
1126191657 15:45885174-45885196 GAGGAGCGACAGGAAGGGAAGGG - Intergenic
1128379329 15:67100293-67100315 ATGGGGATACTGCATGGGAATGG - Intronic
1128602938 15:69013026-69013048 GTTGTGAGACAGCATTGGGAAGG - Intronic
1129190676 15:73935792-73935814 GGGGAGAGACAGCAGCAGAAGGG - Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1130266141 15:82405474-82405496 GTGAAGCGGCAGGATGGGAAAGG + Intergenic
1130505868 15:84541400-84541422 GTGAAGCGGCAGGATGGGAAAGG - Intergenic
1131331847 15:91507702-91507724 AAGGAGAGACAGCAGGGGACAGG - Intergenic
1131674737 15:94660299-94660321 GTGGAGACAGAGCAAGGGAGAGG + Intergenic
1131787370 15:95927452-95927474 GTGGAGAGGTAGGATGGGATGGG - Intergenic
1132752702 16:1466123-1466145 GTGGAGGGACCGCATGCGCAGGG + Intronic
1132891683 16:2207900-2207922 CTAGAGAGACAGCATGACAAAGG - Intronic
1133203240 16:4217544-4217566 GTGGTAAGACAGCAGGGGAGGGG - Intronic
1133553386 16:6881262-6881284 GTGGGGAGAGAGCAAAGGAAGGG + Intronic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136549174 16:30973258-30973280 GTGCAGAGAAAGCTTGGAAAGGG + Intronic
1136849718 16:33603189-33603211 GAGGAGAGGAAGGATGGGAAGGG - Intergenic
1137512210 16:49111267-49111289 GTGGACACACGGCATGGAAAAGG - Intergenic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137814364 16:51384214-51384236 GAGGAGAGACATCAGGGGTAGGG - Intergenic
1137977270 16:53042328-53042350 GGGGAGAGGCAGAATGGGAGAGG - Intergenic
1138024975 16:53515188-53515210 AGGAAGAGACAGCAAGGGAATGG + Intergenic
1138033358 16:53578845-53578867 CTGGAGAAGAAGCATGGGAAGGG - Intergenic
1138312888 16:56043123-56043145 GTGGGAAGACAGCCTGGGAGCGG - Intergenic
1139354964 16:66362042-66362064 GGGGGAGGACAGCATGGGAAAGG + Intergenic
1139393517 16:66621678-66621700 ATGAAGGGACAGCATTGGAACGG - Intronic
1140195815 16:72854507-72854529 GTGAAGAGCCAGAATGGGAGTGG - Intronic
1140693431 16:77507534-77507556 GTGGAGGGAGAGCAGGGGGAGGG + Intergenic
1141522568 16:84590825-84590847 GTAGAGAGACAGGAGGGGCAAGG + Intronic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142277713 16:89131703-89131725 ATGTAGAGACAGCAAGGCAAAGG - Intronic
1143416871 17:6756754-6756776 GAGGAGAGAGAGCAGAGGAAGGG + Intronic
1143756404 17:9070999-9071021 GCGGACACGCAGCATGGGAATGG - Intronic
1143965579 17:10754518-10754540 GAGGAGGGACAGCTTGAGAAAGG - Intergenic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1146592183 17:34137029-34137051 TTGGAAAGACTTCATGGGAAAGG - Intronic
1146791566 17:35753423-35753445 GTGGAGGGAAAGCAGGGGTAGGG + Intronic
1146814989 17:35935562-35935584 ATGGACAGAAAGCAAGGGAAAGG + Intronic
1146976374 17:37116310-37116332 TAGGAGAGACAGCATGAGACTGG + Intronic
1147135991 17:38434467-38434489 GAGGAGAGACAGCATGGGGCGGG + Intronic
1147745519 17:42692088-42692110 TTTGACAGGCAGCATGGGAAGGG + Intronic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1148079602 17:44960399-44960421 GAGGAGAGAGAGGATGAGAAGGG + Intronic
1149978506 17:61290056-61290078 GTGTAAAGGGAGCATGGGAAGGG + Intronic
1150478072 17:65488947-65488969 GGGGAGAGACAGAAAGGGATGGG + Intergenic
1151127950 17:71865556-71865578 GTGGAAAGAAAGCATTGGCAGGG - Intergenic
1151734880 17:75933164-75933186 ATACAGAGACAGCTTGGGAAGGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152559710 17:81071941-81071963 GAGGAGAGGCAGCAAGGAAATGG - Intronic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1154305494 18:13227832-13227854 GGGGAGGGACCTCATGGGAAGGG - Intronic
1155701368 18:28748043-28748065 GTGGGGAGACAGCAAGAAAATGG + Intergenic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1158829265 18:61260020-61260042 GTGGACAGACACCAGGAGAAGGG - Intergenic
1158960202 18:62581949-62581971 GTGGAGAGTCACCTTGGGGAAGG + Intronic
1159076266 18:63685114-63685136 GTGGAGAGGGAACATGGGAGTGG + Intronic
1159262585 18:66034570-66034592 TCAGAGAGAGAGCATGGGAAGGG - Intergenic
1159453058 18:68626788-68626810 GTGGAGAGATGGGATGGGATGGG + Intergenic
1159550844 18:69894524-69894546 GGGGAGAGACAGGAGGGGAGGGG + Intronic
1159985938 18:74841041-74841063 GGAGAGAGACAGCAGGTGAAAGG - Intronic
1160160543 18:76466901-76466923 GTGGGGAGCAAACATGGGAAGGG + Intronic
1160427409 18:78787778-78787800 GTTGGGAGACAGCAGGGGACGGG - Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1160707698 19:537100-537122 GTGGAAAGAGAGCAAGGGGAAGG + Exonic
1160812199 19:1017690-1017712 GTGGGGAGACAGGAAAGGAAAGG - Intronic
1161236051 19:3198792-3198814 GTGGATAGAGAGCAGGGGAATGG - Intronic
1162769891 19:12943046-12943068 ATGGAGAGACAGCCAGGGACGGG - Intronic
1163447894 19:17358210-17358232 GTTGAGAGACAGCTTGGCGAGGG + Intronic
1163504578 19:17697955-17697977 GTGGAGAGAAAGCATGAAATTGG - Intergenic
1163632002 19:18422287-18422309 GTGGGAGGACAGTATGGGAAGGG - Intronic
1163676011 19:18655665-18655687 ATGGAGAGCCAGGATGGGAGGGG + Intronic
1164734226 19:30528944-30528966 GGGCAGAGACAGCCTGGGATAGG + Intronic
1165363640 19:35351305-35351327 GTGGAGAGAAAGCACAGGACTGG + Intergenic
1165365773 19:35363759-35363781 GTGGAGAGAAAGCACAGGACTGG + Intergenic
1165900050 19:39165124-39165146 GTAGACAGAAAGAATGGGAACGG + Intronic
1166147402 19:40847058-40847080 TTGCAGAGAGAGGATGGGAAGGG + Intronic
1166151551 19:40878943-40878965 TTGCAGAGAGAGGATGGGAAGGG + Intronic
1166170423 19:41024447-41024469 TTGCAGAGAGAGGATGGGAAGGG + Intergenic
1166178636 19:41091703-41091725 TTGCAGAGAGAGGATGGGAAGGG - Intronic
1166213017 19:41319544-41319566 GAGGAGAGACAGGGTGGGCATGG - Intronic
1166590888 19:43997618-43997640 GTTGGTAGACAGCAAGGGAAGGG + Exonic
1166790478 19:45396035-45396057 GTGAAGGGAGAGCGTGGGAACGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167024320 19:46904115-46904137 GTGGAGAGACAGCACTGGGATGG + Intergenic
1167291859 19:48629127-48629149 GTTGAGGGACAGGATGGGCAGGG - Exonic
1168102716 19:54149537-54149559 CTGGAGAGAGAGCATGGAAGAGG - Intronic
1168299087 19:55393147-55393169 CTGGAGGGACAGCAGGGGAGCGG - Intronic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925682923 2:6442042-6442064 GTGAACAGACAGAAGGGGAATGG - Intergenic
925762649 2:7200510-7200532 GTGAAGAGACAGCATGCGCCAGG - Intergenic
925923243 2:8652209-8652231 GTGCAGAGACCGCATGGTGAGGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926390678 2:12388968-12388990 GAGAAGAGACAGAATGGGACAGG - Intergenic
926717050 2:15933023-15933045 ATGGAAAGGCAACATGGGAAAGG + Intergenic
927067843 2:19491846-19491868 GTGGAAAGACAGCATAGGGGAGG + Intergenic
927312511 2:21647160-21647182 GAGGAGAGACTCCAAGGGAATGG - Intergenic
927362734 2:22255268-22255290 GGGGAGAGAGAGCATAGGATAGG + Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
927732604 2:25487836-25487858 GAGGAGAGGCAGGATGTGAAAGG + Intronic
928032747 2:27795702-27795724 GTGGTGAAACAGGATGGGAGCGG - Intronic
928424381 2:31166045-31166067 GAGGAGGAGCAGCATGGGAAAGG - Intergenic
928449731 2:31367549-31367571 GTGGAGGGAGAGCAGGGCAAAGG + Intronic
929151338 2:38751564-38751586 GGGGCGGGACAGCATGGGGAAGG - Intronic
929709082 2:44248098-44248120 GGGGAAAGAGAGCAAGGGAAGGG + Intergenic
930387240 2:50712275-50712297 ACGGAGATACAGCATTGGAAAGG - Intronic
931848009 2:66224665-66224687 GTGGCGAGGCAGCATGGGATGGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
934553740 2:95276894-95276916 CTGGGGAGGCAGGATGGGAATGG + Intronic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934837544 2:97604486-97604508 ACGGAGAGACAAAATGGGAATGG + Intergenic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
936724497 2:115296484-115296506 TTGAAGAGAGAGCAGGGGAATGG + Intronic
936995072 2:118404787-118404809 GAGCAGAGAAAGGATGGGAATGG + Intergenic
937296036 2:120810458-120810480 GAGGAGGGACAGCAATGGAAGGG - Intronic
938106038 2:128530423-128530445 GTGGTGAGACAGGAAGAGAAGGG - Intergenic
938265737 2:129926912-129926934 CTGGAAACACAGCATGGGAAAGG + Intergenic
940612453 2:156007387-156007409 GTGGAGACTCAGCTTGGGATGGG - Intergenic
940663626 2:156578622-156578644 GTGGCTAGAGATCATGGGAAGGG + Intronic
941239779 2:163022820-163022842 GAGGAGAGAAAGAATGGGAATGG - Intergenic
942141798 2:172984596-172984618 GTGGAGAGTAAGGATGGCAAGGG - Intronic
942626228 2:177903476-177903498 TTGGATAGACAGCATGTGAAGGG + Intronic
943384312 2:187183148-187183170 CTGGAGAACAAGCATGGGAATGG - Intergenic
943395683 2:187329671-187329693 GAGGAGAGAGAGCAAGTGAAGGG - Intergenic
943731300 2:191306114-191306136 GTGGAGAAACAACGTGGGGAAGG + Intronic
944042368 2:195370091-195370113 GTGGAGGGAGAGGATGGGAGTGG + Intergenic
944205902 2:197158028-197158050 GTGGAAACAGAACATGGGAAAGG + Intronic
946054511 2:216889114-216889136 AGGGAGAGACAGCAGGGGAGGGG + Intergenic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
947900047 2:233713657-233713679 GAGCAGAAACAGCATGGCAAAGG - Exonic
948388951 2:237598380-237598402 GGGGAGAGAGAGCAGGGGAGTGG - Intronic
948791585 2:240380883-240380905 GGCGAGAGAGAGCATGCGAAGGG - Intergenic
1169308017 20:4510512-4510534 GTTGTGAGCAAGCATGGGAAGGG + Intergenic
1169650327 20:7859564-7859586 GTAGAGAGAAAGGATGAGAAGGG + Intergenic
1169838830 20:9911419-9911441 GTGAACAGACAGCATGGCATTGG - Intergenic
1171040336 20:21756955-21756977 GCGGAGAGAGAACATGAGAAGGG - Intergenic
1171411851 20:24952953-24952975 GAGGAGAGAAAACATGGGCAGGG - Intronic
1171428564 20:25064150-25064172 CAGGAGAGGCAGCTTGGGAATGG - Intergenic
1171727441 20:28638107-28638129 GTGGAGACACAGCATAGAAATGG - Intergenic
1171750797 20:29046512-29046534 GTGGAGACACAGCATGGAAATGG + Intergenic
1171902131 20:30867990-30868012 ATGGAGAGACTGCAGGGGACAGG + Intergenic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1173406358 20:42769335-42769357 GTGGAGAGACAGCTAGGCAAAGG + Intronic
1173423395 20:42922858-42922880 GTGAGGAGACAGCAGGGTAAGGG - Intronic
1173788881 20:45814677-45814699 GGGGACAGACAGCAAGGAAATGG + Intronic
1174140272 20:48408280-48408302 GTGGAGAGCCAGCCAGGGAAAGG - Intergenic
1174276444 20:49407921-49407943 GTGGGGAGAAAGCATGGTGACGG - Intronic
1174905246 20:54543607-54543629 GAGGAGAGAGAGGAGGGGAAGGG + Intronic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175624617 20:60480108-60480130 GTGGGGAGGCAGGATGGGTAGGG - Intergenic
1176313964 21:5224408-5224430 GTGGAGACACAGCATGGAAATGG - Intergenic
1179007579 21:37529028-37529050 ATGGGGAGACAGCAGGGGAGGGG - Intergenic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1180081860 21:45490813-45490835 CTGGAGAGACAGGAAGGAAATGG - Intronic
1180231752 21:46430556-46430578 CTGGAGAGTGAGCAGGGGAAGGG + Exonic
1180245816 21:46546608-46546630 GGGCAGCGTCAGCATGGGAAAGG - Intronic
1180335507 22:11573925-11573947 ATGGAGAGACTGCAGGGGACAGG + Intergenic
1181350168 22:22249501-22249523 GGGGAGAGAGAGAATCGGAAAGG - Intergenic
1181534079 22:23532881-23532903 GGGCAGAGACAGCCTGGGGAAGG + Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181749602 22:24979779-24979801 GTGGGGAGGCGGCATGGGATGGG - Intronic
1182519383 22:30876688-30876710 GTGGGGAGCCAGGATGGGAAAGG + Intronic
1182866189 22:33606584-33606606 GTGGAGAGAGAGCACGGGGTAGG - Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1183263956 22:36814386-36814408 GGGGAGAGACAGGATGGGTGGGG + Intronic
1183434224 22:37783903-37783925 GGGGAGAGACTGCATGAGATTGG - Intergenic
1183773578 22:39947657-39947679 GGGTGGAGACAGCTTGGGAAAGG + Intronic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1185184737 22:49392198-49392220 GTGGAGAGACATGATGGGGAGGG - Intergenic
949245573 3:1922618-1922640 CTGGAGAACAAGCATGGGAATGG + Intergenic
950181699 3:10918073-10918095 GCATAGAGCCAGCATGGGAAGGG - Intronic
951330068 3:21356260-21356282 GTCCAGAGTCAGTATGGGAAGGG - Intergenic
951370925 3:21846721-21846743 TTAGAGAGAGAGGATGGGAAAGG + Intronic
952303565 3:32125756-32125778 GTGGTAATACAGCAGGGGAAAGG - Intronic
952537362 3:34324967-34324989 TTTGAGAGACAGTATGGGTATGG - Intergenic
954223363 3:49167717-49167739 GTGGAGAGAAAGCAAGAGTAGGG + Intergenic
954392430 3:50274674-50274696 GTGGAGACACAGCCCAGGAAAGG - Intronic
954995222 3:54875173-54875195 CTGGAGAGACACTCTGGGAAGGG - Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955406976 3:58631665-58631687 GTGGAGGAGCAGGATGGGAAAGG + Intergenic
955746877 3:62149116-62149138 TGGGAATGACAGCATGGGAATGG - Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
959077068 3:101760473-101760495 TTGTAGAGAGAGCAGGGGAAGGG + Intronic
959377686 3:105605460-105605482 ATGGAGAACCGGCATGGGAATGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960811519 3:121631683-121631705 GGGCAGAGACAGCATGGGGAAGG - Exonic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962893373 3:139692454-139692476 CAGGAGAGCAAGCATGGGAAAGG + Intergenic
963932456 3:151017785-151017807 GGGGAAAGACAGAAGGGGAAAGG - Intergenic
964656594 3:159073660-159073682 GTGGAGAGACTGAATTGGATGGG - Intronic
966099472 3:176249189-176249211 GTGGTGAGACAGCAGGTGACTGG - Intergenic
966445378 3:179996266-179996288 CTGGAGAGCAGGCATGGGAATGG + Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967528848 3:190525964-190525986 GTGAAGAGTAAGCATGTGAAAGG + Intronic
968731979 4:2273478-2273500 GTCGAGAGAGATCAGGGGAAGGG + Intronic
970125111 4:12800331-12800353 GTTAAGAGACAGCTTGGTAATGG - Intergenic
970544293 4:17111578-17111600 GTGCTAAGACAGCATGGCAAAGG + Intergenic
970688515 4:18595397-18595419 GTGGAGAAGCAGCACAGGAAAGG + Intergenic
971420091 4:26466821-26466843 GTGCAGAGAGATCATGGGAAGGG - Intergenic
971692651 4:29857566-29857588 GTGAAGAGACAACCTAGGAATGG + Intergenic
972311616 4:37888617-37888639 GTGGAGTGGCAGGATGGGAGGGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
973780704 4:54285827-54285849 GTGGACACACTGCATGGAAAAGG - Exonic
975201557 4:71596249-71596271 TTGGAGAGAGAGAAAGGGAAGGG + Intergenic
975628122 4:76370392-76370414 GTAGAGAGAAAGGATTGGAAAGG + Intronic
975662193 4:76699003-76699025 GTGGAAAGTCACCATGGGGAGGG - Intronic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
977902622 4:102439551-102439573 GTGGAGAGGCAGAAAAGGAAGGG + Intergenic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
978341954 4:107728560-107728582 CTGGAGAACAAGCATGGGAATGG - Intergenic
978553279 4:109950742-109950764 GAGGAGAGACAGCTGGTGAAGGG - Intronic
978631604 4:110753415-110753437 GAGCAGAGCCAGCATGGGCATGG + Intergenic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
980892875 4:138833512-138833534 GTGGAGAGAGAGCAGGAGAGAGG - Intergenic
981848675 4:149201333-149201355 GTGGGGAGAGAGCATGGACAAGG + Intergenic
983056702 4:163105538-163105560 GTTTAGAGACAGCATGAGATAGG - Intergenic
983180003 4:164636517-164636539 GGGGAGGGATAGCATGGGGAGGG + Intergenic
984420256 4:179512219-179512241 GTGGGTAGATGGCATGGGAAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984958630 4:185071867-185071889 GTGGGGAGGCATCAGGGGAAAGG - Intergenic
985433157 4:189900941-189900963 GTGGAGACACAGCATAGAAATGG + Intergenic
985641330 5:1064759-1064781 GTGAAGGGACAGCAAGGGGACGG + Intronic
986021996 5:3812946-3812968 GTGGGGAGGCAGGATGGGAGTGG + Intergenic
986114486 5:4758465-4758487 GTGAAGAGACTACATGGGAATGG - Intergenic
986216505 5:5724439-5724461 GAGGAGAGTCAGCTTGGGGAAGG - Intergenic
986375993 5:7131533-7131555 GAGGAGAGAGATCAAGGGAAAGG - Intergenic
986506069 5:8452796-8452818 GTTGAGAGACAGGACAGGAATGG - Intergenic
986674277 5:10169423-10169445 CTGGATAGACAGCATGGTTAGGG - Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
988358875 5:30210480-30210502 GGGGAGAGAAAGGAAGGGAAGGG - Intergenic
988491961 5:31712519-31712541 CTGGAGAGACTGGATGGAAAAGG - Intronic
989553491 5:42763471-42763493 GTGAAGACACAGTATGGAAAGGG + Intronic
990165134 5:52986522-52986544 GTGTAAAGACAGAATTGGAATGG + Intergenic
990175060 5:53098794-53098816 GACGAGAGACATCATGGGCAAGG + Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991663044 5:68969575-68969597 CTGGGGAGACTGCAAGGGAAGGG - Intergenic
992386012 5:76285163-76285185 GTGGAGCTTCAGCATGGGATCGG + Exonic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993724115 5:91348871-91348893 GTGGAGAGAGAGCTTGTGCAGGG + Intergenic
994095686 5:95845484-95845506 AGAGAGAGACAGCAAGGGAAGGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
998096112 5:139396296-139396318 GTGGAGAAACAATCTGGGAAGGG - Intergenic
998176491 5:139904793-139904815 GTGGGGAGACAGCGAGGAAAGGG + Intronic
998671238 5:144356718-144356740 GTGGGGAGAAAGGCTGGGAAAGG + Intronic
1000537132 5:162493126-162493148 CAGGAGAAATAGCATGGGAATGG + Intergenic
1000611669 5:163381850-163381872 GTGGTGAGACATAAAGGGAAAGG + Intergenic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1002087773 5:176786445-176786467 TTAGAGAGACAGCATGGGTTGGG - Intergenic
1002360839 5:178669581-178669603 GTTCAGTGACAGCATGGAAATGG + Intergenic
1002874486 6:1199537-1199559 GTGGAGAGAGACCCAGGGAAGGG + Intergenic
1003577498 6:7311361-7311383 GTGGATAAAAAACATGGGAAGGG + Intronic
1003614823 6:7645440-7645462 GTGGAGAGAGAACAAGAGAATGG - Intergenic
1003863823 6:10345826-10345848 GAGGGGTGACTGCATGGGAAAGG + Intergenic
1004249952 6:14015619-14015641 GAGGAGAGAGAGCAGAGGAATGG - Intergenic
1004321012 6:14631549-14631571 GTGCAGAGAAAGCATAGGACAGG - Intergenic
1004321523 6:14635174-14635196 GTGGAGAGAGAGAATGAGAGAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1006062047 6:31430862-31430884 GTGGAGAACAGGCATGGGAATGG + Intergenic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1007153804 6:39722996-39723018 GTCAAGAGACAGGATGGGTAGGG - Intronic
1007373467 6:41441841-41441863 GAGGAGGGGCAGTATGGGAAGGG + Intergenic
1008626768 6:53324770-53324792 TTGGAGAGAAAGCAGAGGAATGG + Intronic
1009745352 6:67806304-67806326 GTGAAGAGACAACATCAGAATGG + Intergenic
1010274862 6:73957581-73957603 GTGAAGAGCCAGCCAGGGAATGG - Intergenic
1010706099 6:79112623-79112645 GTTGAGAGGTAGGATGGGAAGGG - Intergenic
1010854251 6:80817598-80817620 GTTCAGAGAGAGCAGGGGAACGG - Intergenic
1012026058 6:93993283-93993305 GTGCAGAGATAGCATGTGAAAGG + Intergenic
1012329936 6:97972804-97972826 GTGTAGAGGATGCATGGGAAGGG - Intergenic
1012535191 6:100287570-100287592 TTGGAGAGGCAGCTGGGGAAGGG + Intergenic
1012709161 6:102576513-102576535 GTGCAGAGGCAGCATAGGTATGG - Intergenic
1012730172 6:102872041-102872063 CTGGAGAACAAGCATGGGAATGG + Intergenic
1014142638 6:117962216-117962238 GCTGATAGACAGGATGGGAAAGG - Intronic
1014245313 6:119061757-119061779 GTGATGAGAGAGGATGGGAAGGG + Intronic
1015090538 6:129352034-129352056 GTTGAGAGACAGTAGGGGATTGG - Intronic
1015475436 6:133655021-133655043 CTGGAGAACAAGCATGGGAATGG + Intergenic
1015771191 6:136769872-136769894 GTGGAGAGAAGGGAAGGGAAAGG + Intronic
1015891757 6:137976779-137976801 GTAGGGAGGCAGGATGGGAAAGG - Intergenic
1016219905 6:141655309-141655331 CTGGAGAACAAGCATGGGAATGG + Intergenic
1018160558 6:161038055-161038077 GAGGAGAGAAAGCGTGAGAAAGG - Intronic
1020901542 7:14009572-14009594 GGAGAGAGAAAGCAAGGGAAAGG + Intergenic
1021431668 7:20566461-20566483 GTGAAAAGACAACATAGGAATGG + Intergenic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1021666700 7:22989079-22989101 GTGGAAAGAGAGCATGTTAAAGG - Intronic
1021931974 7:25590027-25590049 GGGTAGAGACAACATAGGAAGGG - Intergenic
1022208896 7:28189245-28189267 GGGGAGAGTGAGGATGGGAATGG - Intergenic
1022431837 7:30331623-30331645 GTGGAGAGGCAGTATTTGAAGGG + Intronic
1022500405 7:30878982-30879004 GTGAAGGGACAGGATTGGAAAGG - Intronic
1022847010 7:34220457-34220479 GTGAAGGGAAAGGATGGGAAAGG - Intergenic
1023268009 7:38428984-38429006 TTGAAGAGAAAGCATGTGAAAGG - Intronic
1023740749 7:43278621-43278643 GTGGAGAGAGAGGAGGGGAAGGG - Intronic
1024458058 7:49631327-49631349 AGGGAAAGACAGCATGTGAAAGG + Intergenic
1026258442 7:68733273-68733295 GAGGAGACACAGTATGTGAAAGG - Intergenic
1026494106 7:70887993-70888015 GTGGAGGGACAGATTGGGAAAGG + Intergenic
1026511695 7:71032849-71032871 TTGGGGGGAAAGCATGGGAAGGG + Intergenic
1026592934 7:71712223-71712245 GCGGAGAGACAGCAAGGGGCCGG + Exonic
1026864284 7:73813496-73813518 GTGGAGACACAGCAAGGTAGTGG - Intronic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027267906 7:76504196-76504218 GTGGAGGGAAACCAGGGGAAAGG - Intronic
1027319717 7:77004058-77004080 GTGGAGGGAAACCAGGGGAAAGG - Intergenic
1029503966 7:100950893-100950915 GCAGAGAGACAGCATAGAAAAGG - Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1030059124 7:105609141-105609163 ATGGACAGACACCATGGGCAAGG + Intronic
1030933534 7:115555782-115555804 AGGCAGAGACAGCATGTGAAAGG + Intergenic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031776838 7:125916124-125916146 GTGCAGAGACAGCAATGAAAAGG - Intergenic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032535440 7:132659416-132659438 GTGAAGAGAGAGCATGAGACTGG + Intronic
1035401296 7:158567693-158567715 GGGTAGAGACAGCATGGTCAGGG + Intronic
1035631211 8:1107787-1107809 GTGGAAACACAGCATAGGATGGG - Intergenic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1037339848 8:17832699-17832721 TTGGAGAGAGGGAATGGGAAAGG - Intergenic
1037992423 8:23330462-23330484 GTGGGAAGACAGCTTGGGAAGGG - Intronic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1039567780 8:38563819-38563841 CAGGAGAGACAGCAAGGCAAAGG - Intergenic
1040598507 8:48862527-48862549 GTAGAGAAACAGCTTGGGAGAGG + Intergenic
1041100208 8:54389196-54389218 GTGGAGACAAAGAATGGAAATGG - Intergenic
1042185701 8:66134698-66134720 GTGGAAATACACCATGGAAATGG + Intronic
1042525012 8:69755336-69755358 GTGGGTAGACAGCATGGGCCTGG + Intronic
1042840479 8:73118466-73118488 GTGCTGAGAGAGCATGGGGAAGG - Intronic
1043994750 8:86799351-86799373 GTGGAGAATCATCAGGGGAAGGG - Intergenic
1045345772 8:101292246-101292268 GTGGAGAGGCCACATGGGGAGGG - Intergenic
1046214437 8:111125307-111125329 GTGGAAAGACAGGATAGAAATGG - Intergenic
1046627796 8:116593658-116593680 GTGAAGAGCCAGCCAGGGAATGG + Intergenic
1046834474 8:118784374-118784396 GAGGAGACACAGCGTGGAAAAGG - Intergenic
1047554835 8:125918124-125918146 CTTGAGAGATAGCATGGAAAGGG - Intergenic
1049248719 8:141576891-141576913 GTGGAGAGAAAGCGTGGGCTTGG + Intergenic
1049259480 8:141631128-141631150 GTTCAGGAACAGCATGGGAAAGG + Intergenic
1050447350 9:5739431-5739453 CTGGAGAGTAGGCATGGGAATGG - Intronic
1050560458 9:6829626-6829648 GAGTAGAGACAGAATAGGAAAGG - Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051428617 9:16959937-16959959 GTGGAGAGAAAGGGAGGGAAAGG - Intergenic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1052330245 9:27260299-27260321 GTGTAAAGACAGCAAGGGAAAGG + Intergenic
1052988415 9:34504220-34504242 GTGGTGGGACAGAGTGGGAAGGG - Intronic
1053722299 9:40958996-40959018 GTGGAGACACAGCATAGAAATGG + Intergenic
1054343670 9:63893002-63893024 GTGGAGACACAGCATAGAAATGG - Intergenic
1054747390 9:68868558-68868580 GTGGCAATAAAGCATGGGAATGG + Intronic
1054824311 9:69556791-69556813 GTGCAGAGGCAGCGTGGAAAAGG + Intronic
1055844673 9:80546842-80546864 GTGGAAAGGCAGAATAGGAATGG + Intergenic
1056066650 9:82942408-82942430 GAGGAGAAAGAGGATGGGAAGGG + Intergenic
1056491174 9:87108737-87108759 GTGATGTGACAGCCTGGGAAGGG - Intergenic
1056795765 9:89657906-89657928 GCGGTGACACAGCATGGGCATGG - Intergenic
1056799959 9:89684065-89684087 GGGGAGAGAGCACATGGGAAGGG + Intergenic
1057549062 9:96038949-96038971 ATGGAGAGCCCACATGGGAAGGG + Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG + Intergenic
1058690248 9:107514305-107514327 TTGTAGAGACAGCAGGGGGAGGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059709798 9:116857005-116857027 GTGGAGAAAAATAATGGGAAAGG - Intronic
1059927727 9:119228146-119228168 GTGGAAAGAGAGAAAGGGAAGGG - Intronic
1060026005 9:120172097-120172119 GTGGAGGGGGAGCTTGGGAAAGG - Intergenic
1060046378 9:120344583-120344605 CTGGAAAGACAGCAAGGGCAGGG - Intergenic
1060276456 9:122186587-122186609 GTGGGGAGAGAGGATGGCAATGG - Intronic
1060783406 9:126430416-126430438 ATGGAGAGGCAGCTTGGGAGTGG - Intronic
1060910265 9:127344022-127344044 GTGGAGAGCCAGCATTGCATGGG - Intronic
1061899089 9:133663849-133663871 ATGGATGGACAGCATGGGATGGG + Exonic
1203452877 Un_GL000219v1:136984-137006 GTGGAGACACAGCATAGAAATGG - Intergenic
1185708438 X:2282513-2282535 GGGGAGAGACAGGAAGAGAAAGG + Intronic
1185967458 X:4623957-4623979 GTGGAGGGAAAGGGTGGGAACGG - Intergenic
1186111890 X:6266429-6266451 GATGACACACAGCATGGGAATGG + Intergenic
1186784735 X:12946886-12946908 GTGGAGCGACAGCAAGGGATGGG + Intergenic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1191042433 X:56098144-56098166 GTGCAGAGACCACATGGAAAGGG - Intergenic
1191700068 X:64032931-64032953 CAGGAGAGACTGCATGGAAAAGG + Intergenic
1191864878 X:65695920-65695942 GTAGAGAGACAGCATGTACAGGG - Intronic
1191896420 X:65998098-65998120 TTGGGGAGGCAGTATGGGAATGG + Intergenic
1192661857 X:73050059-73050081 CTGGAGAAAAGGCATGGGAATGG - Intergenic
1194711175 X:97238068-97238090 CAGAAGAGACAGCAGGGGAAGGG + Intronic
1194911467 X:99650077-99650099 CTGGAGAACCGGCATGGGAATGG - Intergenic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1197176441 X:123491155-123491177 GAGGAGACAAAGAATGGGAATGG - Intergenic
1197957988 X:131973634-131973656 GCTGAGAGTAAGCATGGGAAAGG + Intergenic
1198827034 X:140709784-140709806 GTGGGGAGACAGCATGCCACTGG + Intergenic
1199214688 X:145251032-145251054 GTTGAGAGGCAGCATGGGGTGGG + Intronic
1199888175 X:152044400-152044422 TTTGAGATACAGCATGGCAATGG + Intergenic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1199950869 X:152705009-152705031 GCGGAGAGAAAGCTTGGAAATGG - Intergenic
1199953179 X:152721590-152721612 GCGGAGAGAAAGCATGGAAATGG - Intergenic
1199956503 X:152746856-152746878 GCGGAGAGAAAGCATGGAAATGG + Intergenic
1199958813 X:152763452-152763474 GCGGAGAGAAAGCTTGGAAATGG + Intergenic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200691346 Y:6308047-6308069 GTGGTGGGGCATCATGGGAAAGG + Intergenic
1200958032 Y:8971099-8971121 GAGGGGAGAAAGCATGTGAAGGG + Intergenic
1200979443 Y:9248416-9248438 GTGGTGGGGCATCATGGGAAAGG - Intergenic
1201043926 Y:9866669-9866691 GTGGTGGGGCATCATGGGAAAGG - Intergenic
1201131569 Y:10955590-10955612 GTGGAAAGAAAGCAATGGAATGG - Intergenic
1201138546 Y:11009138-11009160 GTCGAGAGAAAGGATTGGAATGG - Intergenic
1202364093 Y:24143216-24143238 GTGAAGTGGCAGGATGGGAAAGG + Intergenic
1202506687 Y:25526906-25526928 GTGAAGTGGCAGGATGGGAAAGG - Intergenic