ID: 927511114

View in Genome Browser
Species Human (GRCh38)
Location 2:23644327-23644349
Sequence CAACTCTGACAACTGGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927511110_927511114 -1 Left 927511110 2:23644305-23644327 CCAGTTCAAGTTCATGAGTTACC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG 0: 1
1: 0
2: 0
3: 23
4: 223
927511109_927511114 0 Left 927511109 2:23644304-23644326 CCCAGTTCAAGTTCATGAGTTAC 0: 1
1: 0
2: 0
3: 10
4: 99
Right 927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG 0: 1
1: 0
2: 0
3: 23
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927511114 Original CRISPR CAACTCTGACAACTGGGCAG CGG Intronic
900590893 1:3459339-3459361 CAACTCTGACAACAAGGGAAGGG + Intronic
900902819 1:5528248-5528270 CAACACTGAGGACTGGGCTGTGG + Intergenic
902516391 1:16991964-16991986 CCACTCTGAGGACTAGGCAGAGG - Intronic
903132605 1:21289798-21289820 CAACTCTGCCACCTGGGCTGTGG + Intronic
903183709 1:21618090-21618112 CACCTCTTACAGATGGGCAGGGG + Intronic
903671644 1:25039460-25039482 CCACGCTGACCACTGGGCAGCGG - Intergenic
904866405 1:33582449-33582471 CAAGTCTGCAAACTGGGCAAAGG - Intronic
905423832 1:37867454-37867476 CAAAGCTGATAAATGGGCAGAGG - Intronic
905946784 1:41907836-41907858 CAACTCAGACACATGGGCAATGG + Intronic
906321430 1:44819674-44819696 CCACTCTGACTAGAGGGCAGTGG + Intergenic
906735981 1:48128649-48128671 CTTCTCTTCCAACTGGGCAGTGG + Intergenic
906787241 1:48626817-48626839 CAACTCTGGGAACTGGACTGTGG - Intronic
907757118 1:57321423-57321445 CAACTCTCACCTCTTGGCAGAGG + Intronic
909091711 1:71233888-71233910 CAATTCTGACTGCTGTGCAGAGG - Intergenic
910458941 1:87427349-87427371 GCACTCTGAAAACTGGACAGCGG - Intergenic
910806946 1:91197955-91197977 CAACTCTGCCAAGGGGGCAGGGG - Intergenic
912405511 1:109434367-109434389 CATCTCTGAAATCTAGGCAGAGG + Intergenic
912827981 1:112923777-112923799 CAACTATGCCACCTGGGAAGTGG + Intronic
913959660 1:143328574-143328596 CAACTGTTAAAACTAGGCAGAGG - Intergenic
914054019 1:144154147-144154169 CAACTGTTAAAACTAGGCAGAGG - Intergenic
914125127 1:144812218-144812240 CAACTGTTAAAACTAGGCAGAGG + Intergenic
916926683 1:169528640-169528662 CTAATCTGAGAAGTGGGCAGAGG - Intronic
917086300 1:171308424-171308446 CAACTCTGAAGTCTGGGCATTGG + Intergenic
917281338 1:173380337-173380359 CAACTCTGAAGTCTGGGCATTGG + Intergenic
917841460 1:178983299-178983321 CCACTCTGTCACCTAGGCAGAGG - Intergenic
920108408 1:203570419-203570441 CAACTCAGACACCAGGGAAGGGG - Intergenic
920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG + Intronic
920423600 1:205854488-205854510 CACCTCTGACAACTTTGGAGGGG - Intergenic
921110729 1:212034390-212034412 CAACTCAGAAAACTGGGAAGTGG + Intronic
922272780 1:224049702-224049724 CAACTCTGACCACTCATCAGGGG - Intergenic
923486587 1:234438000-234438022 CCACTCTGGGAACTGGCCAGTGG - Intronic
1064752483 10:18545155-18545177 CAGCTCTGGCAGCTGGGAAGTGG - Intergenic
1067546055 10:47193359-47193381 GAATTCTGACCACTGGGCCGTGG - Intergenic
1068940977 10:62680983-62681005 CAACTCTGTGCATTGGGCAGTGG + Intergenic
1069639190 10:69944014-69944036 CAACTCTGAAAACTGGGCCTTGG + Intronic
1072226944 10:93379251-93379273 AAACTCTGAGAACTTTGCAGTGG - Intronic
1077080982 11:724659-724681 CTCCTCTGAGACCTGGGCAGTGG - Intronic
1077117044 11:889894-889916 AATCTCTGACAGGTGGGCAGAGG - Intronic
1077360235 11:2137571-2137593 CCACGCTGCCCACTGGGCAGGGG + Intronic
1078753374 11:14186300-14186322 CAGCTCTAACAAGTGGGCAAGGG + Intronic
1078921003 11:15830554-15830576 CAACTCTGAGCACTTGGGAGTGG - Intergenic
1078932434 11:15922576-15922598 AAGCTCTGACAACCTGGCAGAGG - Intergenic
1079769733 11:24444443-24444465 CATCTCTGAAATCTAGGCAGAGG - Intergenic
1080640151 11:34153999-34154021 CAGCTCTGCCACCTGGGCTGTGG - Intronic
1081042698 11:38231923-38231945 CAAAACTGACAAATGGGAAGAGG + Intergenic
1083934872 11:65864938-65864960 CAAGGCTGAGGACTGGGCAGGGG + Intronic
1084176632 11:67425732-67425754 CAACTCAGACACCAGGCCAGTGG - Intergenic
1085266019 11:75238599-75238621 AAACTCTGAAAACTTGACAGGGG + Intergenic
1087153333 11:94878007-94878029 CCATTCTGACATCTGGGCTGGGG + Intergenic
1091287751 11:134417529-134417551 CCACACTGAGACCTGGGCAGGGG + Intergenic
1099358896 12:81673116-81673138 CAATTCTGGCACCAGGGCAGGGG + Intronic
1099947679 12:89263500-89263522 CATCTCTGAGAACTGGGAATTGG - Intergenic
1100754917 12:97740756-97740778 CAACTCTGATTACTTGGCAGTGG - Intergenic
1100872392 12:98923725-98923747 TAACTTTGACAACTGGGGAAAGG + Intronic
1101083766 12:101214772-101214794 CATCTCTGAAATCTAGGCAGAGG - Intergenic
1101848233 12:108381030-108381052 CTACTCACACAACTGGGGAGTGG - Intergenic
1105762676 13:23528401-23528423 CAACCCTGACGTCTGGGCATTGG + Intergenic
1106898375 13:34329727-34329749 GAACTTTGACCACTTGGCAGAGG + Intergenic
1108848792 13:54703803-54703825 CAACCCTGAAATCTGGGCATTGG + Intergenic
1112337888 13:98529387-98529409 CAACTCTGACAGCAGGTCACAGG - Intronic
1117066340 14:52015942-52015964 CAATTCTGGAAACTGGGCTGTGG - Intronic
1117537358 14:56714841-56714863 CAAATCTGGCAACTGGGCCTGGG + Intronic
1117539164 14:56729924-56729946 CATTTTGGACAACTGGGCAGGGG - Intronic
1117712627 14:58547817-58547839 CATCACTGACATCTTGGCAGGGG - Exonic
1118840893 14:69509978-69510000 CAACTCTGACAATGGAGCAAAGG - Intronic
1119204508 14:72784016-72784038 CAACTCTGACAGGAGGGCAGAGG - Intronic
1119772468 14:77228888-77228910 CAATCCTGACAAGGGGGCAGGGG + Intronic
1121472467 14:94166000-94166022 CAACTCTGACCAATGGGAGGTGG + Intronic
1123423465 15:20149331-20149353 CAACTGTTAAAACTAGGCAGAGG - Intergenic
1123532686 15:21155852-21155874 CAACTGTTAAAACTAGGCAGAGG - Intergenic
1124240539 15:28024410-28024432 CAACACTTACCGCTGGGCAGAGG + Intronic
1125422656 15:39519942-39519964 CACCTGTCACCACTGGGCAGGGG + Intergenic
1126071898 15:44872856-44872878 CAACTCTGAAGTCTGGGCATTGG - Intergenic
1126086358 15:45014130-45014152 CAACTCTGAATTCTGGGCATTGG + Intergenic
1128884259 15:71272098-71272120 CAACTCTTAAAAATGGGCAAAGG + Intronic
1129303371 15:74640063-74640085 CCACACTGACAACTGAGTAGGGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129897234 15:79117550-79117572 CAACTCTGCCTTTTGGGCAGTGG - Intergenic
1130416913 15:83702683-83702705 AACCTCTGAAATCTGGGCAGAGG - Intronic
1131440817 15:92458378-92458400 CATCTCTGGTAACTGGGCTGGGG - Intronic
1132908480 16:2296581-2296603 TGGCTCTGCCAACTGGGCAGTGG + Intronic
1133118928 16:3594640-3594662 CTGCTCTGCTAACTGGGCAGTGG + Intronic
1135389568 16:22078805-22078827 CAACACTGATAAGTGGGCATTGG + Intronic
1136861356 16:33706275-33706297 CAACTGTTAAAACTAGGCAGAGG + Intergenic
1138341389 16:56291605-56291627 GAACTCTGGCAAGGGGGCAGAGG - Intronic
1139736223 16:68991186-68991208 CAGCTCTGAGAGCTGAGCAGAGG + Intronic
1140830178 16:78743616-78743638 CAACTCAGAAAAGTGGGGAGGGG - Intronic
1140977999 16:80079409-80079431 GAGCTCTGGCAACTGGGCTGTGG - Intergenic
1141281297 16:82631927-82631949 CAACTCTGGCTTCTGGGCAGAGG + Intronic
1203122854 16_KI270728v1_random:1554466-1554488 CAACTGTTAAAACTAGGCAGAGG + Intergenic
1146687739 17:34852813-34852835 CAGCTCTGACCAATGGGCTGTGG + Intergenic
1148713706 17:49700388-49700410 CCACTCAGACAACTCGACAGTGG + Intergenic
1149907622 17:60540780-60540802 CTACTCTGGAAGCTGGGCAGAGG + Intergenic
1151114021 17:71713206-71713228 AAACTCAGACAACTGGTCAGTGG - Intergenic
1151674894 17:75592324-75592346 CTACTCTGGGAACTGGGCAGGGG - Intergenic
1152373421 17:79904826-79904848 TAGGTCTGAAAACTGGGCAGAGG - Intergenic
1152477835 17:80529721-80529743 CAAATCTGATAAGTGAGCAGTGG - Intergenic
1152677063 17:81647089-81647111 CAACCCTGAAAACTGGCCATTGG + Intronic
1152888514 17:82866675-82866697 CAGCACTGCCACCTGGGCAGAGG + Intronic
1152889538 17:82872729-82872751 CAACCCTGAGAGGTGGGCAGGGG + Intronic
1153590800 18:6672476-6672498 CAGCTCTGGAAACTGGGCAAGGG + Intergenic
1158498034 18:57974258-57974280 CAACTCTGAGAACAGAGCAAGGG - Intergenic
1164449980 19:28352206-28352228 CAACTCTGACCCGTGGGCATGGG - Intergenic
1164489136 19:28690617-28690639 CAACTTTCACAATTGGCCAGTGG + Intergenic
1165010212 19:32840568-32840590 CAAATCTCTCAACTGGGAAGGGG - Intronic
1166666260 19:44682384-44682406 CTCCTCTGACAAATGGGCACTGG - Intronic
1167045140 19:47045360-47045382 CACCTCTGTCATCCGGGCAGGGG + Exonic
1167072182 19:47227774-47227796 CAACTCTGGCCTCTGGGGAGGGG - Intronic
1167094847 19:47369691-47369713 TAACAGTGACATCTGGGCAGAGG + Intronic
1202693498 1_KI270712v1_random:106827-106849 CAACTGTTAAAACTAGGCAGAGG - Intergenic
925351672 2:3205302-3205324 TATGTCTGACAACTGGACAGAGG + Intronic
926116932 2:10219303-10219325 CAACTCACACAGCTGGGAAGTGG + Intergenic
926256317 2:11204204-11204226 CAAGTCTGACAACAGGGAATGGG - Intronic
927420474 2:22925634-22925656 CCACCCTGACACCTGAGCAGAGG + Intergenic
927462290 2:23309714-23309736 CATCTCTGTCCACTCGGCAGAGG + Intergenic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
929629119 2:43440839-43440861 CCACTCTGAGAAAAGGGCAGTGG + Intronic
930427847 2:51234188-51234210 AAACTCTGAAATCTAGGCAGAGG + Intergenic
931147931 2:59540511-59540533 CAACTCTGAAAACTGCCCAAAGG + Intergenic
931540660 2:63325798-63325820 CAACCCTGAAGTCTGGGCAGTGG + Intronic
933953074 2:87347755-87347777 CAACTGTTAAAACTAGGCAGAGG + Intergenic
934237306 2:90244100-90244122 CAACTGTTAAAACTAGGCAGAGG + Intergenic
934459729 2:94207394-94207416 CAACTGTTAAAACTAGGCAGAGG + Intergenic
936057527 2:109272109-109272131 CAGCTCCGACAGCTGGCCAGAGG - Intronic
938679314 2:133673202-133673224 CACCTCTGAAAATGGGGCAGTGG - Intergenic
940561479 2:155302435-155302457 CAATTCTGAGAACTGTGCTGAGG - Intergenic
940972113 2:159905667-159905689 CAACTGTGAAACCTTGGCAGTGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
946006986 2:216533708-216533730 CCACCCTGACCACTGGGCAGAGG - Intronic
946601534 2:221365246-221365268 CATCTCTGATCTCTGGGCAGTGG - Intergenic
948156445 2:235787158-235787180 CAACTCTTACAACAGGAGAGGGG - Intronic
948455113 2:238101278-238101300 CAACTCTGACCTCTGGGCGGCGG - Intronic
948470688 2:238176027-238176049 GAACTTTGAAAACTGGGCAACGG - Intronic
1169134683 20:3190224-3190246 CATCTCTGTTAACTGGGGAGGGG - Intergenic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1173398371 20:42702057-42702079 CAAGTGTGACAAGTGGGAAGTGG - Intronic
1173932654 20:46833590-46833612 CATCTCTCACAAGTGCGCAGTGG - Intergenic
1177602681 21:23336165-23336187 AAACTCTGAAATCTAGGCAGAGG - Intergenic
1180903030 22:19388362-19388384 CTACTATGACACCTGGGGAGGGG + Intronic
1181106575 22:20579298-20579320 CACCACTGACACCTGGGCACAGG + Intronic
1181106725 22:20580021-20580043 CACCACTGACACCTGGGCACAGG + Intronic
1181356469 22:22299062-22299084 CAACTGTTAAAACTAGGCAGAGG - Intergenic
1182981054 22:34671808-34671830 CAAATCTGAAAACTTGGCAAGGG - Intergenic
1184875981 22:47275840-47275862 GAAATCTGAGAACTGGCCAGAGG - Intergenic
1184878636 22:47291221-47291243 CACCTCTGCCTGCTGGGCAGCGG - Intergenic
950263894 3:11561052-11561074 CATCTCTGAGAGCTGGACAGGGG - Intronic
950442315 3:13017411-13017433 CCACTCTGACACATGGGAAGAGG - Intronic
950667505 3:14506229-14506251 CAACTCAGAGGACTGGGTAGGGG - Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
953734066 3:45476336-45476358 CAGCTCTGACCACTGGGCCAGGG - Intronic
954294681 3:49667709-49667731 CAAGTCGGACCACTGGCCAGGGG + Exonic
955506678 3:59639675-59639697 AAACCCTGACATCTGGGGAGGGG - Intergenic
956392686 3:68790658-68790680 CAAATCTGACATTTGTGCAGAGG + Intronic
957988173 3:87597235-87597257 TACCTCTGAAAACTAGGCAGAGG + Intergenic
960539565 3:118848442-118848464 CAATTCTGCCAACTGTGCACTGG - Intergenic
964256638 3:154781946-154781968 TAAATCTGATAACTTGGCAGAGG + Intergenic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
964954442 3:162334957-162334979 CACCTCTGAAATCTAGGCAGTGG - Intergenic
965062913 3:163805142-163805164 CAACTCTGAAGTCTGGGCATTGG + Intergenic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
967218215 3:187227863-187227885 CCACACTGACACCTGGGTAGAGG - Intronic
967425414 3:189321497-189321519 CAAGTTTGACATCTGGGCATCGG - Exonic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
970656443 4:18235535-18235557 CAGATCTGAAAACTGGGCAAAGG - Intergenic
972835813 4:42868637-42868659 CAGCTCTACCAAGTGGGCAGTGG - Intergenic
973057741 4:45681211-45681233 CACATCTGAAAACTGGGCAAGGG - Intergenic
976445077 4:85120998-85121020 CTGCTCTTACAACAGGGCAGAGG - Intergenic
978747337 4:112209006-112209028 CAACCCTGAAATCTGGGCATTGG + Intergenic
979006617 4:115306422-115306444 CATCACAGACCACTGGGCAGAGG + Intergenic
980102906 4:128559510-128559532 CCACTCTGGCAACTGAGCAGAGG - Intergenic
980228741 4:130020594-130020616 CACCTCTGACCTCTGGGAAGGGG - Intergenic
983298033 4:165890956-165890978 CATCTCTGAAATCTAGGCAGAGG + Intronic
984009188 4:174349933-174349955 CAACTATTACAACTGTGTAGGGG + Intergenic
986499400 5:8383271-8383293 CAACCCTGTGAACTGGGCACTGG - Intergenic
988320305 5:29686358-29686380 CAACCCAGTCCACTGGGCAGAGG + Intergenic
988628959 5:32908735-32908757 CACCTCTAAAAACTGGGCTGTGG - Intergenic
990197725 5:53337418-53337440 GAACTCTGAAAATTGGGAAGGGG + Intergenic
994759692 5:103836872-103836894 GTACTCTGACATCTGGTCAGGGG + Intergenic
995621411 5:114030029-114030051 CTACGCTGACTTCTGGGCAGGGG + Intergenic
995674167 5:114643699-114643721 AAACTCTGACCACTGGTGAGTGG + Intergenic
996099067 5:119429293-119429315 CAACCCTGAAGACTGGGCATTGG - Intergenic
996563593 5:124856883-124856905 CAACTCTGAGAACTGATCAAGGG - Intergenic
997072555 5:130637150-130637172 CAACCCTGAAATCTGGGCATTGG + Intergenic
997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG + Intronic
997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG + Intronic
998345972 5:141463825-141463847 CCACTATAACAACTGGGAAGTGG - Intronic
999658611 5:153834983-153835005 CAGCTCTGACAGCTGGAAAGTGG - Intergenic
1000344743 5:160305308-160305330 GAACTCTGACAGCTGGATAGTGG - Intronic
1003438870 6:6121610-6121632 CTACTCTGCCAACTTGGTAGGGG - Intergenic
1003547614 6:7073777-7073799 CAAGTCTGACAAATGGACAAAGG - Intergenic
1004103108 6:12635474-12635496 CATCTCTGAATACTGGGCAGTGG + Intergenic
1004325441 6:14670261-14670283 CAACTCTACTAACTGGGCAAGGG + Intergenic
1004554293 6:16680541-16680563 CAGCTCTGACACTGGGGCAGGGG + Intronic
1005890606 6:30134892-30134914 CACCTCTGACCTCTGGGGAGGGG - Intergenic
1007782126 6:44260365-44260387 CACTTCTGACTGCTGGGCAGGGG + Intronic
1009479497 6:64139273-64139295 AAACTTTGGCAACTGGGAAGTGG + Intronic
1015283691 6:131460818-131460840 CAGCTCTCACATCTGGGCACGGG + Intergenic
1018710965 6:166497946-166497968 CCACTCTCCCAGCTGGGCAGGGG - Intronic
1019709200 7:2510671-2510693 CAGCCCTCCCAACTGGGCAGTGG + Intergenic
1021187834 7:17585940-17585962 CCACTCCGAAAACCGGGCAGTGG + Intergenic
1021574890 7:22097923-22097945 AAACTGTGCTAACTGGGCAGAGG + Intergenic
1023690173 7:42778245-42778267 CAACTGTGACAGAAGGGCAGAGG - Intergenic
1024995980 7:55273528-55273550 CCACTTTGACAACTGGGCCATGG + Intergenic
1028157376 7:87446881-87446903 CAGCTCTGCCCACTGGACAGTGG + Intronic
1029160871 7:98550839-98550861 CAAACTTGACTACTGGGCAGGGG + Intergenic
1032211666 7:129920732-129920754 AAAATCTGACAACTGGGAAATGG + Intronic
1035061617 7:156073610-156073632 CTGCTCTGACACCTGGGCTGAGG - Intergenic
1038298967 8:26324486-26324508 CACGTCTGAAAACTAGGCAGAGG - Intronic
1039824824 8:41164104-41164126 CAACCCAGACATGTGGGCAGTGG - Intergenic
1039999539 8:42564589-42564611 CAACCCTGAAATCTGGGCATTGG - Intergenic
1040024584 8:42770127-42770149 CAACACTGATATCTGGTCAGAGG - Intronic
1040796677 8:51295709-51295731 CAACTCTGAAGTCTGGGCATTGG - Intergenic
1042407546 8:68422806-68422828 CTCCTCTGAAATCTGGGCAGAGG + Intronic
1043963187 8:86441674-86441696 GTCCTCAGACAACTGGGCAGTGG - Intronic
1047466009 8:125115063-125115085 CAACTCTCAGAGCTTGGCAGTGG + Intronic
1050149824 9:2608285-2608307 AAACTCTGACAAGTGGGCACTGG - Intergenic
1050730484 9:8703768-8703790 GAACTCAGAAAACTGGGCTGGGG - Intronic
1051682603 9:19623064-19623086 CAACTCAGACAAGGGGGCAGTGG + Intronic
1052161801 9:25271452-25271474 AATCTCTGACAACTGGGTGGGGG - Intergenic
1052900949 9:33794657-33794679 AAACTCTGACATCTGATCAGGGG + Intronic
1053411509 9:37918937-37918959 CTGCTCTGACAACTGGGCTGAGG - Intronic
1053690233 9:40583208-40583230 CAACTATTAAAACTAGGCAGAGG + Intergenic
1054301483 9:63384168-63384190 CAACTATTAAAACTAGGCAGAGG + Intergenic
1056200402 9:84270120-84270142 CAAGGCTGACAGCTGGGGAGGGG - Intergenic
1056510991 9:87305410-87305432 TGACTCTGACAACTTGTCAGGGG - Intergenic
1056958483 9:91101515-91101537 CATCTGGGACAACTGGGCAGGGG - Intergenic
1057039445 9:91836810-91836832 CACCTCTGCCGCCTGGGCAGTGG + Intronic
1058097564 9:100880258-100880280 CAACTGTGAGAATTGGGCAGAGG - Intergenic
1060892072 9:127195312-127195334 CAACTCCCAGAACAGGGCAGGGG - Intronic
1061074317 9:128332021-128332043 AAACTCTGGCGACTGGCCAGGGG - Intronic
1062478744 9:136742009-136742031 GAACCCTGAAAACTGCGCAGCGG + Exonic
1188727893 X:33607480-33607502 CCACCCTGCCAACTGGGTAGGGG + Intergenic
1189430070 X:40938415-40938437 CTCCTCTGACATCTGGGCAGAGG + Intergenic
1190072624 X:47291573-47291595 CAACTCTGGACACTGGGCAAAGG - Intergenic
1192153700 X:68727507-68727529 CCACTCTGGCAACAGGGCACTGG - Intergenic
1192299091 X:69881518-69881540 CAACTATGGCAACTGGGCTAAGG - Intronic
1193766780 X:85539227-85539249 CATCTCTGTCAATTGAGCAGAGG - Intergenic
1195822534 X:108962315-108962337 CAATGGAGACAACTGGGCAGGGG + Intergenic
1200252738 X:154562389-154562411 CCACTCTGCCACCTGGTCAGAGG - Intronic
1200265029 X:154642027-154642049 CCACTCTGCCACCTGGTCAGAGG + Intergenic
1200706683 Y:6449015-6449037 TAGCTCTGACAAATGGGCACCGG - Intergenic
1200920983 Y:8612700-8612722 CAGCTCTGACAATTGGGCGCTGG + Intergenic
1200922659 Y:8627076-8627098 CAACTCTAACATCTGGGCCCCGG + Intergenic
1200924836 Y:8645063-8645085 CAATTCTAACAGCTGGGCACCGG + Intergenic
1200930378 Y:8691584-8691606 CAGCTCTGACAGTTGGGCACTGG - Intergenic
1201027429 Y:9715693-9715715 TAGCTCTGACAAATGGGCACCGG + Intergenic
1201530682 Y:14987017-14987039 CAACCCTGACGTCTGGGCATTGG + Intergenic