ID: 927515626

View in Genome Browser
Species Human (GRCh38)
Location 2:23670183-23670205
Sequence TCCAGTTAGCCCGCGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927515626_927515635 30 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515635 2:23670236-23670258 CCCAGGAGGAGGGATTGGCCTGG 0: 1
1: 0
2: 4
3: 38
4: 441
927515626_927515631 19 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515631 2:23670225-23670247 AAGATCACACACCCAGGAGGAGG 0: 1
1: 0
2: 14
3: 141
4: 918
927515626_927515628 -6 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515628 2:23670200-23670222 ACTGGAAGACAGGATTCAGCAGG 0: 1
1: 0
2: 0
3: 25
4: 201
927515626_927515633 25 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515633 2:23670231-23670253 ACACACCCAGGAGGAGGGATTGG 0: 1
1: 2
2: 3
3: 28
4: 303
927515626_927515629 13 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515629 2:23670219-23670241 CAGGCAAAGATCACACACCCAGG 0: 1
1: 0
2: 1
3: 24
4: 720
927515626_927515630 16 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515630 2:23670222-23670244 GCAAAGATCACACACCCAGGAGG 0: 1
1: 0
2: 0
3: 27
4: 197
927515626_927515632 20 Left 927515626 2:23670183-23670205 CCTGAGCTCGCGGGCTAACTGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 927515632 2:23670226-23670248 AGATCACACACCCAGGAGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927515626 Original CRISPR TCCAGTTAGCCCGCGAGCTC AGG (reversed) Intronic
902801659 1:18833988-18834010 TCCAGTGAGCTGGAGAGCTCTGG + Intergenic
904592274 1:31621561-31621583 TCCAGATATTCCGCAAGCTCTGG + Exonic
920113067 1:203600680-203600702 TCCAGTTAGCCTGGGGCCTCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1084142116 11:67239657-67239679 TGCAGTCAGCCAGAGAGCTCTGG + Intronic
1091857847 12:3753361-3753383 TCCAGTGAGCCAGCGAGGGCCGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1121776569 14:96594744-96594766 TCCAGTGAGCCCCTGAGGTCGGG + Intergenic
1135616495 16:23915115-23915137 TCCCGTTAGCCCCTGATCTCTGG + Intronic
1142141415 16:88474337-88474359 TCCAGGCAGCCCCCCAGCTCTGG - Intronic
1142416822 16:89947832-89947854 TAAACTGAGCCCGCGAGCTCAGG + Intergenic
1143130484 17:4674213-4674235 TGCGGTTAGACCGGGAGCTCTGG - Intronic
1147503021 17:40984103-40984125 ACCAGTCAGCCCGCGAGACCTGG + Exonic
1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG + Intergenic
1152790047 17:82273820-82273842 TCCTGTTACCCCGGGACCTCGGG + Intergenic
1162000802 19:7743825-7743847 TCCAGTAAGGCCACCAGCTCAGG - Intronic
1165309480 19:35021785-35021807 CCCCGTGAGCCCGCCAGCTCAGG - Exonic
927515626 2:23670183-23670205 TCCAGTTAGCCCGCGAGCTCAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947229498 2:227871102-227871124 TCCATTTAGGCTGCGACCTCTGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948604599 2:239126825-239126847 CCCAGTTAGCGAGCCAGCTCTGG - Intronic
1178975241 21:37215664-37215686 TCCCGTTAGCCTGGGAGTTCTGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953410078 3:42685814-42685836 TGCAGCTCGCCCGCGCGCTCCGG - Exonic
954390603 3:50266312-50266334 TCCAGGAAGCCCACGAGCCCAGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
967859757 3:194141763-194141785 TCCAGTTCCCCCGGTAGCTCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985551907 5:538064-538086 TCCACTCAGCCCACGAGCTCAGG + Intergenic
985551926 5:538169-538191 TCCACCTAGCCCACGAGCTCAGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992269781 5:75053036-75053058 TCCACTCCGCCCGCGAGCCCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998660916 5:144236722-144236744 TGCATTTAGCCCTGGAGCTCTGG + Intronic
999287084 5:150400577-150400599 TCGAGTTAGGCCTCGAGCTAGGG + Intergenic
1019163665 6:170085345-170085367 TCCAGTATTCCCGGGAGCTCTGG + Intergenic
1031974980 7:128087907-128087929 TCCAGATCCCCCGGGAGCTCAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1039435441 8:37556531-37556553 TCCAGCCAGCCCTGGAGCTCAGG + Intergenic
1041829953 8:62143199-62143221 TGCAGTGTGCCCGCGAGCCCCGG - Intergenic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1049337176 8:142092614-142092636 TCCACTTAGCCAGCGAGCCCAGG - Intergenic
1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG + Intronic
1052461660 9:28772269-28772291 TCCAGTCAGACCGCGGTCTCAGG + Intergenic
1060999459 9:127894892-127894914 TCCAATTAGACCGTGAGCTCTGG + Intronic
1186381924 X:9069925-9069947 TCCCGATAGCCAGCCAGCTCTGG + Intronic
1190415515 X:50176736-50176758 TCCTGTTAGCCCAGGAGTTCAGG - Intergenic