ID: 927507885

View in Genome Browser
Species Human (GRCh38)
Location 2:23626466-23626488
Sequence AGAGCTGGGCACTTAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927507881_927507885 4 Left 927507881 2:23626439-23626461 CCTGAGCTGACTAATGCAGTGAG 0: 1
1: 2
2: 4
3: 48
4: 268
Right 927507885 2:23626466-23626488 AGAGCTGGGCACTTAGATCTTGG 0: 1
1: 1
2: 0
3: 10
4: 126
927507880_927507885 27 Left 927507880 2:23626416-23626438 CCAGTGATATTTTATTTTGGCAG 0: 1
1: 1
2: 23
3: 112
4: 528
Right 927507885 2:23626466-23626488 AGAGCTGGGCACTTAGATCTTGG 0: 1
1: 1
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927507885 Original CRISPR AGAGCTGGGCACTTAGATCT TGG Intronic
901848082 1:11997372-11997394 AGAAGTGGGCACTTAGAGTTGGG - Exonic
904113860 1:28147663-28147685 AGAGGTGGGCATCTAGATTTAGG - Exonic
904458803 1:30663389-30663411 AGAGGTGGGCCCATAGATCTGGG - Intergenic
905395877 1:37666071-37666093 AGAGCTGGACTCTAAAATCTCGG + Intergenic
906647572 1:47486742-47486764 AGAGCTGGGCACAGAGATCCAGG - Intergenic
907400598 1:54222639-54222661 AGGACTGGGCCCTGAGATCTGGG - Intronic
908939357 1:69412575-69412597 AGAGATGTGGACTTAGATCTGGG + Intergenic
915082550 1:153361926-153361948 TGAACTGAGCACTTGGATCTGGG - Intergenic
917057429 1:170998424-170998446 AGAGGTGTGGAGTTAGATCTGGG + Intronic
917674607 1:177306916-177306938 AGAGCTGGGGACTGAAGTCTGGG - Intergenic
918170094 1:181988349-181988371 AGAACTGGGATCTTAGAGCTGGG - Intergenic
921213740 1:212920565-212920587 AGGGCTGGGCACTGGCATCTGGG + Intergenic
922193082 1:223336944-223336966 AGAGCTGGCCACTAAGATGGTGG + Intronic
922878507 1:228960696-228960718 AGTGCTGGGGACTTAGAGATAGG + Intergenic
1065047030 10:21754113-21754135 AGAGCTGTGCTCTGAGAGCTGGG + Intergenic
1069904866 10:71726311-71726333 GGAGCCGGGCACTCAGTTCTGGG - Intronic
1070665858 10:78342935-78342957 AGAGCTGGGCATTGACGTCTGGG + Intergenic
1071265148 10:83958136-83958158 AGAGCTGGGCACATGGAAATGGG - Intergenic
1073301175 10:102471775-102471797 AGAGCTGGGAACTGAGTTCTGGG + Intronic
1079299210 11:19262518-19262540 GGAGCTGGGCACTGGGGTCTTGG - Intergenic
1079671732 11:23179322-23179344 AGAGCTTGGCACATAGATTACGG - Intergenic
1080243130 11:30150291-30150313 AGAAATGGGCACTTAGATAAAGG + Intergenic
1087257965 11:95978260-95978282 AGAGCTGTGCAATTTGATTTTGG - Exonic
1089051447 11:115549338-115549360 AGCGCTGGGCACTCATATCCTGG + Intergenic
1089529294 11:119116246-119116268 AGAGCTGGGTCCTCAGAGCTGGG - Exonic
1089706644 11:120283004-120283026 AGAGCTGTGCTCCTAGCTCTGGG + Intronic
1092002898 12:5045758-5045780 AGAGCAGGGCACTCAGAGCCAGG + Exonic
1094155185 12:27331783-27331805 AGACCTGGGCTTTAAGATCTGGG - Intergenic
1095607928 12:44092403-44092425 AGAGCTTGACATTTAGAACTAGG + Intronic
1095858360 12:46886924-46886946 AGAGTTAGTCACTTAGGTCTGGG + Intergenic
1095865431 12:46966521-46966543 AGAGCTTAGGGCTTAGATCTAGG - Intergenic
1096407843 12:51356943-51356965 AGTGCTGGGCACCTAGTTTTGGG + Intronic
1096695437 12:53345462-53345484 AGAGCTGGCCCCTTTGATCTAGG + Intergenic
1097712355 12:62930927-62930949 AGAGCTGGGAAATTCCATCTAGG + Intronic
1098177400 12:67806964-67806986 AGAGCTGGGGACTTCAACCTTGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1105979768 13:25506616-25506638 AGAACTGGGCACCTCGATCCGGG - Intronic
1108283413 13:48881874-48881896 AGAGCTGGGAAGTCAGATCTTGG - Intergenic
1108444472 13:50493613-50493635 TGAGCTGGCCACTTAGGGCTTGG + Intronic
1108730334 13:53228802-53228824 AGAACTGGGCATTTGGATTTTGG + Intergenic
1116470315 14:45279176-45279198 ACAGCTGGGCATGTAGCTCTAGG + Intergenic
1120647013 14:87086414-87086436 ACAGCTGGGATCTTAGACCTGGG + Intergenic
1121005758 14:90489634-90489656 AGAGCTGGGCTCTCAGAGCCTGG + Intergenic
1121704864 14:95983902-95983924 AGAGCTGGGCCTTTGTATCTAGG - Intergenic
1121789974 14:96691783-96691805 AGATCAGGGCACCTACATCTGGG + Intergenic
1124969434 15:34471404-34471426 AGAGCTGGGAGCGTAGATCTTGG + Intergenic
1129115653 15:73364039-73364061 AGAGCTGGGCTCCAAAATCTTGG - Intronic
1134356021 16:13483033-13483055 ACAGATGGGCACTTAGAGTTTGG + Intergenic
1139382241 16:66539979-66540001 GCATCTGGGAACTTAGATCTTGG - Intronic
1141605444 16:85150461-85150483 AGAGCTGGGGGCTGAGAGCTGGG + Intergenic
1143321717 17:6072657-6072679 AGAGCTGGGCCCTAACATCCAGG + Intronic
1144375440 17:14635290-14635312 TGATCTGGTGACTTAGATCTGGG + Intergenic
1145790794 17:27625421-27625443 AGTGCTGGGCACCTAGAGATAGG + Exonic
1149451045 17:56750256-56750278 ACAGCTGGGCATTTGGCTCTGGG + Intergenic
1150248415 17:63692612-63692634 AGAGCTGGGAACTTAGGCCATGG + Intronic
1151852900 17:76701484-76701506 AGAGCTGGGCGTATAGATGTGGG + Intronic
1153327736 18:3838945-3838967 AGAGATGGCAAATTAGATCTGGG + Intronic
1153404059 18:4715938-4715960 AGAGATGGACACTTACATCCAGG - Intergenic
1153847297 18:9061583-9061605 AGGGCTGGGCCCTTAGCCCTGGG - Intergenic
1154349126 18:13568402-13568424 AGAGCTGGACACTAAGTGCTGGG - Intronic
1156554547 18:38052510-38052532 AGAGCTGAGCACATAGAAGTGGG - Intergenic
1160845846 19:1165707-1165729 AGATCTGGGGTCTGAGATCTGGG - Intronic
1161069739 19:2254099-2254121 GGAGCTGGGTCCTTGGATCTTGG - Intronic
1161321203 19:3642340-3642362 AGGGCTGGGCACTTAAAGCCAGG + Intronic
1163871024 19:19821453-19821475 GGAGCTGGGCAATGAGAACTTGG + Intronic
1165486828 19:36101477-36101499 AGAGCTGGGCTCTCAGCTGTAGG - Intronic
925378449 2:3406037-3406059 ACAGCTGGGAACTTTGCTCTGGG - Intronic
926301800 2:11610227-11610249 AGAGATGGGCCTTTAGAACTCGG + Intronic
927507885 2:23626466-23626488 AGAGCTGGGCACTTAGATCTTGG + Intronic
930617417 2:53607974-53607996 AGAGCTGGGCACTGGGAAATGGG - Intronic
934742680 2:96736863-96736885 TGAGCTCGGCACTATGATCTAGG + Intronic
937311666 2:120906619-120906641 AGAGCTGGGGGCTCAGCTCTTGG - Intronic
938835576 2:135100329-135100351 ACAGCTGGGCACTGGGAGCTGGG - Intronic
940290488 2:152073763-152073785 AGAGCAGGGCTCTCAGAACTTGG + Intronic
943641675 2:190365735-190365757 AAAGCTGTGCACTTAGATTGAGG - Intronic
944657046 2:201886072-201886094 AGAACTGGGCATCAAGATCTTGG - Intronic
945385200 2:209190060-209190082 AGAGCTGGGTACAAAGATGTGGG - Intergenic
945663514 2:212714860-212714882 AGAGCTTAGCTCTTAGCTCTTGG - Intergenic
948284080 2:236770468-236770490 AGAGCTGAGCACTGCCATCTTGG - Intergenic
948427287 2:237895957-237895979 ACAGCTGGGCAGCTAGACCTGGG + Intronic
948596713 2:239084054-239084076 GGAGCTGGGCTCTTGGATGTGGG - Intronic
949028015 2:241775288-241775310 AGAGCTGGGGACTTTGACCTGGG + Intergenic
1168810871 20:703758-703780 AGAGCTGGGCAGTCAGGGCTGGG + Intergenic
1168910554 20:1443604-1443626 AGCTCTGGGTTCTTAGATCTTGG - Exonic
1169151337 20:3291908-3291930 AGACCTGGGCACTGAGAAATAGG - Intronic
1169692275 20:8345164-8345186 AGAGCTGGGCTGTTTGCTCTGGG + Intronic
1169856600 20:10110302-10110324 AGAGCTGGCCACATAAATCTGGG - Intergenic
1171427395 20:25057553-25057575 CGAGCTGGGCACGTGGATCTGGG + Intronic
1173503665 20:43570866-43570888 AAGGCTGGGCACTTGGACCTCGG - Intronic
1175768699 20:61609009-61609031 GGAGCTGGGCACTGAGCTCAGGG - Intronic
1177870851 21:26571432-26571454 GGAGCTGGGCACCTAGCACTGGG + Intronic
1179073382 21:38094388-38094410 AGAGCTTGGCATTTAGCTCCTGG + Intronic
1181974293 22:26717856-26717878 AGAGCAGGGCACTCAGATTGTGG - Intergenic
1184648073 22:45906920-45906942 GGAGCTGGGCACTGATATCAAGG + Intergenic
949399479 3:3651029-3651051 AGAGCTGAGAAGTGAGATCTGGG - Intergenic
950421074 3:12899864-12899886 AGAGCTGGTCACTTTCATGTTGG + Intronic
953217810 3:40937533-40937555 TGAGCTGGTGGCTTAGATCTGGG - Intergenic
953875223 3:46662758-46662780 AGTGCTGAGCACTCTGATCTGGG - Intergenic
954396904 3:50297846-50297868 AGAGCAGGGCAGATAGATCCAGG + Intronic
954998480 3:54904058-54904080 AGATGTGGGCACCTGGATCTTGG - Intronic
955330559 3:58043769-58043791 AGAGCTGGGCACATAATTCAAGG - Intronic
958582001 3:96038955-96038977 AGAGGCAGGCACTTTGATCTTGG - Intergenic
959576734 3:107942459-107942481 AGAGGTGGGAAATTAGATCAGGG - Intergenic
959986717 3:112581287-112581309 AAAGATTGCCACTTAGATCTCGG - Exonic
961780124 3:129316165-129316187 GGAGCTGGGGACGTAGACCTAGG + Exonic
972361974 4:38334833-38334855 AGAGCTGGGCAATTTTATTTGGG - Intergenic
973605603 4:52584243-52584265 AGAGGTGGGCCCCTTGATCTTGG + Intergenic
985614005 5:908540-908562 AGAGCTGGGCACTAAGATCTAGG - Intronic
986405959 5:7425103-7425125 AGAGCTGCACACATAGGTCTGGG - Intronic
987856636 5:23427028-23427050 AGATATGGGCACCTCGATCTTGG + Intergenic
991640203 5:68744371-68744393 AGCTCTAGGCACTTAGCTCTAGG - Intergenic
995215281 5:109588469-109588491 AGAGCGGGACACGCAGATCTGGG - Intergenic
995281609 5:110341785-110341807 AGAGCTGGGGACTTGGATGCTGG - Intronic
995555714 5:113326396-113326418 AGATCTTGGCACCTTGATCTTGG - Intronic
995585663 5:113645679-113645701 ACTGCTGGGCACTTATACCTGGG - Intergenic
996904437 5:128582079-128582101 AGATCTGGGCACTAGGAACTAGG - Intronic
1003904899 6:10690197-10690219 AAAGATGGGCACTTAGGCCTTGG + Intronic
1004463707 6:15863100-15863122 AGAGTTGGGGGCTCAGATCTGGG + Intergenic
1005889107 6:30121792-30121814 AGAGCTGGAAACTCAGAACTGGG - Intergenic
1005986950 6:30881558-30881580 AGAGCTGGGCAGACAGATCAAGG - Intronic
1007222098 6:40286815-40286837 AGAACTGGAATCTTAGATCTAGG - Intergenic
1017952644 6:159149289-159149311 ATAGTAGGTCACTTAGATCTTGG - Intergenic
1019303125 7:319096-319118 AGAGCTGGGGAAATAGAGCTCGG - Intergenic
1020361171 7:7328287-7328309 ACATCTGGGCACTGAAATCTGGG + Intergenic
1021178205 7:17474919-17474941 AGAGCTGGGCACCTCTGTCTAGG - Intergenic
1024424688 7:49212218-49212240 CCAGCAGGGCACTTAAATCTTGG + Intergenic
1034200539 7:149280775-149280797 AGAGCTGGGTGCTGAGACCTGGG + Intronic
1048039083 8:130707562-130707584 AGAGCTGTGAACTTTGAACTTGG - Intergenic
1048451452 8:134537426-134537448 AGAGGTTGATACTTAGATCTGGG - Intronic
1050810713 9:9743402-9743424 TGAGCTAGGTAATTAGATCTAGG - Intronic
1054833197 9:69648833-69648855 GGAGGTGGGCCCTTAGATATAGG - Intronic
1056198546 9:84252117-84252139 TGAGCTGGGGACCTCGATCTAGG + Intergenic
1059133464 9:111779605-111779627 AGAGCTGTGCATTTATAACTAGG - Intronic
1061207377 9:129172879-129172901 TGTGCAGGGCACTGAGATCTGGG - Intergenic
1187857757 X:23653620-23653642 AGTGCTGGTCACTCAGATATTGG + Intergenic
1189534472 X:41923047-41923069 GGGGCTGGGCACTGAGCTCTTGG - Intronic
1189695299 X:43656103-43656125 GGAGCTGGGCACTGAGAGCGGGG - Intronic
1199684419 X:150253934-150253956 AGACCTGGGCACCAAGATGTGGG - Intergenic