ID: 927503683

View in Genome Browser
Species Human (GRCh38)
Location 2:23599170-23599192
Sequence CAGCCCAGAGTCCTTGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927503683_927503684 -8 Left 927503683 2:23599170-23599192 CCTGCGGCAAGGACTCTGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 927503684 2:23599185-23599207 CTGGGCTGAGCTCCAAGATACGG 0: 1
1: 0
2: 0
3: 20
4: 189
927503683_927503685 -7 Left 927503683 2:23599170-23599192 CCTGCGGCAAGGACTCTGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 927503685 2:23599186-23599208 TGGGCTGAGCTCCAAGATACGGG 0: 1
1: 0
2: 0
3: 3
4: 143
927503683_927503686 0 Left 927503683 2:23599170-23599192 CCTGCGGCAAGGACTCTGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 927503686 2:23599193-23599215 AGCTCCAAGATACGGGTTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927503683 Original CRISPR CAGCCCAGAGTCCTTGCCGC AGG (reversed) Intronic
900369498 1:2325001-2325023 CAGCCCCTCGTCCTTGCAGCAGG - Intronic
901026420 1:6280872-6280894 CAGCCCAAAGGCCTACCCGCTGG + Intronic
902886499 1:19408481-19408503 CAGCCCACAGTCTTTGTCCCTGG - Intronic
905670694 1:39788564-39788586 GAGCCCAGCCTCCTTGCCGTCGG - Exonic
906246011 1:44274784-44274806 CAGCCCAGAGTGCTTGCTGCTGG - Intronic
910227516 1:84951087-84951109 CACCCCAGAGAGCTTGCAGCTGG + Intronic
911027373 1:93448810-93448832 CCGCCCAGAGCCCTCGCCCCAGG + Intronic
913356633 1:117929586-117929608 CAGCCCAGAGCATTTGCAGCTGG - Exonic
914353604 1:146861778-146861800 CAGAACAGATCCCTTGCCGCAGG + Intergenic
917027883 1:170662329-170662351 CTGCCCAGATTCCTTGAAGCAGG - Intergenic
920703844 1:208237486-208237508 CACCCTGGAGTCCTTGCCGTAGG + Intronic
922723513 1:227910973-227910995 CAGCCCAGCATCCCTGCCGCAGG + Intergenic
922822773 1:228495258-228495280 CCTCACAGAGTCCTTGCTGCAGG + Exonic
923460309 1:234204461-234204483 CAGCCCAGAGTCCTTGGCAGGGG - Intronic
923551216 1:234965424-234965446 CAGCCCACAGTCCTGGAAGCAGG - Intergenic
1062812919 10:478964-478986 GAGCCCAGAGCGCTTGCCCCTGG - Intronic
1063161229 10:3420368-3420390 CAGCCCACAGTCCTGGGAGCTGG + Intergenic
1063491381 10:6466807-6466829 CAGCCCAGAGTCTTTCCAGCAGG - Intronic
1065408990 10:25400506-25400528 CAGCCCAGAGACCTTGTTCCTGG + Intronic
1069913796 10:71775116-71775138 CAGCCCAGGGCCCTTCCTGCTGG + Intronic
1070057889 10:72953082-72953104 CAACGCAGAGGCCTTGCCACTGG - Intronic
1070665251 10:78338038-78338060 CTGCCCAGAGCACTTGCAGCTGG - Intergenic
1071544738 10:86521103-86521125 CAGCCCCGAGTCCTTTCCCGTGG - Intronic
1075644704 10:124090019-124090041 CAGCCTAGGGACCTGGCCGCAGG + Intronic
1076235210 10:128858751-128858773 AAGCCCAGGGTCCTTCCCACTGG + Intergenic
1076241001 10:128907345-128907367 CAGCACAGAGACCTGGCCTCTGG + Intergenic
1077107192 11:847373-847395 CAGCCCAGGGGCCTTGCCAGCGG + Intronic
1077506499 11:2932099-2932121 CTGCCCACAGTCCCTGCCCCAGG + Intergenic
1077997647 11:7467786-7467808 CAGCCCAGAGTCATAGCCTTGGG + Exonic
1080533916 11:33203364-33203386 AAGCCCAGTGTACTTGCCCCAGG - Intergenic
1084235141 11:67782842-67782864 CTGCCCAGAGTCATGGCCTCAGG + Intergenic
1084667263 11:70583099-70583121 CAGCCCAGTGCCCCTGCCCCAGG - Intronic
1085711546 11:78833544-78833566 CTGCCCAGAGCCCTTGCTGCTGG + Intronic
1090839121 11:130473940-130473962 CAGCCCATGGTCCTTGTCCCCGG - Exonic
1091370379 11:135052537-135052559 CTGCCTAGAGTCCTCCCCGCAGG + Intergenic
1091635886 12:2196191-2196213 GACCCCAGACTCCTTGCCCCAGG - Intronic
1095329811 12:40945886-40945908 CAGAGCAGAGTCCTGACCGCAGG + Intronic
1097188430 12:57208229-57208251 CAGCCCAGAGGCCTCCCCCCAGG - Intronic
1097607714 12:61776351-61776373 CAGCCCAGGCTCCTTTCCGTTGG - Intronic
1099955541 12:89350083-89350105 CAGCCCACAGTTCTTCCTGCTGG + Intronic
1102713016 12:114944721-114944743 CAGCAAAGAGTCCTTGCTGCAGG + Intergenic
1105025836 12:132848400-132848422 CAGGACAGAATCCTTGCAGCGGG - Intronic
1106173379 13:27308222-27308244 CAGCCCAGAGCCCTTCCAGAAGG + Intergenic
1106197283 13:27504728-27504750 AAGCCCAGAGCCGCTGCCGCAGG + Intergenic
1110096342 13:71527622-71527644 GAGCACAGAGTCTTTGCCACTGG + Intronic
1113778185 13:112960842-112960864 CATCCCAGGGTCCTTCCAGCAGG - Intronic
1114581878 14:23768401-23768423 CAGCCCAGAGTATTTGCTTCTGG + Intergenic
1118004578 14:61553987-61554009 CAGCCCACAGTGATTGCCCCCGG + Intronic
1118024291 14:61753291-61753313 CAGCCCAGGGTGCTCCCCGCAGG + Intergenic
1118314958 14:64720475-64720497 CATCTCAGAGTCCTTCCAGCAGG + Intronic
1120997525 14:90427879-90427901 AATCCCAGAGGCCTTGCCGGGGG + Intergenic
1122024067 14:98862071-98862093 CAGCCCCGAGTCTTTGATGCTGG - Intergenic
1122904741 14:104796441-104796463 CAGCCCAGAGCCCTCCCTGCTGG + Intergenic
1123671730 15:22665178-22665200 GAGCCTAGTGTACTTGCCGCTGG + Intergenic
1124138640 15:27057571-27057593 CAGCCCAGAGGCCTTTCCAGGGG - Intronic
1124323772 15:28738404-28738426 GAGCCTAGTGTACTTGCCGCTGG + Intergenic
1124434796 15:29638209-29638231 CAGCCCAGAGTGCCTGCTGCAGG + Intergenic
1124527664 15:30471645-30471667 GAGCCTAGTGTACTTGCCGCTGG + Intergenic
1124606610 15:31174250-31174272 CAGCCCAGGGTCCTGGCAGGAGG - Intergenic
1124770995 15:32536057-32536079 GAGCCTAGTGTACTTGCCGCTGG - Intergenic
1125717613 15:41828024-41828046 CTCCCCAGAGTCCCCGCCGCAGG - Intergenic
1128300720 15:66564886-66564908 CAGCCCAGAGTCCTGGCTCTGGG - Intronic
1129330765 15:74826168-74826190 CTGCCCAGAGAGCTTGACGCTGG - Intergenic
1132025625 15:98402289-98402311 CAGCCCAGAGTCCTGATAGCAGG - Intergenic
1132466445 16:79537-79559 CAGCCCAGGCACCTTGCCCCAGG + Exonic
1132699024 16:1214428-1214450 CAGCCCAGGCTCCTGGCCTCTGG - Intronic
1133775703 16:8893678-8893700 CAGCCCAGAGACCTTGAGCCAGG + Exonic
1136994695 16:35181668-35181690 CAGCCCAGAGCCCTGGGAGCTGG - Intergenic
1137390274 16:48075439-48075461 CTGCCCAGAGTCCCGGCTGCTGG - Intergenic
1137444339 16:48522689-48522711 CAGGCCAGAGCCCTTCCCACTGG + Intergenic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1139433700 16:66924753-66924775 CAGCCCCTAGTCCTAGCCCCGGG + Intronic
1139940488 16:70601861-70601883 CAGCTCAGTGTCCTTGTCTCCGG - Intronic
1139967491 16:70753932-70753954 TACCCCAGAGGCCCTGCCGCTGG + Intronic
1139980414 16:70853743-70853765 CAGAACAGATCCCTTGCCGCAGG - Intronic
1141140318 16:81492999-81493021 CAGCCCAGAGTCCCTTCCAGGGG - Intronic
1142002556 16:87671763-87671785 CAGCCCAGTCTCCATGCCTCAGG - Intronic
1142263769 16:89054333-89054355 CAGCCCTGTGTTCCTGCCGCAGG - Intergenic
1143613055 17:8031283-8031305 CAGCCCAGAGTCCATGTGGGAGG - Intergenic
1143796567 17:9341951-9341973 CAGCCCACAGTCCTTGGCTCTGG - Intronic
1144608613 17:16689599-16689621 CTGCCCAGGGTCCGTGCAGCTGG - Intergenic
1145128387 17:20320514-20320536 CTGCCCAGGGTCCGTGCAGCTGG - Intergenic
1145907075 17:28522080-28522102 CAGACCAGAGTTCTTGCCCCTGG + Intronic
1145935095 17:28710728-28710750 CAGTCCAGAGTTCCTGCAGCAGG + Intronic
1146329584 17:31916876-31916898 CAGCCCAGGGTGCATGCGGCGGG - Intergenic
1148080241 17:44963995-44964017 CAACCCAGAGTCCTTTCCCCAGG + Intronic
1148462323 17:47845879-47845901 CAGGCCACAGCCCTTGCAGCCGG - Exonic
1148491001 17:48024002-48024024 CCGCCCAGAGTCCTGCCCGCTGG - Intergenic
1148693646 17:49546688-49546710 CCGCCCACAGTCCCTGCCACTGG + Intergenic
1148820793 17:50358428-50358450 CAGTCCAGGGCCCTGGCCGCAGG - Exonic
1149598087 17:57875734-57875756 CAGCCCAGAGCCTCTGCCTCTGG + Intronic
1151147702 17:72056873-72056895 CAGCCCAGAGGCCTGGCCTGTGG + Intergenic
1151925587 17:77193828-77193850 CAGCCCCCAGGCCTTGCTGCAGG + Intronic
1152121241 17:78419982-78420004 CATCCCTGAGCCCTTGCCCCAGG - Intronic
1152535092 17:80946007-80946029 CAGTCCAGAGTCCTGCCTGCAGG + Intronic
1152709856 17:81865966-81865988 CAGCCCAAAGTCCTGGCTGCTGG + Intergenic
1155043966 18:22087866-22087888 CAGCCCAGAGCCATTGTGGCTGG + Intergenic
1155773074 18:29724830-29724852 CAGCCCAGAGACCTTGGGCCTGG + Intergenic
1158488268 18:57887631-57887653 CATCTCAGAGTCCATGCGGCAGG + Intergenic
1159197276 18:65133888-65133910 CAGCCTAGAGTCTTTCCCCCTGG - Intergenic
1160838376 19:1135487-1135509 CAGCCCAGGGTCCCTGGAGCAGG + Intronic
1161079622 19:2304070-2304092 GAGCCCAGAGTCCTAGGCCCTGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162084805 19:8242071-8242093 CAGCTCAGAGACCTTGCACCTGG - Intronic
1163320372 19:16571485-16571507 CTGCCCAGAGTCCCTGCCCGGGG + Intronic
1163763802 19:19151327-19151349 CAGCTCAGAGTCCTTGGGCCAGG + Intronic
1164964626 19:32471593-32471615 CCGCCCCGTGTCCTTGCTGCTGG + Intronic
1166283471 19:41809996-41810018 CAGCCCCAAGCCCTTGCCCCTGG + Exonic
1167661590 19:50798836-50798858 CAGCTCAGTGTCCCTGCAGCAGG + Exonic
925041762 2:736741-736763 CTTCCCAGAGTCCCTGCCCCAGG + Intergenic
925903050 2:8522439-8522461 CAGGCCAGAGACCTCGCCCCTGG + Intergenic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
927894956 2:26775683-26775705 CAGCCCCGTGTCCCTGCCCCTGG - Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
937403700 2:121608360-121608382 AAGCCCAGAGTCATTGCAGGAGG - Intronic
942721368 2:178956850-178956872 CAGCCCAGATTCTTTCCCCCAGG - Intronic
942882307 2:180875980-180876002 CAGGCAAGAGTCCTTGCGGAGGG + Intergenic
944605633 2:201349301-201349323 CTGCCAAGAGTGCTTGCCCCAGG + Intronic
945260109 2:207835330-207835352 GAGCCCCGAGTCCTTGGCGCAGG + Intronic
947616456 2:231560309-231560331 CAGCTCAGGGTCCTTCCCACTGG - Intergenic
948908708 2:240992300-240992322 TAGGCCAGAGTCCTTGCGACTGG - Intronic
949055414 2:241925550-241925572 CAGCCCACAGCCCCTGCTGCTGG + Intergenic
1172649514 20:36492983-36493005 CAGCCCAGACTCCCTGCCAGTGG + Intronic
1174930156 20:54804756-54804778 AAGCCCAGAGTCTTTGCCTGAGG - Intergenic
1175778521 20:61667751-61667773 CAGCCCACTGACCTTGCTGCTGG + Intronic
1176078270 20:63259082-63259104 CAGCCCAGGATGCTTGCCTCGGG + Intronic
1176145939 20:63565503-63565525 CAGGCCCGAGTCCCTGCAGCAGG - Exonic
1176385853 21:6138266-6138288 CAGCCCACAGGCCTGGCTGCTGG - Intergenic
1178419176 21:32430015-32430037 CTGCCCAGAGTCGTGGCCTCAGG - Intronic
1178638933 21:34330303-34330325 CAGCCCAGAAGGCTTGCCTCAGG + Intergenic
1179737620 21:43399986-43400008 CAGCCCACAGGCCTGGCTGCTGG + Intergenic
1179818223 21:43921624-43921646 CAGCCCAGAGTCTCACCCGCAGG - Intronic
1179961039 21:44767093-44767115 CAGCCCAGGGTCCAGGCCCCAGG + Intergenic
1180174657 21:46081775-46081797 CAGCCCAGGGGCCCTGCAGCAGG + Intergenic
1181461630 22:23089278-23089300 CAGCACAGAGTCAGTGCCCCCGG - Intronic
1181467825 22:23119674-23119696 CATCCCAGCGTCCCTGACGCAGG - Intronic
1182005332 22:26955070-26955092 CAGCCCAGAGCTCATGCCTCTGG - Intergenic
1182811847 22:33123430-33123452 CATCCCATAGGCCTTGCCACCGG - Intergenic
1183312400 22:37117732-37117754 CAGCCCTGGGTCCTGGCCTCTGG + Intergenic
1184495996 22:44841841-44841863 CAGCCCAGAGTCAGTGGGGCAGG + Intronic
1185106096 22:48870721-48870743 CAGCCTAGAGTCCCAGCCCCTGG - Intergenic
950026081 3:9820750-9820772 CAGCCCAAAGTCCCAGCTGCAGG - Intronic
951615115 3:24533573-24533595 CAGCCAACAGTCATTGCAGCTGG - Intergenic
953138822 3:40208711-40208733 CAACTCAGAGTCCCTTCCGCAGG + Intronic
954453013 3:50581865-50581887 CAGCTCAGAGTCCATGCAGCTGG - Exonic
955392144 3:58529725-58529747 CAGCCCAGGGTCCTTTCCTCTGG - Intronic
955614642 3:60793738-60793760 AAGCCCAGTTTCCTTGCCTCTGG - Intronic
961825444 3:129596758-129596780 CAGCCCATATGCCTGGCCGCAGG + Intronic
961884785 3:130089371-130089393 CTGCCCAGAGTCATGGCCTCAGG + Intronic
966480626 3:180404425-180404447 CTGCCCAAAGTCCTTCCCACTGG - Intergenic
969476370 4:7424673-7424695 CAGCCCAGAGTCCCTGTGCCGGG + Intronic
969820002 4:9712917-9712939 CTGCCCAGAGTCATGGCCTCAGG - Intergenic
976285856 4:83370554-83370576 CAGCCCAGAGTCACAGCAGCTGG - Intergenic
976649856 4:87422814-87422836 CAGCTCCGAGTCCCGGCCGCGGG - Exonic
985630940 5:1013670-1013692 CACCCCAGAGCCCCTGCTGCAGG - Intronic
985748720 5:1662243-1662265 CACCCCATAGTCCCTGCCCCTGG + Intergenic
987142486 5:14960204-14960226 CAGCCCAGAGACAAGGCCGCCGG - Intergenic
990492074 5:56312349-56312371 CAGCCCTGAGTCCTTGCCTGAGG + Intergenic
990987027 5:61650076-61650098 CAGCCCTGGTTCCTTGCCACAGG - Intronic
998295306 5:140964508-140964530 CAGCTCAGAGACCTGGCCACTGG - Intronic
1001154478 5:169261350-169261372 AAGCCCAGAGGCATTGCCTCAGG + Intronic
1007670722 6:43551309-43551331 CAGACCAGAGTTCCTGCCCCAGG - Exonic
1007721594 6:43888442-43888464 AAGCCCAGTGTCCTTGGCACAGG + Intergenic
1009593470 6:65705267-65705289 CAGCCCAGATTCTTTGACTCTGG - Intronic
1014841482 6:126225180-126225202 CAGCCCAGAGTGTTTGGCACAGG - Intergenic
1017809882 6:157977087-157977109 CTGCTCAGAGTCCCTGCCACAGG + Intergenic
1020318162 7:6921380-6921402 CTGCCCAGAGTCATGGCCTCAGG + Intergenic
1022090278 7:27103549-27103571 CAGCCCAGAGTCTGCGCCCCGGG + Intergenic
1024374409 7:48620846-48620868 CAGCCCAGAGTGTTTGCCTCTGG - Intronic
1026260153 7:68748024-68748046 CAGGCCACAGTCCTTGCTCCGGG + Intergenic
1026540361 7:71274965-71274987 CAGACCACAGTCCCTGCCTCTGG + Intronic
1032198550 7:129803807-129803829 CAGCCCAGGGTTCTTTCCACCGG - Intergenic
1032781402 7:135167781-135167803 CAGTACACAGTCCTTGTCGCAGG + Exonic
1036690542 8:10941903-10941925 CAGCCCACAGGCCTGGCTGCTGG - Intronic
1037708060 8:21332409-21332431 CAGGCCAGGGTCCCTGCAGCGGG + Intergenic
1040310021 8:46232036-46232058 TCCCCCTGAGTCCTTGCCGCTGG - Intergenic
1042088418 8:65132790-65132812 GTGCACAGAGTCATTGCCGCAGG + Intergenic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1049442155 8:142614476-142614498 CTGCGCTGAGTCCTGGCCGCCGG + Intergenic
1054792404 9:69268311-69268333 CAGCCCAAAGCCCTTGCCCAGGG + Intergenic
1056318533 9:85415019-85415041 AAGCCCAGAGTCCTGGCCCTTGG + Intergenic
1056396572 9:86186821-86186843 CAGCCCACAGTCCTAGAGGCTGG - Intergenic
1058419025 9:104817315-104817337 AACCCCAGAGTCCTTACCGATGG + Exonic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic
1059299011 9:113297982-113298004 CAGCCCACAGTGCTGGCCTCAGG - Exonic
1059935226 9:119303767-119303789 CATCTCAGAGTCCCTGCTGCTGG + Intronic
1061417237 9:130453726-130453748 CAGGCCAGAGTCCAGGCAGCAGG + Intronic
1061581616 9:131540554-131540576 CAGCCAAGAATCCTGGCCGACGG - Intergenic
1062373800 9:136253124-136253146 CTGCCCAGGGACCCTGCCGCAGG + Intergenic
1062721521 9:138046802-138046824 CAGCCCAGAGCCCTTTCTGCGGG + Intronic
1187400192 X:18952570-18952592 CGGCCCAGGGTCCTTGCTGCAGG + Intronic
1193239005 X:79144040-79144062 CAGCCCAGACCCATTGCCACAGG - Intergenic
1195077478 X:101340890-101340912 CAGCCCAGACTCCTTTCCATTGG - Intergenic
1198766762 X:140088070-140088092 CAGCCCATTGTGCTGGCCGCAGG - Intergenic
1199596934 X:149513408-149513430 CAGCCCAGAGCCCTGGCCCGTGG - Intronic
1199698059 X:150357851-150357873 CTGCACAGAGTCCTAGCCCCAGG - Intergenic
1201447946 Y:14079016-14079038 CAACAGAGAGTCCTTGCCCCAGG - Intergenic