ID: 927503602

View in Genome Browser
Species Human (GRCh38)
Location 2:23598723-23598745
Sequence CCCAGTCATAAGCAAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927503602_927503605 2 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503605 2:23598748-23598770 TGTTCATCATGCGTGGCCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 90
927503602_927503611 25 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503611 2:23598771-23598793 GCTGTCTTTCTTCCAATAATGGG 0: 1
1: 1
2: 1
3: 12
4: 200
927503602_927503604 -5 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503604 2:23598741-23598763 CTGGGAGTGTTCATCATGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 99
927503602_927503610 24 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503610 2:23598770-23598792 GGCTGTCTTTCTTCCAATAATGG 0: 1
1: 0
2: 0
3: 16
4: 130
927503602_927503606 3 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503606 2:23598749-23598771 GTTCATCATGCGTGGCCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 85
927503602_927503612 29 Left 927503602 2:23598723-23598745 CCTGTGTTTTGCTTATGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 927503612 2:23598775-23598797 TCTTTCTTCCAATAATGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927503602 Original CRISPR CCCAGTCATAAGCAAAACAC AGG (reversed) Intronic
902226045 1:14996972-14996994 CCCAGGGATCAGCAAAGCACAGG - Intronic
902637987 1:17747632-17747654 CCCAGGCAGAGGCAAAACTCAGG - Intergenic
903669502 1:25027166-25027188 CTCAGTCATATGCAAAAGACAGG - Intergenic
904903549 1:33876822-33876844 CCCATTCACAAGCAAAAGTCTGG - Intronic
904935111 1:34124595-34124617 CCCATTCATAAGCACAGCATGGG + Intronic
905687896 1:39921952-39921974 CCCAGGAACAAGCAAGACACTGG + Intergenic
907562883 1:55407029-55407051 CCCAGTCCTAAGCCAAGAACAGG - Intergenic
908578692 1:65490209-65490231 CCCAGTAATAAAAACAACACTGG - Intronic
909607037 1:77518149-77518171 CCCACTCATGTGCAAAGCACTGG - Intronic
911791698 1:102025208-102025230 CCCATTCATATAAAAAACACAGG - Intergenic
912042434 1:105409263-105409285 TCCAGTCAAGAGAAAAACACTGG + Intergenic
913218382 1:116639436-116639458 CCTACTCCTAAGCAAACCACAGG + Intronic
918732413 1:188014401-188014423 CCTAATCATGAGGAAAACACTGG - Intergenic
920440567 1:205978000-205978022 TCCAGTGACAAACAAAACACAGG - Exonic
923496897 1:234533558-234533580 CGCAGTCTTAAGCACAAGACAGG + Intergenic
924385177 1:243493133-243493155 CCCAGTCTCAAACAAAAGACAGG - Intronic
1063155744 10:3377863-3377885 GCCAGTTACAAGCAAAACAGAGG - Intergenic
1067005028 10:42652548-42652570 GAAACTCATAAGCAAAACACAGG + Intergenic
1070457103 10:76628063-76628085 GTCAGACATAAACAAAACACAGG - Intergenic
1070964955 10:80524295-80524317 CCCACTCATAAGGAGAACAGAGG + Exonic
1074174782 10:110987154-110987176 CCCAGATACAAGCAAAACAATGG - Intronic
1075745380 10:124723924-124723946 CCCAGAGAGAAGCACAACACAGG - Intronic
1076499771 10:130928498-130928520 TCCAGTCATAAGCAGAAGGCAGG + Intergenic
1078648494 11:13164834-13164856 CCCTGTGAAAAGCAAGACACAGG - Intergenic
1078727853 11:13947889-13947911 AGCAGTCATAAGCAATATACAGG - Intergenic
1080020895 11:27559009-27559031 CAGAGTCATAAGCCAATCACTGG + Intergenic
1080106848 11:28519979-28520001 CCCAGTGATATGCTAAAAACTGG - Intergenic
1080720692 11:34845539-34845561 CACAGTCATATGCCAAAGACTGG - Intergenic
1081058136 11:38436738-38436760 CCAAGTCAAAAGCAGAACAGGGG + Intergenic
1084534830 11:69750523-69750545 CCTATTCATGTGCAAAACACAGG - Intergenic
1085730264 11:78991835-78991857 CCCAGACCCAGGCAAAACACTGG + Intronic
1086572498 11:88301576-88301598 ACCAGTAACAAGCATAACACAGG + Intronic
1087280783 11:96207613-96207635 CACAGTCAAAAGAAAAACAGAGG + Intronic
1087464807 11:98490787-98490809 ATCAGTCAAAAACAAAACACTGG - Intergenic
1088024557 11:105162170-105162192 CACAGTAACAAGGAAAACACAGG + Intergenic
1090455176 11:126842820-126842842 CCCTGTCATAGACAGAACACTGG + Intronic
1091127235 11:133111367-133111389 CCCAGCCAGAAGCAAAAGAAAGG - Intronic
1092962300 12:13608056-13608078 CCCATTCATCAGCACCACACAGG + Intronic
1095446612 12:42288567-42288589 CACAGGCACAAGCAAAACAACGG + Intronic
1098566843 12:71946708-71946730 CCCAGTCCTGAGACAAACACAGG + Intronic
1100727268 12:97421788-97421810 TCCAGTAATAAGCAAAAGAGAGG + Intergenic
1102220560 12:111191629-111191651 ACCAGTCATAAGAATAACAGTGG - Intronic
1103134271 12:118494062-118494084 CCCAGTCATAAAAAAATCCCAGG - Intergenic
1103791496 12:123475191-123475213 CACAGACAGAATCAAAACACTGG + Intronic
1104062640 12:125281283-125281305 CCACCTCAGAAGCAAAACACAGG - Intronic
1106624378 13:31405505-31405527 ATCAGTCAAAAACAAAACACTGG + Intergenic
1109665617 13:65531824-65531846 CCCAGTCATAATAAAAATGCTGG + Intergenic
1115576028 14:34713164-34713186 CCCATTTATAAGAAAAACAAAGG + Intronic
1117993141 14:61454468-61454490 CCCAGACAAAAGCATAACCCAGG - Intronic
1119643379 14:76330686-76330708 CCCCATCAGAAACAAAACACAGG + Intronic
1120223865 14:81767798-81767820 TCCAGTCACAAGCCAAAAACAGG - Intergenic
1125470183 15:39994695-39994717 CCCTGTCAGAACCAAAACCCAGG - Intronic
1127579167 15:60321616-60321638 CCCACTTATAAGCAAGACCCTGG - Intergenic
1131024729 15:89130530-89130552 TCTAGTGATAAGCAAAAAACAGG - Intronic
1131105110 15:89728644-89728666 CCCAGTTATCAGCACAACACTGG + Intronic
1132381960 15:101372241-101372263 CCCCGTAATAAGCCAAGCACCGG - Intronic
1135420472 16:22302567-22302589 CCCAGCCATGATTAAAACACTGG - Intronic
1138113675 16:54343601-54343623 GCCAGTCCTAAGCCAGACACTGG - Intergenic
1146418033 17:32655291-32655313 CACAGTAATAAGCAAAACAAAGG + Intronic
1152942496 17:83180243-83180265 CCAATTCATAAGAAAAAGACAGG + Intergenic
1154043730 18:10884546-10884568 CCAAGTGAGAAGCAAAGCACTGG + Intronic
1156455749 18:37292975-37292997 CCCTCTCATAGGCAAAACTCAGG + Intronic
1159451068 18:68602910-68602932 ACCATACATAAGCAAAACAGTGG + Intergenic
1159759845 18:72410583-72410605 CTGAGTCATCAGCAAAACACAGG + Intergenic
1168210533 19:54886823-54886845 TCTAGTCATGAGCAAAACATCGG - Intronic
926191870 2:10734432-10734454 TCTAATCATAAGCAAAAGACAGG - Intronic
927069016 2:19506018-19506040 CCCAGGTGGAAGCAAAACACAGG + Intergenic
927503602 2:23598723-23598745 CCCAGTCATAAGCAAAACACAGG - Intronic
928692254 2:33812087-33812109 ACCAGTCATAGGAAAAGCACAGG + Intergenic
928843845 2:35644721-35644743 CCCAGTGGAAAGCAACACACTGG + Intergenic
932377640 2:71251670-71251692 CCAGGTAATAAGCATAACACTGG + Intergenic
933467427 2:82672305-82672327 GCTAGTCATCAGCAAAAGACAGG + Intergenic
935021995 2:99240625-99240647 CCTAGTCATAAAGAGAACACTGG + Intronic
936324405 2:111492650-111492672 CCCAGTCATAAGCACATGTCTGG + Intergenic
937348490 2:121143348-121143370 CACATTCATGAGCAAAACATCGG + Intergenic
939726306 2:145725609-145725631 CACAGTCACATGCAAAACCCAGG + Intergenic
943630671 2:190248347-190248369 CCCACTCCTAAGCAATACATTGG - Intronic
943792550 2:191950360-191950382 CACAGACAGAAGCAAAATACAGG - Exonic
947413322 2:229866873-229866895 TCCAGTCAAAAGCAGAATACAGG + Intronic
1169306235 20:4492870-4492892 CTCAGTCATAATCTAAACTCAGG - Intergenic
1169513146 20:6287027-6287049 TCCAGTCATAAGGAAAAAAATGG + Intergenic
1169689031 20:8309463-8309485 TCCAGTCATAAGAAAAACACTGG - Intronic
1170240940 20:14165266-14165288 CCTAGTCATAGGAGAAACACAGG - Intronic
1171470875 20:25370282-25370304 CCCAGTCACAACCAAAGCACTGG + Intronic
1173694173 20:44993582-44993604 GCCAGTCAGAAGCAAATGACAGG - Intronic
1173982127 20:47232665-47232687 CCCATTCATAAGCAAACAGCTGG + Intronic
1174424625 20:50423346-50423368 CCCAGTGATTAGCAAACCGCAGG - Intergenic
1176875463 21:14122430-14122452 GAAACTCATAAGCAAAACACGGG + Intronic
1176986208 21:15440132-15440154 TACAGTCTTCAGCAAAACACAGG - Intergenic
1177534057 21:22401620-22401642 ATCAGTCAAAAGCAAAACACTGG + Intergenic
1177864732 21:26499543-26499565 GCAAGGCAAAAGCAAAACACAGG + Intronic
1183084753 22:35479990-35480012 CCCTGTCCTAAGCACATCACAGG + Intergenic
1183565859 22:38614927-38614949 CACAGTCATATGCTAAGCACAGG + Intronic
1184418603 22:44366329-44366351 CGCCGTCATAACCAAAACACAGG - Intergenic
1184507960 22:44915654-44915676 CCCAGCCATAAGCAAGAGAGGGG + Intronic
1184888777 22:47367007-47367029 CACAGATATTAGCAAAACACAGG - Intergenic
949966606 3:9362092-9362114 TCCAGTCAGAAGCCAAAAACAGG - Intronic
951279221 3:20726863-20726885 CCCAGTTATATCCAAAAGACAGG - Intergenic
952653265 3:35751970-35751992 CCCACTCATAAGAAAAGAACTGG + Intronic
952834253 3:37590556-37590578 CACAGTTATAAGCAGAACAAGGG - Intronic
953020686 3:39111127-39111149 CCCAGGCACTGGCAAAACACCGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954829656 3:53409312-53409334 CCCAGTCATAAATATAACACAGG - Intergenic
957954290 3:87163897-87163919 CACTGTCATAAGAAAAGCACGGG + Intergenic
958270952 3:91499088-91499110 GCCAGTCATAAACAAAATACAGG + Intergenic
961905831 3:130262092-130262114 TTCAGTCATTAGCAAAGCACAGG - Intergenic
964904620 3:161704677-161704699 TCCAGTCATTTGCAAAACATAGG + Intergenic
967223113 3:187265901-187265923 TCCAGTCATAACCTAAACAGAGG + Intronic
975140889 4:70917179-70917201 ATCAGTCAAAAACAAAACACTGG - Intronic
976972126 4:91116750-91116772 CCAAGTGATAAACAAAAAACAGG + Intronic
978903924 4:113984438-113984460 CACAGTCATGAGAACAACACGGG - Intergenic
980393607 4:132178770-132178792 CCACTGCATAAGCAAAACACAGG + Intergenic
983098227 4:163591729-163591751 CCGAAACATAAACAAAACACTGG - Intronic
983571929 4:169218513-169218535 CCAAAACAAAAGCAAAACACTGG + Intronic
983575091 4:169252747-169252769 CGTATTCATAAGCAAAACACAGG + Intronic
984712079 4:182894331-182894353 ACCATTCAAAAACAAAACACGGG + Intronic
985141586 4:186845480-186845502 CACAGTCACTAGCAAATCACAGG - Intergenic
986928596 5:12790926-12790948 ACCTGTCAAAAGCCAAACACAGG - Intergenic
990440570 5:55840815-55840837 TACAGGCATAAGAAAAACACAGG - Intergenic
994023223 5:95051927-95051949 CCCAGTAATAAGCATAGTACTGG - Intronic
994057267 5:95432030-95432052 CCCCATCATAAGGGAAACACAGG - Intronic
997468882 5:134105604-134105626 CCCAGTCATGAGCAAGACGGAGG + Intergenic
999720754 5:154397748-154397770 CCCAGAGATAAGGAAAAGACTGG - Intronic
1003498556 6:6685802-6685824 CCCTGTCATAAGGACAAGACTGG + Intergenic
1004343529 6:14828105-14828127 CCCAGTTGCAAGCAAAACAGTGG + Intergenic
1006579780 6:35070177-35070199 ACCAGTCATAGTCTAAACACAGG - Intronic
1007877366 6:45120682-45120704 CCAAGTCAAAAGCAAATAACTGG + Intronic
1008636373 6:53415022-53415044 CCCTGCCTTAAGCAAACCACTGG + Intergenic
1008984188 6:57522239-57522261 CCAAGTCATAAACAAAATACAGG - Intronic
1009172247 6:60415117-60415139 GCCAGTCATAAACAAAATACAGG - Intergenic
1013086455 6:106861832-106861854 CACAGTCATGAGAACAACACAGG - Intergenic
1016203404 6:141441693-141441715 GCCAGTCATGAGAAAAACATCGG - Intergenic
1018368380 6:163145505-163145527 TCCTGTCCTATGCAAAACACTGG + Intronic
1020393747 7:7689155-7689177 CCCATTCCTAAGCCAATCACTGG - Intronic
1021401126 7:20210463-20210485 CCCAGTGCTAAGCAAAATACAGG + Intronic
1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG + Intergenic
1022862194 7:34379023-34379045 ATCAGTCATAAACAAAACATTGG - Intergenic
1022973029 7:35534636-35534658 CTCACTCATAAGCTAAACATTGG - Intergenic
1023571324 7:41575545-41575567 CCAGGTAATAAGCAAAATACTGG + Intergenic
1023949271 7:44829081-44829103 CACATTCATAGGCATAACACTGG + Intronic
1024617352 7:51126990-51127012 CCCAGTCATAAGCATATGCCTGG - Intronic
1025115745 7:56256423-56256445 AGCAGTCATGAGCAAAACTCGGG + Intergenic
1025617145 7:63130616-63130638 CCCAGACACAGGCTAAACACAGG + Intergenic
1027259629 7:76455564-76455586 CCCAAGCAGAAGCAAGACACTGG + Intergenic
1027282845 7:76621330-76621352 CCCAAGCAGAAGCAAGACACTGG - Intronic
1027310999 7:76953652-76953674 CCCAAGCAGAAGCAAGACACTGG + Intergenic
1028113837 7:86974941-86974963 CCAGGTCATAAGTAAGACACAGG + Intronic
1030609383 7:111672057-111672079 ACCATTCTTAAGCAAAACAAAGG + Intergenic
1032590865 7:133191158-133191180 CCCAGCCATACCCAAAACTCTGG + Intergenic
1033885251 7:145936243-145936265 TCCAGACAGAAGAAAAACACTGG + Intergenic
1034299274 7:150001089-150001111 CCCAGGAAAAAGCAGAACACCGG + Intergenic
1034435449 7:151060891-151060913 CCCAGTCCCCAGCAACACACTGG + Intronic
1034806740 7:154095684-154095706 CCCAGGAAAAAGCAGAACACCGG - Intronic
1035740459 8:1924256-1924278 CTCACTGAGAAGCAAAACACAGG + Intronic
1037422593 8:18719421-18719443 CCCTGGCAGAAGCAAAAGACAGG + Intronic
1038886641 8:31669850-31669872 ACCAGTCGCAATCAAAACACAGG - Intronic
1039107106 8:34001808-34001830 CCAAGTTATAAGGGAAACACAGG - Intergenic
1043131293 8:76465324-76465346 CCTGGTTATAAGCAAAACTCAGG - Intergenic
1044953004 8:97451799-97451821 TCAAATCAAAAGCAAAACACTGG + Intergenic
1045203418 8:100011029-100011051 CCCAAGCAGAAGCAAAACACAGG + Intronic
1047605004 8:126466076-126466098 TGGAGTCATAAGCAAAACTCAGG + Intergenic
1055636322 9:78282581-78282603 GCCAAACATAAGCCAAACACTGG + Intergenic
1055944602 9:81681611-81681633 CCCATTCTTCAGCAGAACACAGG + Intronic
1057376704 9:94530957-94530979 CCCACTCATAAGCAAAAACATGG - Intergenic
1059709236 9:116852224-116852246 GCCAGGCATGAGCAAAACCCAGG - Intronic
1061005374 9:127926088-127926110 CCCAGTCCTCAGCACAACCCTGG + Intronic
1061604755 9:131700299-131700321 CCCAGACATCTGCAACACACAGG + Intronic
1061645094 9:131994683-131994705 CCCAGTCAAAAACAAGACTCAGG + Intronic
1186296111 X:8150334-8150356 TCTAGTCATGAGGAAAACACTGG + Intergenic
1186986524 X:15020701-15020723 CCCAGTCCTAAACCAATCACTGG + Intergenic
1187547958 X:20270483-20270505 CCCAGTCAGAACCAAAATATTGG + Intergenic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1195169049 X:102247991-102248013 CCCAGTCATCTTCAACACACAGG - Intergenic
1195189808 X:102439098-102439120 CCCAGTCATCTTCAACACACAGG + Intronic
1196580448 X:117373163-117373185 CCCATTCATAACGATAACACAGG - Intergenic
1197243095 X:124140648-124140670 ATCAGTCAAAAACAAAACACTGG - Intronic
1199969221 X:152846620-152846642 CACAGTCATAAGCAAAGAAATGG - Intronic
1200888323 Y:8295651-8295673 CCCAGTCAGCAGCAACCCACTGG - Intergenic