ID: 927509462

View in Genome Browser
Species Human (GRCh38)
Location 2:23635389-23635411
Sequence ACAGCTGGTTCCCCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927509454_927509462 21 Left 927509454 2:23635345-23635367 CCCTAAATGAAGCTGGTCCCTCA 0: 1
1: 0
2: 2
3: 3
4: 172
Right 927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 130
927509459_927509462 3 Left 927509459 2:23635363-23635385 CCTCAGAGCAGCTGTGTGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 293
Right 927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 130
927509458_927509462 4 Left 927509458 2:23635362-23635384 CCCTCAGAGCAGCTGTGTGGGCC 0: 1
1: 1
2: 4
3: 49
4: 281
Right 927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 130
927509453_927509462 26 Left 927509453 2:23635340-23635362 CCTTTCCCTAAATGAAGCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 142
Right 927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 130
927509455_927509462 20 Left 927509455 2:23635346-23635368 CCTAAATGAAGCTGGTCCCTCAG 0: 1
1: 0
2: 1
3: 9
4: 178
Right 927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927509462 Original CRISPR ACAGCTGGTTCCCCCCAAGC TGG Intronic
900031846 1:378265-378287 ACAGCTGCTGTCCCCCAAGCTGG - Intergenic
900052394 1:606456-606478 ACAGCTGCTGTCCCCCAAGCTGG - Intergenic
900619570 1:3580635-3580657 ACAGCAGGTGCCCCCCAGGCTGG + Intronic
900633712 1:3651911-3651933 ACGGCTGCTTTCCGCCAAGCAGG - Intronic
901494687 1:9614181-9614203 ACAGCTGATTCCTCCCCAACTGG - Exonic
902641591 1:17769743-17769765 ACAGCTGGTTGGCCCCGAGCTGG - Intronic
903027062 1:20436919-20436941 CCTGCAGGTTCCTCCCAAGCTGG - Intergenic
903163939 1:21508406-21508428 AGAGCTGGTTCCCCAGGAGCGGG + Intergenic
904285261 1:29449835-29449857 TCAGCAGGCTCCCCCCAACCAGG + Intergenic
904891312 1:33781821-33781843 ACAGCTGGTCGCCCCCATGGAGG + Intronic
905339796 1:37270707-37270729 TCAGCTGGTGCCCTCCAAACAGG - Intergenic
908569388 1:65392730-65392752 GCAGCTGGTCCCACCCAGGCTGG + Exonic
909593537 1:77379120-77379142 ACCGCTGGTTCCTCTCATGCTGG - Intronic
910099880 1:83564425-83564447 TCAGCTAATTCCACCCAAGCAGG + Intergenic
913193486 1:116433306-116433328 ACAGCTGGCTACCACCCAGCTGG + Intergenic
913681186 1:121187760-121187782 GCAGCCCTTTCCCCCCAAGCCGG + Intronic
914033015 1:143975400-143975422 GCAGCCCTTTCCCCCCAAGCCGG + Intergenic
914156430 1:145092566-145092588 GCAGCCCTTTCCCCCCAAGCCGG - Intronic
916644500 1:166769815-166769837 CCAGCTGATTCCAGCCAAGCAGG - Intergenic
917708199 1:177656357-177656379 GCAGCTGGTTTCTCCCAGGCAGG + Intergenic
1065862213 10:29881523-29881545 ACATCTGTTTCCCACCAAGTGGG + Intergenic
1067015324 10:42753756-42753778 ACAGCTGGTTCCCGCCCGGATGG - Intergenic
1070629996 10:78077639-78077661 ACATCTGGGTCCCCCAAAACAGG - Intergenic
1073461300 10:103667361-103667383 ATAACTGGTTCCTCCCAGGCTGG + Intronic
1076275091 10:129191926-129191948 CCAGCTGGTTCCCACTAACCAGG + Intergenic
1076508898 10:130998455-130998477 ACAACTGGTCCCCACAAAGCCGG + Intergenic
1076648602 10:131971711-131971733 ACATCTGGGTACACCCAAGCTGG + Intronic
1077649042 11:3952956-3952978 ACAGCTAGTCACCACCAAGCAGG - Intronic
1081669615 11:44935698-44935720 ACAGCTGACTCCCTCCCAGCAGG + Intronic
1083729051 11:64643253-64643275 AGACCTGGTTCCCCCGAAGGCGG + Intronic
1087026833 11:93658443-93658465 CCAGGTGGTCCCCCACAAGCTGG - Intergenic
1088587313 11:111370483-111370505 ACAGCTGGATCCCCCTGACCTGG - Intronic
1089427331 11:118389795-118389817 ACACCTGGTTGGCCCCAAGATGG + Exonic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1094763077 12:33557545-33557567 CCAGCTGGTTCCACCCAGACTGG + Intergenic
1102028898 12:109728769-109728791 AGACCTGGTTCCCACCTAGCAGG + Intronic
1104981856 12:132576804-132576826 GCAGCTGGACCCCCACAAGCTGG + Exonic
1112310813 13:98316201-98316223 ACAGCTGGTTCGAGCCAAGGCGG - Intronic
1117253513 14:53956478-53956500 CCAGCTTCTTCCCCCCAAGGAGG + Intronic
1117800927 14:59444399-59444421 ACTGCTGATTCCCCACAAGGAGG - Intronic
1121179828 14:91920648-91920670 ACAGCTGATTCTGCCCAAGGGGG - Intronic
1122206388 14:100149990-100150012 CCAGCTTGTTCCCACCCAGCAGG + Intronic
1125180635 15:36878480-36878502 ACAGCTGGCTCCCCCGAGACAGG - Intergenic
1129828658 15:78652489-78652511 ACAGCTGGTTCCCACCCCTCTGG + Intronic
1131268186 15:90931078-90931100 ACATCTGATTCCCACCACGCGGG + Exonic
1132058826 15:98673606-98673628 ACCACTGGATCCCCCCATGCTGG + Intronic
1132398745 15:101491815-101491837 GCAGCTGGTGCCTCCCAAGACGG + Intronic
1138066735 16:53949218-53949240 ACAGCTGGGTTCCCCCATGGAGG - Intronic
1140480740 16:75261605-75261627 CCAGCTGGTTGCCCCAATGCAGG + Intronic
1141029243 16:80573471-80573493 CCAGCTGGCTCTCCCCCAGCAGG - Intergenic
1144106690 17:11992532-11992554 ACATCTGGATCTCCCCAGGCAGG + Exonic
1144747377 17:17624981-17625003 GCAGCTGGTTCGCCGCAAGACGG + Intergenic
1145969794 17:28950213-28950235 TCTGCTGGCTCCCCCCAAGACGG - Exonic
1146039064 17:29433893-29433915 ACTGCTGTTTCCCCCAAAACAGG - Intronic
1146058286 17:29591862-29591884 CCAGCTGGCTCCTCCCAGGCGGG + Intronic
1147336514 17:39729714-39729736 ACAGCTGGTGTTCTCCAAGCTGG - Exonic
1147733353 17:42618056-42618078 GCAGCTGGTTCACACCAACCAGG - Intergenic
1149675881 17:58461070-58461092 ACAGGTGTGTCCCCCCAGGCTGG - Intronic
1149893270 17:60408994-60409016 TCAGCTGTGTCTCCCCAAGCTGG - Intronic
1152947810 17:83207449-83207471 ACAGCTGCCGTCCCCCAAGCTGG + Intergenic
1156036205 18:32770498-32770520 ACAGCTGCTTCCTCCACAGCAGG + Exonic
1156470232 18:37373236-37373258 ACTGCTGGTTCCCATCAATCAGG + Intronic
1159110124 18:64045490-64045512 ACAGCTTATTCCCCCCAAAAAGG + Intergenic
1160983209 19:1826230-1826252 GCAGCTGGTTCGGCCCAAGGTGG - Intronic
1161509501 19:4662742-4662764 CCAGCTGTTTCCCCTCAGGCAGG - Intronic
1162142493 19:8592931-8592953 ACATCTGGGTCCTCCCAAGCCGG - Intronic
1162406761 19:10479496-10479518 ACAGCAGGGTCCCCTCAAGAAGG - Intergenic
1163195451 19:15716450-15716472 ACACGTGGTTCCTCCAAAGCTGG - Intergenic
1167535736 19:50050431-50050453 TCAGCAGGTTCCGCCCACGCCGG + Intronic
1168130926 19:54318083-54318105 ACAGCTGAGCCCACCCAAGCTGG + Intergenic
1168132725 19:54331654-54331676 ACAGCTGGAGCCCCCAGAGCAGG - Intergenic
927207437 2:20619114-20619136 CCAGCTGTTCCCCCCAAAGCGGG - Exonic
927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG + Intronic
928170331 2:28999251-28999273 ACAGCTGGGTGGCCTCAAGCTGG + Exonic
930720613 2:54634144-54634166 ACAGCTGGTTTCCTGCAGGCGGG + Intronic
931587264 2:63841680-63841702 ACAGCGGCTCCCGCCCAAGCAGG - Intronic
937077757 2:119119316-119119338 AAAGCTTGTTTCCCCCAGGCCGG + Intergenic
938093750 2:128448833-128448855 AGAGCTGGTTCCACCCCTGCAGG + Intergenic
938301567 2:130217875-130217897 CCAGCTGTTTCACCCCAAGATGG + Intergenic
938455139 2:131456583-131456605 CCAGCTGTTTCACCCCAAGATGG - Intergenic
938656194 2:133436577-133436599 ACAGCTAGTTCCCCACCTGCAGG + Intronic
941045796 2:160674407-160674429 ACAGCTGGCTTCCCCAAAGAAGG + Intergenic
942278877 2:174342028-174342050 ACAGCTGGATCCCCACATCCTGG - Intergenic
945432202 2:209777375-209777397 ACTGCTGCTTCCACCCCAGCTGG - Exonic
948284596 2:236773917-236773939 ACAGCTGGTTCCCCAGGAGGTGG - Intergenic
948725539 2:239931543-239931565 ACAGCGTCTTTCCCCCAAGCAGG + Intronic
1171324928 20:24282827-24282849 GCAGCTGAGTCCACCCAAGCTGG - Intergenic
1175100292 20:56574579-56574601 ACAGCGGGTTCCACCCAGCCAGG - Intergenic
1175966998 20:62664768-62664790 ACAGCAGGTTCCTCCCACCCTGG + Intronic
1176037166 20:63045224-63045246 ACAGAGGGTTCCCGCCATGCAGG - Intergenic
1179570587 21:42276377-42276399 ACCACTGGTTCCGCCCAGGCTGG + Intronic
1179955474 21:44735852-44735874 AGAGCTGGTTCCTCTCAAGGTGG + Intergenic
1180627942 22:17207187-17207209 ACATCTGTTTCACCCCAAGGGGG - Exonic
1181850985 22:25749736-25749758 ACAGCTGCCTCACCCCAAGAAGG - Intronic
1182269832 22:29146298-29146320 ACAGCTGTCTCCCCTCAGGCTGG + Intronic
1183395522 22:37568877-37568899 ACAGCTGGTTCCTACCAGACCGG + Exonic
1183464125 22:37970943-37970965 ACTGCTGGTTCCCGTGAAGCTGG - Intronic
1184916075 22:47569908-47569930 ACTGCTGGCTCCGCCCACGCAGG + Intergenic
961013682 3:123450999-123451021 AAAGCTGTTTACCCCCAGGCTGG - Intergenic
961570290 3:127792930-127792952 ACATCTGGTTCCCATGAAGCAGG + Intronic
964538878 3:157757010-157757032 ACAGCAGGTTCTCCCCACTCAGG - Intergenic
966686862 3:182705115-182705137 ACACCTGGTGCTCCCCAAGTGGG - Intergenic
980980556 4:139651137-139651159 GCAGCTGGTCTCCCTCAAGCTGG + Intergenic
982532220 4:156559046-156559068 ATAGCTGATCCCCGCCAAGCAGG + Intergenic
984799365 4:183699304-183699326 ACTTCTTGTTCCTCCCAAGCAGG + Intronic
985635532 5:1034022-1034044 AAAGCTGGGTCCCCCCAAGAAGG + Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
990994449 5:61717501-61717523 GTGGCTGGTTTCCCCCAAGCAGG - Intronic
992229907 5:74654011-74654033 ACACCTGGAGCCCCTCAAGCTGG - Intronic
994302489 5:98161759-98161781 AAAGCTGGTTCCCCAAAAGATGG - Intergenic
996727357 5:126684418-126684440 ACAGGTGGGTGCCACCAAGCTGG + Intergenic
997362255 5:133302592-133302614 ACTCCTGTTTCCCCCAAAGCTGG - Intronic
997523985 5:134540880-134540902 ACACCTGTTTCCTCCCAGGCAGG - Intronic
998188020 5:139997886-139997908 GCAGCTGGCTCCTCCCCAGCGGG - Intronic
1001400025 5:171440864-171440886 ACAGATGGTTCCACCGCAGCAGG - Intronic
1002741974 5:181440603-181440625 ACAGCTGCTGTCCCCCAAGCTGG + Intergenic
1007071764 6:39043228-39043250 ACAGCTGGTGCACCCGCAGCAGG + Intergenic
1016986651 6:149900473-149900495 ACAGCCGGTGCCTCCCAGGCAGG + Intergenic
1019247115 6:170716360-170716382 ACAGCTGCTGTCCCCCAAGCTGG + Intergenic
1031819656 7:126484236-126484258 ACAGCTGGTTACCCCAATGATGG + Intronic
1032967878 7:137122244-137122266 CCAGCTTTTTCCCCGCAAGCAGG - Intergenic
1034343401 7:150371811-150371833 CCAGCTAGTTGCCCACAAGCGGG + Exonic
1034919747 7:155070395-155070417 AAAGCAGGTTCCCCCAAAACTGG + Exonic
1035369857 7:158372599-158372621 AGAGCTGGTCCCCACCACGCTGG + Intronic
1035501026 8:91593-91615 ACAGCTGCTGTCCCCCAAGCTGG - Intergenic
1038779093 8:30555897-30555919 GCAGCTTGTTCCCCCCCACCGGG + Intronic
1042212486 8:66394636-66394658 ACAGCTTGGTCTTCCCAAGCAGG + Intergenic
1044858373 8:96497775-96497797 ACAACTGGATCCCCACCAGCAGG - Intronic
1045821635 8:106344976-106344998 ACAGCTGTTTCCTCACAAGGAGG - Intronic
1046285832 8:112092164-112092186 ACAGCTGCCTCACCCCCAGCTGG - Intergenic
1053125226 9:35575710-35575732 ACAGCTGAGCCCACCCAAGCTGG + Intergenic
1053411844 9:37920857-37920879 TCAGGTGGCTCCTCCCAAGCAGG - Intronic
1055319848 9:75072366-75072388 ACTGCTGGTTCCAGCCAAGATGG - Intronic
1055421662 9:76149744-76149766 ATGGCTGGGTCTCCCCAAGCTGG + Intronic
1058510635 9:105713274-105713296 ACAGCTGCAGCCCCCCAAACCGG + Intronic
1061279102 9:129586874-129586896 ACATCTGGTTCCACCCACCCAGG + Intergenic
1062105115 9:134750969-134750991 ACAGCTGCTTCCCTCCAAGTTGG - Intronic
1203607886 Un_KI270748v1:71819-71841 ACAGCTGCTGTCCCCCAAGCTGG + Intergenic
1186452880 X:9687891-9687913 ACAGCTGGCTCCCAGCAACCAGG - Intronic
1187095463 X:16143195-16143217 AAAGCTTGTTCCCTCCATGCAGG + Intronic
1190528797 X:51354192-51354214 ACAGCTGTGACCCCACAAGCTGG - Intergenic
1193508553 X:82372135-82372157 TCATCTGGGTCCCCTCAAGCTGG + Intergenic