ID: 927509001

View in Genome Browser
Species Human (GRCh38)
Location 2:23632625-23632647
Sequence AGCAGAAGTGCATTTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927509001_927509004 25 Left 927509001 2:23632625-23632647 CCCGCAACAAATGCACTTCTGCT 0: 1
1: 0
2: 1
3: 23
4: 195
Right 927509004 2:23632673-23632695 GCTGTTCTCAGAAGAGCCCTAGG 0: 1
1: 0
2: 4
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927509001 Original CRISPR AGCAGAAGTGCATTTGTTGC GGG (reversed) Intronic
902566127 1:17312670-17312692 ATCAGATATGCATTTGTTGCAGG + Intronic
902693277 1:18123837-18123859 AGATGAAGTGCATTTGCTGGAGG + Intronic
907097392 1:51794167-51794189 AGCAGAAGGACATTTGTTAAGGG - Intronic
907969341 1:59365526-59365548 TGCAGAAGTGCATTTCTTACTGG - Intronic
910062022 1:83105320-83105342 AGCAGTAGAGCATTTATTCCTGG - Intergenic
910198759 1:84675671-84675693 ATCAGATGTGCATTTGTCTCAGG - Intronic
910894062 1:92049189-92049211 TGCAGAAAGGCCTTTGTTGCTGG - Intronic
911241141 1:95468475-95468497 AGGTGAAGTGCATTTCTTGCAGG + Intergenic
911981263 1:104569414-104569436 AGTTGAAGTACATTTCTTGCAGG - Intergenic
914002946 1:143708073-143708095 AGCAGAGGTGCATTTGGAGTAGG - Intergenic
915966132 1:160310199-160310221 AGCAGGACTGCATTTTCTGCTGG + Exonic
916375668 1:164150828-164150850 AGCAGCAGTTCCTTTTTTGCAGG - Intergenic
918232235 1:182546879-182546901 AGCAGAAGTGAATGTGTACCAGG - Intronic
918387395 1:184023732-184023754 AGCATAAGTGTACGTGTTGCAGG - Intronic
919180283 1:194071476-194071498 AGCAGTAGTGTATTTGCTGATGG - Intergenic
919394956 1:197034810-197034832 AGGAAAAGTGAATTTGTGGCAGG - Intergenic
920090947 1:203452803-203452825 AGCAGAAGTTTATTTGTTGCTGG - Intergenic
920497662 1:206467047-206467069 TGCAGAGGTGCATTTGTTGGTGG + Intergenic
920596442 1:207276604-207276626 AGCTGAAGTGTATTTCTTGTAGG + Intergenic
921097966 1:211902951-211902973 AATAGAAATACATTTGTTGCAGG - Intergenic
921107973 1:212002112-212002134 ATCACAATTGCATTTGTTGATGG + Intronic
921277516 1:213534528-213534550 AGCAGAAGAGCAGTGGTTGAAGG - Intergenic
921483124 1:215686465-215686487 AGCAGAAGTGTGATGGTTGCAGG + Intronic
921785330 1:219222549-219222571 AGGAGAAGTCCCTCTGTTGCTGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066100621 10:32115039-32115061 AGCAGATGTGCATGTGTAGGAGG - Intergenic
1066622497 10:37372752-37372774 AGGTGAAGTGCATTTCTTGTAGG + Intronic
1068138322 10:52973044-52973066 AGCAGAAGTGCATTGGTGATGGG + Intergenic
1072178770 10:92958444-92958466 ATCAGAAGTGCATTTCTTCTAGG - Intronic
1074230230 10:111526413-111526435 AGCAGAAGTGCATTTAGAGAAGG - Intergenic
1075082396 10:119392728-119392750 AGCAGAGGTGCCTGTGTTTCGGG + Intronic
1076319442 10:129567120-129567142 AGCACAAAGGCATTTGTTTCTGG - Intronic
1077698512 11:4418067-4418089 ACCAGAAGTGCTGGTGTTGCAGG - Intergenic
1077738243 11:4815231-4815253 ATCAGATGTGCATTTGTCTCAGG + Intronic
1085571860 11:77566409-77566431 AGGAGAAGTATATTTCTTGCAGG + Intronic
1089936780 11:122372282-122372304 AACAGAAGTGCAGTTGTAACAGG - Intergenic
1090185248 11:124734800-124734822 GGCAGAAGAGCATTTGAGGCAGG - Intergenic
1091707470 12:2706431-2706453 TGCAGGAGTGAATTTCTTGCAGG - Intergenic
1091938204 12:4450302-4450324 AGCAGAAGTGTATTTGTCTGAGG - Intergenic
1092153474 12:6267131-6267153 GGCAGAAGTGACTTTGTTGTGGG + Intergenic
1092534518 12:9375917-9375939 AGCAGAGGTCCATGTGCTGCGGG + Intergenic
1093057630 12:14570429-14570451 ATCAGATGTGCATTTGTCTCAGG - Intergenic
1094707582 12:32929263-32929285 ATCAGATATGCATTTGTGGCTGG - Intergenic
1095829313 12:46567406-46567428 AGAAGAAGTGAATTTCTTGTGGG + Intergenic
1096240282 12:49956155-49956177 AGGAGAAGCGGATTTATTGCAGG - Exonic
1098081870 12:66795116-66795138 TGCAGAAGTTAATTTTTTGCAGG + Intronic
1098900638 12:76108744-76108766 ACCAGAAATGCATTTGATGCTGG + Intergenic
1100324690 12:93529867-93529889 AGCAGAAGTTCTTTTGATGAAGG - Intergenic
1100914641 12:99405784-99405806 AGGTGAAGTGTATTTCTTGCAGG - Intronic
1102990771 12:117314129-117314151 AGCAGAAGTGGTTTTGATGTGGG - Intronic
1104382232 12:128317165-128317187 TACAGAACTGCATTTGGTGCAGG - Intronic
1105041331 12:132963685-132963707 AGTAAAAGTGAATTTGTGGCTGG - Intergenic
1105938368 13:25123204-25123226 AGGTGAAGTGCATTTCTTGTAGG - Intergenic
1108090481 13:46844198-46844220 AGCAGAAGCACATTCGATGCTGG - Intronic
1108793152 13:53997123-53997145 AGCAGGACTGCATTTCTTTCTGG - Intergenic
1109022515 13:57116555-57116577 AGGTGAAGTGCATTTTTTGAAGG + Intergenic
1109451781 13:62524486-62524508 AGCAGAAGTCTATTTGTAGCTGG - Intergenic
1111636085 13:90905992-90906014 TGCACAAGTGGATGTGTTGCTGG + Intergenic
1116834804 14:49759722-49759744 AGGTGAAGTGCATTTCTTCCAGG + Intergenic
1117099654 14:52333448-52333470 GGAGGAAGAGCATTTGTTGCAGG - Intergenic
1117977300 14:61310992-61311014 AGCAGCAGTGCATGGGATGCAGG + Intronic
1118462958 14:66003439-66003461 AGCAGAAAAGCATTTTCTGCAGG + Intronic
1119096083 14:71832694-71832716 AGCAGAAGTTGATTTCTTGAAGG - Intergenic
1123705304 15:22947046-22947068 GACAGAAATGCATTTGTTACTGG - Exonic
1124081148 15:26498809-26498831 AGGTGAATTGCATTTATTGCAGG + Intergenic
1124930527 15:34115134-34115156 AGCAGAAGTGAATTCTGTGCAGG - Intergenic
1126220732 15:46209689-46209711 AGCAGAAGTGCAATCGTGTCCGG - Intergenic
1126703182 15:51385403-51385425 AGAAAAAGTGCATTTGTTTATGG + Intronic
1126725604 15:51628535-51628557 AGCAGAAGTACAGTAGTTTCTGG + Intergenic
1128369671 15:67031298-67031320 AGCAGAAATGCAGTTGGTGAAGG + Intergenic
1128538275 15:68506798-68506820 ATCAGACATGCATTTGTTTCTGG - Intergenic
1128925729 15:71653675-71653697 AGCAGAACTGCTTTGGTTGAAGG - Intronic
1129462285 15:75705384-75705406 AGCAGAAGTCCCCATGTTGCCGG + Intronic
1129589578 15:76903756-76903778 AGGAAAAGAGCATTTGTTGAGGG + Intronic
1133652257 16:7823349-7823371 ATCAGATGTGCATTTGTCTCAGG + Intergenic
1139388264 16:66588411-66588433 ACCAGAAGTGTAGGTGTTGCCGG + Intergenic
1139521065 16:67483045-67483067 GGCAGAAGAGGATCTGTTGCAGG - Exonic
1140565059 16:76032053-76032075 TGCAGAGCTGCATTTGTTTCTGG - Intergenic
1140660667 16:77189336-77189358 ATCAGATATGCATTTGTTTCAGG - Intergenic
1144379484 17:14680054-14680076 AGCTCATTTGCATTTGTTGCAGG - Intergenic
1144706625 17:17372692-17372714 ATCAGAGGTGCATTTGTCTCCGG - Intergenic
1145068155 17:19778254-19778276 ATTAGAATTGCATTTTTTGCAGG - Intronic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1147662792 17:42125911-42125933 GGGAAAAGTGCATTTGTTGGGGG + Intronic
1147720265 17:42535690-42535712 AGAAGAAATGCATTTATTGAAGG - Intergenic
1149344584 17:55721629-55721651 AGAAGAACATCATTTGTTGCTGG - Intronic
1149442048 17:56682523-56682545 ACCAGAAGTCCTTTTATTGCTGG - Intergenic
1151023214 17:70643898-70643920 AGCAAAATAGCATTTGTTGATGG - Intergenic
1151934835 17:77255315-77255337 AGCAGAGGTGGAGTGGTTGCAGG - Intergenic
1153126252 18:1795499-1795521 AACAGAAGTTTATTTCTTGCAGG + Intergenic
1154162476 18:11990483-11990505 AGCCAAAGTGCATTTCTTGGAGG - Intronic
1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG + Intronic
1155488424 18:26372387-26372409 TCCAGATGTGCTTTTGTTGCTGG + Intronic
1156972327 18:43171139-43171161 ATCGGCAGTGCATTTGTTGTAGG - Intergenic
1157897707 18:51484581-51484603 AGCCGCAGGGCATTTGTAGCAGG - Intergenic
1158669700 18:59463728-59463750 AGCAGTATTGCGTTTGTTGCTGG + Intronic
1162633568 19:11947666-11947688 AGAAGAAATGAATTTGATGCTGG - Intronic
1164078015 19:21838063-21838085 ATCAGATGTGCATTTGTCTCAGG + Intronic
1164966637 19:32490340-32490362 AGCAGATTTACATTTGTTTCTGG - Intergenic
1164982764 19:32626686-32626708 AGCAGTGGTGCCTTTGTGGCGGG - Intronic
1165320537 19:35082369-35082391 TGCAGGAGTGCATTTCTTTCTGG + Intergenic
1165609469 19:37138063-37138085 ATCAGATGTGCATTTGTCTCAGG - Intronic
1166627242 19:44369573-44369595 ATCAGATATGCATTTGTTTCAGG - Intronic
925429249 2:3776735-3776757 AGCAGATGTGCATATGTTCCTGG - Intronic
927509001 2:23632625-23632647 AGCAGAAGTGCATTTGTTGCGGG - Intronic
930082618 2:47465809-47465831 ATCAGAAATGCATTTGTGTCAGG + Intronic
935602160 2:104933806-104933828 AGCAGAAGTTGGTCTGTTGCTGG - Intergenic
935657572 2:105438225-105438247 AGCAGAGATGCAGGTGTTGCTGG - Intronic
936620810 2:114095411-114095433 AGCAGAACTGCATATTTTTCTGG + Intergenic
938504020 2:131856201-131856223 AGTAGGAGTACATTTGCTGCTGG - Intergenic
938546256 2:132334980-132335002 ATCAGATATGCATTTGTTTCAGG + Intergenic
940031115 2:149262318-149262340 AGCAGAAATGCAACTCTTGCTGG + Intergenic
940786123 2:157982738-157982760 AGGTGAAGTGCATTTCTTGTAGG + Intronic
941341733 2:164314066-164314088 AGCAGAAGTGGATTTTGTGTGGG - Intergenic
942846110 2:180428070-180428092 AGGTGAAGTGCATTTCTTGTGGG - Intergenic
947049282 2:226024005-226024027 ATCAGATATGCATTTGTTTCTGG + Intergenic
948322199 2:237079543-237079565 ATCAGATATGCATTTGTTTCAGG + Intergenic
948624139 2:239257614-239257636 AGCAGAGCTGCAATTGTTGAGGG - Intronic
1171875118 20:30567713-30567735 ATCAGATATGCATTTGTTTCAGG + Intergenic
1175558511 20:59894861-59894883 AGGAGAAGGGCATTTGTTCCAGG - Intronic
1176255214 20:64148337-64148359 ATCAGATGTGCATTTGTCTCAGG + Intergenic
1177649579 21:23943011-23943033 AGCAGATATGCATTTGTTTCAGG + Intergenic
1177992418 21:28053979-28054001 AGTAGGAGTACATTTGCTGCTGG + Intergenic
1179247190 21:39644201-39644223 ATCAGATATGCATTTGTTTCAGG + Intronic
1179543180 21:42097296-42097318 AGCAGATGAGCATCTGTTACTGG - Intronic
1179668366 21:42928009-42928031 ATCAGATGTGCATTTGTCTCAGG + Intergenic
1182450089 22:30414820-30414842 AGCAGAAGTGAAATGGTGGCTGG + Intronic
1183075273 22:35422871-35422893 AGCAGGACTCCTTTTGTTGCTGG - Intronic
949861751 3:8511737-8511759 AAAAGATGTGCATTTGTGGCTGG - Intronic
950960051 3:17095502-17095524 AGGAGGAGGGCATTTGTTGGTGG - Intergenic
952811202 3:37404945-37404967 TGCAGATGTAGATTTGTTGCTGG + Intronic
954471848 3:50704598-50704620 AGGTGAAGTGCATTTCTTGTAGG + Intronic
955025238 3:55161076-55161098 AACAAAAGGGCATATGTTGCTGG - Intergenic
957161323 3:76612974-76612996 AGGTGAAGTGCATTTCTTGTAGG + Intronic
958786739 3:98604630-98604652 AGCAGAGCTGCTTTTGTTGCAGG + Intergenic
960152462 3:114264159-114264181 AGGTGAAGTGCATTTCTTGTAGG + Intergenic
960387164 3:117034285-117034307 TTCAGAAGTACATTTGTTACAGG - Intronic
963151122 3:142046454-142046476 GGCAGAAGTGGATTTGTTGGGGG - Intronic
964398163 3:156269870-156269892 ATATGAAGTGCATTTCTTGCAGG + Intronic
966345614 3:178976344-178976366 AGCAAAAATGCATTCATTGCTGG + Intergenic
967780839 3:193437749-193437771 AGCAGAAGTACATTTTCGGCAGG + Intronic
967898642 3:194423520-194423542 AGGAGCAGTGCAGTTGATGCAGG - Intronic
970458821 4:16252516-16252538 AGCAGAAGGGCATCAGATGCAGG - Intergenic
974238875 4:59217034-59217056 AGTATAAGCTCATTTGTTGCAGG + Intergenic
974771905 4:66425743-66425765 AGGGGAAGTGTATTTGTTGTAGG - Intergenic
974908032 4:68081469-68081491 AGCAGAAGTACATTAATTACTGG + Intronic
975026978 4:69561583-69561605 AGCTGAAGTGTTTTTCTTGCAGG - Intergenic
975226688 4:71880842-71880864 ATCAGATGTGCATTTGTGTCTGG + Intergenic
975556236 4:75668042-75668064 AGCTGAAGTGCATGTGCTTCAGG - Intronic
975752131 4:77534707-77534729 AGCAGAAGTCCATTTAGTGCAGG + Intronic
977211870 4:94227526-94227548 AGCAAGAGAGGATTTGTTGCTGG + Intronic
981530519 4:145749286-145749308 AGGTGAAGTGTATTTCTTGCAGG + Intronic
981585283 4:146294621-146294643 AGCAAAAGTGCATGTGTTGTGGG + Intronic
982857248 4:160399303-160399325 AGCAGGAGCGTGTTTGTTGCTGG + Intergenic
983473757 4:168189244-168189266 AGGTGAAGTGCATTTCTTGTAGG - Intergenic
984078373 4:175212665-175212687 AGCAGGGCTGCATTTGTTTCTGG - Intergenic
984382439 4:179012794-179012816 ATCAGATGTGCATTTGTATCTGG - Intergenic
985785346 5:1890317-1890339 AGCAGAAGGGCAGTGTTTGCAGG + Intergenic
987346358 5:16982230-16982252 TGCAGACGTGTATTTGATGCTGG + Intergenic
995991918 5:118249788-118249810 AGCTAAAATGCATTTCTTGCAGG - Intergenic
996111004 5:119566742-119566764 AGCTCAAGTCCATTTGCTGCTGG + Intronic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1000052932 5:157577569-157577591 ATCAGATATGCATTTGTTTCCGG + Intergenic
1003627174 6:7752483-7752505 AGTAGAAATGCATTTGTAACTGG + Intronic
1003790577 6:9542601-9542623 AGCTGAATTGCATTTCTTGGTGG + Intergenic
1005969222 6:30748392-30748414 AGCAGTAGTGTATTTCTAGCCGG - Intergenic
1006312016 6:33267601-33267623 AGGAGCAGTGCATTGGTGGCTGG + Intronic
1008228711 6:48956616-48956638 AGCAGATTTGCATTTGATGTAGG - Intergenic
1008490288 6:52079319-52079341 ACCAAAAGGGCATTTGCTGCTGG - Intronic
1009615987 6:66008105-66008127 AGAAGAAGTGTATTTATTGTAGG + Intergenic
1010012140 6:71060471-71060493 GGCAGAAGTGCATTTGTCAGTGG + Intergenic
1010038112 6:71349605-71349627 ATCAGAAATGAATTTATTGCTGG - Intergenic
1010546262 6:77160240-77160262 AGGTGAAGTGCATTTCTTACAGG + Intergenic
1011447192 6:87453984-87454006 AGGTGAAGTGCATTTCTTGTAGG - Intronic
1012490369 6:99776734-99776756 AGAAGAAGTGGATATGTTCCTGG - Intergenic
1012738759 6:102985685-102985707 AGAAGAACTGCATTTCTTTCTGG - Intergenic
1015273987 6:131365694-131365716 AGCAGAAGACCTTCTGTTGCTGG - Intergenic
1015598229 6:134886922-134886944 AGCAGAAGTCCTTTTGTTTCAGG - Intergenic
1015711354 6:136144802-136144824 ATCAGATGTGCATTTGGGGCAGG + Intronic
1015788839 6:136945928-136945950 AGGAGAAGTTCATTTTTTTCCGG + Intergenic
1016528556 6:145032373-145032395 AGCAGAACAGAATTTGTTACAGG - Intergenic
1016586973 6:145699186-145699208 AACAGAAGTTCATTTATTGTGGG - Intronic
1017467611 6:154708894-154708916 AGCAGAAGTGCTATGGTTGGTGG - Intergenic
1018598535 6:165511912-165511934 AGGTGAAGTGCATTTCTTACAGG + Intronic
1023216333 7:37867096-37867118 ATCAGATGTGCATTTGTGTCTGG + Intronic
1023499648 7:40833829-40833851 ACAAGAAGTGCATTTGGTGACGG + Intronic
1028645448 7:93091229-93091251 AGGTGAAGTGAATTTGTTGTAGG + Intergenic
1029920486 7:104257251-104257273 AGCAGATGTGCATTTTTTGTGGG + Intergenic
1029999252 7:105041413-105041435 AGCAAAACTCCATCTGTTGCTGG - Intronic
1031452372 7:121937585-121937607 AGCCGAGGTGCATGTGGTGCAGG + Intronic
1035927453 8:3743814-3743836 AGCAGATATGCATTTGTGTCTGG - Intronic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1042184700 8:66124905-66124927 AGCAGATATGCATTTGTCTCAGG - Intergenic
1042966917 8:74363544-74363566 AGCAGAAGAGCTTTTGTGACAGG - Intronic
1043039888 8:75249934-75249956 GGCAGGAGTGCATTGGTTTCTGG - Intergenic
1043146669 8:76665314-76665336 AAGAGAAGTGCATATGTTGTAGG - Intergenic
1049945795 9:594106-594128 TGCAGAAGTGCACTTGTTGGGGG + Intronic
1050839574 9:10131063-10131085 AAAAGAATTGCATTTGTTGGAGG + Intronic
1050855500 9:10349036-10349058 ATCAGATATGCATTTGTTTCAGG - Intronic
1051549453 9:18312893-18312915 AACAGAAGTGCATGCGTTACTGG - Intergenic
1055486898 9:76765093-76765115 AGCAGATGTACATTTGTTGGGGG + Intronic
1056072098 9:82997947-82997969 AGCAGACTTGCATTTGGTGATGG - Intronic
1061732138 9:132623789-132623811 AGCAGATGTGGATCTGTTGGAGG - Intronic
1185805928 X:3057035-3057057 AGCCGAAGTTCATTTGTTCATGG - Intronic
1186728036 X:12377755-12377777 CGCAGAAGTGCAGTGGGTGCTGG + Intronic
1187425375 X:19173535-19173557 AGCAAAAGTTAATTTGTTGCAGG + Intergenic
1187583424 X:20633726-20633748 AACAGAAGTGCATAAGCTGCTGG - Intergenic
1188068558 X:25692241-25692263 AGGTGAAGTGCATTTCTTGTAGG + Intergenic
1188440434 X:30210515-30210537 ATCAGATATGCATTTGTTTCAGG - Intergenic
1188815065 X:34703140-34703162 AGGTGAAGTGCATTTCTTGTTGG + Intergenic
1189194737 X:39143398-39143420 GGAAGAAGAGCCTTTGTTGCTGG - Intergenic
1191985887 X:66980688-66980710 AGATGAAGTGCATTTCTTGTAGG + Intergenic
1192738114 X:73868070-73868092 AGGTGAAGTGCATTTGTTGTAGG - Intergenic
1193021345 X:76796980-76797002 AGCAGAGGTGCATTTCTTCTTGG - Intergenic
1194354972 X:92871695-92871717 TGCAGGAGTGCATTTCTTTCTGG + Intergenic
1195720123 X:107859313-107859335 AGCACAAATACATTTGTTGGTGG + Intronic
1196458279 X:115905057-115905079 AGCAGAAGTGCATTTTTAGGTGG + Intergenic
1197580767 X:128280663-128280685 AGCAGAACTGCTTTTGTTGAAGG - Intergenic
1200376886 X:155791549-155791571 AGCAGTAGGGCTTTTGTTGTAGG - Intergenic
1200663331 Y:5988710-5988732 TGCAGGAGTGCATTTCTTTCTGG + Intergenic