ID: 927515956

View in Genome Browser
Species Human (GRCh38)
Location 2:23671808-23671830
Sequence GGCTGGGGATGGAGGGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1583
Summary {0: 1, 1: 3, 2: 10, 3: 179, 4: 1390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927515944_927515956 5 Left 927515944 2:23671780-23671802 CCACTTCTGGAACCTAGGGCTGC 0: 1
1: 0
2: 1
3: 18
4: 157
Right 927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG 0: 1
1: 3
2: 10
3: 179
4: 1390
927515942_927515956 9 Left 927515942 2:23671776-23671798 CCAGCCACTTCTGGAACCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG 0: 1
1: 3
2: 10
3: 179
4: 1390
927515947_927515956 -7 Left 927515947 2:23671792-23671814 CCTAGGGCTGCCCACTGGCTGGG 0: 1
1: 0
2: 8
3: 40
4: 452
Right 927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG 0: 1
1: 3
2: 10
3: 179
4: 1390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927515956 Original CRISPR GGCTGGGGATGGAGGGCAGC GGG Intronic
900103925 1:974205-974227 GACTGGGGAGGGAGAGCAGGGGG + Intronic
900182599 1:1318912-1318934 GGCAGGGGCTGGAGGGGAGATGG - Intronic
900190947 1:1351982-1352004 GGATGGGGAGGGAGGGAGGCTGG - Intergenic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900326539 1:2111060-2111082 GGCTCAGGATGGAAGGCAGGAGG + Intronic
900387314 1:2416546-2416568 AGCTGGGGAGGGTGGGCAGCGGG + Intergenic
900395655 1:2452284-2452306 GCCGGGGGATGGGGGGCGGCAGG - Intronic
900480465 1:2895711-2895733 GGCTGGTGAGTGAGGGAAGCTGG + Intergenic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900504282 1:3021532-3021554 GGCTGAGGATGCAGGGCTCCCGG + Exonic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900548354 1:3241270-3241292 TTCCGGGGATGCAGGGCAGCTGG + Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900579104 1:3399571-3399593 GGCTGGGGTTGGGGAGCAGCAGG + Intronic
900636557 1:3668994-3669016 GCCTGGAGCTGCAGGGCAGCTGG - Intronic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
900969181 1:5980113-5980135 GGCCAGGGAGGGTGGGCAGCTGG - Intronic
901025656 1:6277512-6277534 GGCTGGGGAGAGAGGGCTGGTGG - Intronic
901061257 1:6473010-6473032 GCCTGAGGCTGGAGGACAGCTGG - Exonic
901159064 1:7161271-7161293 GGGTGGAGAAGGAGGGCTGCAGG - Intronic
901433642 1:9233497-9233519 GGCTGGGAACTGAGGGGAGCTGG - Intergenic
901480195 1:9519824-9519846 GGCTGGGGAAGGAGAGCGGCCGG + Intergenic
901499313 1:9641737-9641759 ACCTGGGGATGGAGGGCACAAGG + Intergenic
901623904 1:10612619-10612641 GGCTGTGGATGGCTGGCAGTGGG - Intronic
901757851 1:11452199-11452221 GGTTGGGGGAGGGGGGCAGCTGG - Intergenic
901781577 1:11598072-11598094 GGCTGGGCATGGAGGCCTCCAGG + Intergenic
901829221 1:11881841-11881863 GGCTGGAGAGGGAGGGTAGGTGG + Intergenic
901934926 1:12620334-12620356 TGCCTGGGATGGAGGGCAGACGG + Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902700917 1:18171313-18171335 GGCTGGGGTCAGAGGGCTGCAGG + Intronic
902796524 1:18804095-18804117 GGCTGGGGGCGGCAGGCAGCTGG - Intergenic
902918420 1:19652489-19652511 CACTGGGGAGGAAGGGCAGCTGG - Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903170274 1:21548171-21548193 GGCAGAGGGTGGTGGGCAGCCGG + Intronic
903192358 1:21663833-21663855 GGCTGGGGTTTGGGGGCAGTGGG - Intronic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
903232745 1:21931745-21931767 GGCTCAGGAGGGAGGGCAGGAGG - Intronic
903262031 1:22136608-22136630 GGCTGGGGGTACAGGGCTGCAGG + Intronic
903327614 1:22579995-22580017 AGGTGGGGATGGAGTCCAGCTGG + Intronic
903611048 1:24613043-24613065 GGCTGGGGAGAGAGGGCAGTGGG - Intergenic
903770904 1:25763789-25763811 TGCTGAGGATGGGAGGCAGCTGG - Intronic
903950640 1:26994115-26994137 TGCTGGAGGTGGAGGGCCGCCGG + Exonic
904083373 1:27886164-27886186 GCCTTGGGATGCAGAGCAGCTGG + Exonic
904370798 1:30046248-30046270 TCCAGGGGAGGGAGGGCAGCTGG + Intergenic
904472786 1:30746295-30746317 GGCTGGGGGTGGAGGACTGTGGG - Intronic
904530342 1:31164537-31164559 GGCTGGGGGTGGAGGGGTGGGGG - Intergenic
905016560 1:34782156-34782178 AGCTGGCTTTGGAGGGCAGCTGG + Intronic
905020897 1:34811157-34811179 TGCTGGGGAGGGAGAGCATCAGG + Intronic
905252900 1:36661071-36661093 GCTTGGTGAAGGAGGGCAGCAGG + Intergenic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905322327 1:37126938-37126960 GGCTGGGGAAGGAGGACATGAGG - Intergenic
905630170 1:39514180-39514202 GGCTGGGGCTGGAGAGAACCCGG + Intronic
905667590 1:39772010-39772032 GGCTGGGGCTGGAGAGAACCCGG - Intronic
905894149 1:41534352-41534374 GGCTGGAGGGGGAGTGCAGCAGG - Intronic
906104294 1:43282803-43282825 AGCTGGGGACAGAGGGTAGCAGG - Exonic
906242374 1:44249789-44249811 GGCTGAGGCTGGAGCGCAGTGGG + Intronic
906382807 1:45343465-45343487 GCCTGGGGATGGATTGCACCGGG + Exonic
906525392 1:46490500-46490522 GGCTGGGGAGGGGGCGCGGCCGG + Intergenic
906684964 1:47757374-47757396 GGCTGGGCTTGGAGGGGAGGAGG - Intergenic
906692876 1:47804288-47804310 GGCTGGGGATGGATCACAGGAGG + Intronic
906694990 1:47817773-47817795 GGCTGGGGATGGTGGGAGTCTGG - Intronic
906812577 1:48844057-48844079 GGCTGGTGTTGGGGGGCAGAAGG - Intronic
907193143 1:52665386-52665408 GGGTGGGGACAGAGGTCAGCAGG + Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
907712521 1:56897512-56897534 GGCTGGGGACTGAGGGCAACAGG + Intronic
907865521 1:58396118-58396140 GGCAGGGGAGGGAGGGGAGGGGG + Intronic
908465093 1:64385935-64385957 GGGTGGGGAGGGAGAGCATCAGG - Intergenic
908556027 1:65257001-65257023 GGCAGGGGAGGGAGGGCATCAGG - Intronic
908562267 1:65318713-65318735 GGCGGGGGAAGGAGAGCATCAGG + Intronic
908782959 1:67708536-67708558 GGCTAAGGAGAGAGGGCAGCAGG - Intronic
908794742 1:67819912-67819934 GACTGGGGATGGAGGTGACCAGG - Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909506427 1:76395828-76395850 GGCTGGGGATGAAGAGAGGCTGG + Intronic
910438591 1:87229797-87229819 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
910762239 1:90745187-90745209 GGTTGGTGGTGGAGGGTAGCGGG - Intergenic
911102376 1:94104819-94104841 GGCTGGGTTTGGAAGACAGCCGG - Intronic
911896828 1:103446576-103446598 GTCTGGGGAGGGAGAGCATCAGG + Intergenic
912220086 1:107664330-107664352 GGTTGGGGAGGGAGAGCATCAGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912561581 1:110555355-110555377 GCCTGGGGAAGGAGGTCTGCAGG + Intergenic
912573014 1:110638232-110638254 GGCTGAGGAAGCTGGGCAGCAGG + Intergenic
912715582 1:111981570-111981592 GACGGAGGTTGGAGGGCAGCTGG - Intronic
913185025 1:116363058-116363080 GGATAGGGATGCAGGGAAGCTGG - Intergenic
913186184 1:116372925-116372947 GGCGGGTCATGCAGGGCAGCGGG + Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913491179 1:119381369-119381391 GGCAGGGGAGGGAGGGCTGATGG + Intronic
913969683 1:143405281-143405303 GGCTGGGCATGTAAGCCAGCTGG - Intergenic
913971818 1:143422398-143422420 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914064056 1:144230874-144230896 GGCTGGGCATGTAAGCCAGCTGG - Intergenic
914066197 1:144248011-144248033 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914112956 1:144718343-144718365 GGCAGGGGAAGGACGGCAGTGGG + Intergenic
914115094 1:144735480-144735502 GGCTGGGCATGTAAGCCAGCTGG + Intergenic
914921127 1:151848067-151848089 GGCTGGGGAAGGAGAGTGGCAGG + Intronic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915091007 1:153426193-153426215 TGCTGAGGCTGGAGTGCAGCAGG - Intergenic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915437295 1:155917599-155917621 GGCTGGGGCTGGGGGCCAGCAGG + Exonic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
915493941 1:156267719-156267741 GGCTGGGGAAGGAGAAGAGCAGG + Intronic
915562063 1:156693223-156693245 GGCGGGGGATAAAAGGCAGCAGG - Intergenic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916103250 1:161410907-161410929 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
916378418 1:164181981-164182003 GGCTGGTGGGGTAGGGCAGCAGG - Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916437269 1:164788742-164788764 GGCGGGGGGGGGAGGGCGGCGGG - Intronic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
916577656 1:166081762-166081784 GGCTGGAGGTAGAGGTCAGCAGG + Intronic
916804961 1:168250405-168250427 GGAAGGGAATGCAGGGCAGCAGG - Exonic
916894805 1:169151427-169151449 GTCTGAGGATGGTGGTCAGCTGG - Intronic
917755489 1:178094081-178094103 GGCTGGGGATGGAGCGGGGCCGG - Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918077075 1:181178503-181178525 GGATGGGGTGGGGGGGCAGCGGG + Intergenic
918409459 1:184243777-184243799 TGCCGGGGAGGGAGGGCAGGGGG - Intergenic
918782708 1:188723244-188723266 GGATGGGGGTTGAGGGCAGTGGG - Intergenic
919834923 1:201567051-201567073 GGCTGGGGATGGGGGGTGGGAGG - Intergenic
919980076 1:202637539-202637561 GGCTGGGACTTGAGGGCAGCCGG - Intronic
920021124 1:202957789-202957811 GCGTGGGGAGGGAGGGCTGCGGG - Intronic
920215340 1:204358734-204358756 GGGTGGGGAGGGAGAGCTGCAGG - Intronic
920352176 1:205344339-205344361 GGATGGGGACGGAGCGGAGCAGG - Exonic
920498472 1:206471582-206471604 GGCTGGGGTTGGAGCACAGCAGG - Intronic
920676552 1:208042270-208042292 GGGTGCGGATGAAGGTCAGCAGG + Exonic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920703295 1:208233856-208233878 TGCTGTGGATGGAGGAAAGCTGG + Intronic
920955711 1:210618739-210618761 AGCCGGGGATGGGGGGCTGCAGG - Intronic
920958987 1:210647555-210647577 GGCTGGGGGCGGTGGGAAGCAGG - Intronic
921081150 1:211739150-211739172 GGCGGGGGGTGAAGGGGAGCTGG + Intergenic
921118212 1:212114198-212114220 GGCTTGGGAGGGATGGCATCAGG + Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
921982343 1:221272380-221272402 GGCTGGGGTGGGAGGAGAGCTGG - Intergenic
922315138 1:224434920-224434942 GTCAGGGGAGGGAGGCCAGCGGG + Intronic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922507282 1:226133868-226133890 GCCTGGGGAGGGAGAGGAGCTGG + Intergenic
922549306 1:226482390-226482412 GGCTGGGGAGGCAGGGCTGGTGG + Intergenic
922586734 1:226738905-226738927 GGCTGGGGAGGCAGGGAAGGGGG - Intronic
922606565 1:226893315-226893337 GGTGGGGGAAGGAGGACAGCTGG + Intronic
922730227 1:227945680-227945702 GGCTGGAGCTGGAGGGGGGCTGG - Intronic
923090611 1:230737886-230737908 GGCTGGGGATGGGGTGAAGTGGG - Intergenic
923628421 1:235633268-235633290 GGCTGGGGATGGAGACAAGCAGG + Intronic
923637168 1:235710426-235710448 GGCTGGGGATGGGGTGCATAAGG + Intronic
923853319 1:237820208-237820230 GGTGGGGGAGGGAGGGTAGCTGG + Intronic
924386916 1:243507526-243507548 GGCTGCGGTGGGAGGGGAGCTGG + Intronic
924522206 1:244815150-244815172 GGCTGGGGATGCAGCCCAGTAGG - Intergenic
924548927 1:245056002-245056024 GGCTGGGGCAGGAGGACGGCTGG - Intronic
924948130 1:248859306-248859328 GGCTGGGGTTGGAGCACAGGAGG - Intergenic
1062941937 10:1428674-1428696 GGCTGGGGATGGGAGGGAGGGGG + Intronic
1062961632 10:1576940-1576962 GGCTGGGGCTGGGTGACAGCGGG + Intronic
1063190529 10:3689800-3689822 GGCTGGGGCTGGAGAGGACCTGG - Intergenic
1063450154 10:6145453-6145475 GCCCGGGGCTGGAGCGCAGCGGG - Intronic
1063576306 10:7265163-7265185 GGCAGGGGAGGGAGGGAAGGAGG - Intronic
1063721275 10:8584089-8584111 GGCTGTGGGTGTAGGGGAGCAGG + Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064700105 10:18009607-18009629 GGCAGGGGATTGGGGGGAGCAGG + Intronic
1064782879 10:18862149-18862171 GGCTGGCGATGGAGGTCTGAAGG + Intergenic
1064982029 10:21174383-21174405 GGCTGGGGAGGGAGGGATCCAGG + Intergenic
1065490125 10:26274528-26274550 GGCAGGGGATGGTGGGCATTTGG - Intronic
1065686792 10:28293661-28293683 AGCTGGGGAGGGAGCGGAGCGGG + Intronic
1066253944 10:33660827-33660849 GGGAGGGGCTGGAGGGCAGGGGG - Intergenic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067085444 10:43235667-43235689 GGCTTGGGATGCAGGGCCTCTGG + Intronic
1067146278 10:43695935-43695957 GGCTTGGCATGGATGGCGGCGGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067792190 10:49296738-49296760 GGCTGGGGATGGTCTGCATCAGG + Intergenic
1067938836 10:50635278-50635300 GGCTGGTCATGGTGGGCATCTGG + Intergenic
1068620453 10:59176444-59176466 GGCAGTGGCTGGAGGGCAGGTGG + Intergenic
1068955113 10:62814713-62814735 GGCTGGGGGTGGAGGGGAGTTGG - Intronic
1068955167 10:62814952-62814974 CGCCGGGGATGGGGAGCAGCCGG - Intronic
1069260468 10:66387941-66387963 GTCAGGGGATGGAGGGCTGGGGG + Intronic
1069353076 10:67552651-67552673 GGTTGGGGAGGGAGAGCATCAGG - Intronic
1069553107 10:69378138-69378160 GGCTGGGAAGGAAGGGGAGCGGG + Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1069784824 10:70981307-70981329 GGCTGGGGAGGCAGGGATGCTGG - Intergenic
1069856917 10:71446328-71446350 GGTTGGTGAAGAAGGGCAGCCGG - Intronic
1069891843 10:71656919-71656941 GGTAGGGGATGGAGGGGACCAGG + Intronic
1070162376 10:73874121-73874143 GGGCGGGGCTGGAGGGCACCCGG + Intronic
1070367415 10:75750481-75750503 GGCGGGGGGTGGGGGGCAGAGGG + Intronic
1070387124 10:75935693-75935715 GGCAGGGCATGAAGGGCTGCAGG + Intronic
1070398963 10:76036150-76036172 GGGTGGGGAGTGGGGGCAGCGGG - Intronic
1070565694 10:77602392-77602414 GGCTGGGGAAGGAGGGGTGTGGG + Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070829686 10:79410799-79410821 GTCTGGGGATGGGTGGCAGAGGG + Intronic
1071414782 10:85431066-85431088 GGTTGAGGATGGAGGGCTTCTGG - Intergenic
1071503964 10:86221945-86221967 GGCAGGGGGTGGGAGGCAGCAGG + Intronic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1071574635 10:86716447-86716469 TGCTGGGGATGGAGTGTAGGTGG - Exonic
1071681108 10:87706656-87706678 GGCTGGGGTGGGAGGATAGCTGG + Intronic
1071758079 10:88568309-88568331 GGATGGGGATGGAGGGATGGGGG + Intronic
1072578439 10:96720465-96720487 GGCTCGGGCTGGAGGGGCGCCGG + Exonic
1072626714 10:97116811-97116833 GGCTGGGGATGGAGGGGATGTGG - Intronic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1073001238 10:100287559-100287581 GGCTGGGGATAAGGGGTAGCTGG - Intergenic
1073424064 10:103445780-103445802 ACCTGGGGATTGTGGGCAGCAGG + Exonic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073447383 10:103589733-103589755 GGCTGGGAGTGGAGAGGAGCTGG + Intronic
1073462797 10:103676358-103676380 GGCGGGGGATGGGGTGCAGTGGG + Intronic
1074111916 10:110428837-110428859 GGATGGGGTTGGAGGGAGGCAGG + Intergenic
1074173456 10:110970191-110970213 GGCGGGGGTTGGGGAGCAGCGGG - Intronic
1074524027 10:114249157-114249179 GGGTGGGGAGGGAGAGCATCAGG - Intronic
1074595830 10:114866110-114866132 GGGTGGGGAGGGAGAGCATCAGG - Intronic
1074831795 10:117254671-117254693 AGCTGGGGGTGGAGGGGATCAGG + Intronic
1075031797 10:119029297-119029319 GGCCGGGAAGGGAGGGCCGCTGG - Intergenic
1075084801 10:119407392-119407414 CACTGGGGATGGCCGGCAGCTGG + Intronic
1075120355 10:119660044-119660066 GGCTGGGGCTGCAGGGAGGCTGG + Intronic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075891496 10:125955243-125955265 GGGTGGGGAGGGAGAGCATCAGG - Intronic
1076140387 10:128073678-128073700 GGCTAAGGATAAAGGGCAGCGGG - Intronic
1076194011 10:128502417-128502439 GCCTGGGGCTGAAGGACAGCAGG - Intergenic
1076409426 10:130235220-130235242 GGCTGGGGCTGGAGTTCACCTGG + Intergenic
1076462065 10:130654546-130654568 GGAAGGGGAAGGAGAGCAGCAGG + Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1076583811 10:131532187-131532209 GGCTAGGGATGCAGGTCAGGAGG - Intergenic
1076605495 10:131686871-131686893 GGCTGGAGGTGGAGGGCTGCCGG - Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076647417 10:131962759-131962781 GGTTGGGGGTGGAGCCCAGCAGG - Intergenic
1076700435 10:132270074-132270096 GGCAGGGGACTGAGGGCAGCAGG + Intronic
1076853684 10:133105044-133105066 GGCTGGGGATGCAGGGCCGCTGG - Intronic
1076888254 10:133272318-133272340 GGCTGGGGTGGGAGGGAAGTGGG - Intronic
1076888877 10:133274473-133274495 GGCGGGGGGCGGAGGGCAGAGGG + Intronic
1077009222 11:372797-372819 GGCTGGGGCGGGGGGGCGGCGGG + Intronic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077096350 11:800734-800756 GGCACGGGCCGGAGGGCAGCAGG - Intronic
1077138885 11:1014839-1014861 AGCTGGGAGGGGAGGGCAGCTGG - Intronic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077200849 11:1306801-1306823 GGCCGAGGATGGAGGGAGGCAGG - Intronic
1077239214 11:1501934-1501956 GGCTGGGTGTGGAGGGGTGCAGG - Intergenic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077360122 11:2137139-2137161 GGCTGGAGTGGGATGGCAGCGGG + Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077424401 11:2467581-2467603 GGCTGGGGAAGGCTGGGAGCTGG + Intronic
1077491534 11:2863007-2863029 GGCTGAGGAAGGCGGGCCGCGGG - Intergenic
1077516111 11:3003033-3003055 GGATGGGGATGGTGGGCGGAGGG + Intronic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078031233 11:7753405-7753427 GTCGGGGGATGGGGGGCAGGGGG + Intergenic
1078102968 11:8340662-8340684 GGCTGGTGCTGGAAGGCAGCAGG - Intergenic
1078152688 11:8772788-8772810 GCCTGGGGGTGGCAGGCAGCTGG + Intronic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1078438616 11:11345650-11345672 TGCTGGGGAAGCAGGGCAGCTGG + Intronic
1078597296 11:12698353-12698375 GGTGGAGGATGGAGGGCAGGTGG + Intronic
1079027399 11:16960221-16960243 GGCTGTGGAAGCAGGGGAGCTGG - Intronic
1079097991 11:17523162-17523184 GGCTGGGGATGAAGGTCAAGGGG + Intronic
1079136566 11:17778981-17779003 GGCTGTGGACGGGAGGCAGCCGG + Intronic
1079209979 11:18452780-18452802 GGCTGGAGCTGGAGTGCAGCGGG + Intergenic
1079334523 11:19559607-19559629 GGCTGAGGGTGGATGGCAGGAGG + Intronic
1079688729 11:23396375-23396397 GGTTGGGGATGGTGGGGAGGGGG + Intergenic
1079845974 11:25468164-25468186 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080779923 11:35420017-35420039 GGCGGGGGAGGGAGCGCAGCTGG - Intronic
1081047664 11:38296373-38296395 GGCTCGGTATGGCGGGCTGCAGG + Intergenic
1081381119 11:42416519-42416541 GGATGGGGATTGAGGACTGCGGG - Intergenic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081937841 11:46917583-46917605 GGCTGGGGTAGGGGGGCAGGGGG - Intronic
1081940792 11:46939720-46939742 GGCTGAGGATGGATGGAAACTGG - Intronic
1081993511 11:47349962-47349984 GGGTGGGAAGGGGGGGCAGCAGG - Intronic
1082674153 11:56075101-56075123 GGATGGGGAGGGAGAGCATCAGG - Intergenic
1082799800 11:57406257-57406279 GGATGGGGGTGGAAGGCAGGGGG - Intronic
1083012434 11:59415976-59415998 GGGTGGGGAGGGAGAGCATCAGG + Intergenic
1083294458 11:61707635-61707657 GGCTGGGGCTGAAGGCCAGCTGG + Intronic
1083306375 11:61764122-61764144 AGCTGGGGGTGGGGGTCAGCAGG + Intronic
1083615221 11:64022776-64022798 GGCTGGGGAGCCAGGGGAGCAGG + Intronic
1083628725 11:64085150-64085172 GGATGGGGCTTGAGGGCAGAGGG + Intronic
1083695739 11:64440997-64441019 GGCTGGGGGTGGAGGCCTGGGGG + Intergenic
1083747271 11:64743299-64743321 GGCTGTGGAGGGAGGGAAGCGGG - Intronic
1083851621 11:65371007-65371029 GGCTGGGAGCTGAGGGCAGCAGG + Intergenic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084001000 11:66295437-66295459 GGCTGCGGCTGAAGGGCAGGCGG - Exonic
1084097230 11:66919539-66919561 GGCTGGCGAGGAAGGGCAGGGGG + Intronic
1084167671 11:67383573-67383595 GGCTGGAGGTGGAGGGGAGATGG - Intronic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084360927 11:68668067-68668089 GGGCGGGGAAGGAGGGTAGCAGG - Intergenic
1084385767 11:68841857-68841879 AGCCGGGGAAGGAGGGCCGCGGG + Exonic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085261258 11:75205925-75205947 TGCTGGGGGTGGGGGGAAGCTGG + Exonic
1085398990 11:76224358-76224380 GGTTGGGGGTGGGGGACAGCGGG + Intergenic
1085508652 11:77074310-77074332 GGCTGGGGATGCCAGGCAGAGGG - Intronic
1085516655 11:77115774-77115796 GCCTGGGGCTGGAGGCCATCAGG + Intronic
1085592371 11:77775697-77775719 GGCTGAGGAAGGAGGATAGCTGG + Intronic
1085719838 11:78903221-78903243 GGCTGAGGAGGGTGGGCACCCGG - Intronic
1085830992 11:79900848-79900870 GGCTGGGGAGGGTGGGTGGCTGG + Intergenic
1085848601 11:80094883-80094905 GGTTGGGGAGGGAGAGCATCAGG - Intergenic
1087138251 11:94741084-94741106 GGCTGGGGTTGGAGGGCGGAGGG + Intronic
1087672674 11:101127298-101127320 GGCCGGAGAGGGTGGGCAGCGGG - Intronic
1087846627 11:102980818-102980840 GGTTGGGGATGGGGGGCAAGGGG + Intergenic
1087983703 11:104650638-104650660 AGCTGGGGTTTGAGGGAAGCTGG - Intergenic
1088080548 11:105906698-105906720 GGCAGGAGATGGATGGCAGCCGG + Intronic
1088512379 11:110590995-110591017 GGCTGGGGGTGGTGGTGAGCAGG + Intronic
1088605221 11:111523621-111523643 GGCTGGGGAGGTATGGCAGAAGG - Intronic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1088680002 11:112231845-112231867 GGCAGGGGTTGGGGGGCAGGCGG + Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089110682 11:116053441-116053463 GGTTGGGGGTGCAGGGCAGTGGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089170244 11:116506609-116506631 GGGTGGGGGTGGATGGCATCTGG + Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089201330 11:116726286-116726308 GGCGGGGGAGGGTGGGCAGCGGG - Intergenic
1089215245 11:116830902-116830924 GGATGGGGAGGGAGGCCAGCGGG - Intronic
1089289876 11:117431133-117431155 GTCTGGCCATGGAGGGCACCAGG + Intronic
1089306922 11:117532322-117532344 GGCTGGGAAGGGAGGACACCAGG - Intronic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1089947170 11:122487946-122487968 AGCTGGGAATGGCGGGCATCTGG + Intergenic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090423739 11:126592957-126592979 GGCTGGGGTGGGAGGGCTGAGGG + Intronic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090949259 11:131458427-131458449 GGCTGGGGAAGGAGCTCCGCAGG - Intronic
1091139748 11:133224621-133224643 GCCTGGGGAAGGAAGGCATCTGG - Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091586767 12:1821262-1821284 GGCTTGGGGTGGAGGGTGGCAGG + Intronic
1091591180 12:1843746-1843768 GGCTGGGGCTGGCTGGCAGTTGG + Intronic
1091743595 12:2976911-2976933 GGCCTGGGATGCAGGCCAGCTGG - Intronic
1091764949 12:3113724-3113746 GGCAGGGCATGCATGGCAGCTGG - Intronic
1091900859 12:4142886-4142908 GGCGGGGGAAGGTGAGCAGCAGG - Intergenic
1091934285 12:4423128-4423150 GGCTGGGGATGCTGTGCAGTAGG - Intergenic
1091936720 12:4440751-4440773 AGATGGGGCTGGAGAGCAGCGGG - Intronic
1092025015 12:5232905-5232927 GGCAGGGGCTGCAGGGCAGGGGG - Intergenic
1092193222 12:6534718-6534740 GGCTGGGCATGGAGGCCTGGTGG + Intronic
1092229019 12:6766669-6766691 GGCCGGGGCTGGCGGGGAGCCGG - Exonic
1092906700 12:13106946-13106968 GGTTAGGGAGAGAGGGCAGCAGG - Intronic
1094067094 12:26372889-26372911 GGCTGGGGTCGGGGGGCAGTGGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095632569 12:44395733-44395755 GGCTGGTGATGAAGGAGAGCAGG + Intergenic
1096048628 12:48586614-48586636 GGGAGGGGCTGGAGGGCAGGAGG - Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096460493 12:51819309-51819331 GGCAGGGGGTGGGGAGCAGCAGG + Intergenic
1096500299 12:52060580-52060602 AGCTGTGGATGGGGGGAAGCAGG + Intergenic
1096513557 12:52144748-52144770 GCCTGGGCCTGGATGGCAGCTGG + Intergenic
1096518690 12:52172164-52172186 GGCTGGTGAGGAAGGGCTGCAGG - Intronic
1096613613 12:52819001-52819023 GCCTGGGGTAGGAGGCCAGCAGG - Intergenic
1096648248 12:53049669-53049691 CGCTGGGGAGGGAGTGGAGCTGG - Intronic
1096686565 12:53292040-53292062 GGAAGCGGAAGGAGGGCAGCCGG - Exonic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097011317 12:55955409-55955431 GGGAGTGGATAGAGGGCAGCTGG - Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097168571 12:57099216-57099238 GGCAGGGAGAGGAGGGCAGCGGG + Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1097767549 12:63543128-63543150 GGCTGGGGCTGGAAGACATCCGG - Intergenic
1097783915 12:63738176-63738198 GGCTGGGGCTGGAAGACATCCGG - Intergenic
1097787824 12:63780171-63780193 GGCTGGGGCTGCTGGGCGGCTGG + Intronic
1097894252 12:64808733-64808755 GGCTGGGGAGGGAGGGAATGGGG - Intronic
1098003202 12:65967779-65967801 GGCTGAGGATGGAGGAGAGAGGG - Intergenic
1098255518 12:68611394-68611416 GGCGGGGAAAGGAGGGCGGCGGG - Intronic
1099129683 12:78811497-78811519 GGCGGGGGAGGAAGGGCATCAGG + Intergenic
1099182735 12:79486356-79486378 GGGTGGGGATGAAGAGCGGCAGG - Intergenic
1100245197 12:92750728-92750750 GGCTGGGAGTGGAGGGGAGCAGG - Intronic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1100549966 12:95638251-95638273 ACCTGGGGAAGGAGAGCAGCAGG + Intergenic
1101439684 12:104694255-104694277 GGCTGGGGCTGGACTGCGGCTGG - Intronic
1101939682 12:109090634-109090656 GGCTGAGGCAGGAGGGCTGCTGG - Intronic
1102197834 12:111036888-111036910 GGGTGGGGGTGGGGGGCTGCGGG - Intronic
1102227285 12:111237707-111237729 GGCAGGGGCTGGAGAGCAGATGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102425071 12:112837830-112837852 GCCTGGGGATGAAGGACAGAGGG - Intronic
1102454966 12:113065551-113065573 GGCGGGGGATGGGAGGAAGCTGG - Intronic
1102483760 12:113242351-113242373 GGCTGGGGGTGTAGGCCAGGCGG - Intronic
1102547964 12:113670266-113670288 GGCTGGGGAAGGACGGAGGCTGG + Intergenic
1102561043 12:113762526-113762548 GGGTGGGGAGGGAGGGGGGCCGG - Intergenic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102703141 12:114857567-114857589 GCCTGAGGATGGAGGGCAGGAGG - Intergenic
1102976493 12:117210464-117210486 TGCTGGGTATGTGGGGCAGCGGG + Exonic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103244051 12:119440072-119440094 GGCCGGGGATGGAGAGCATTAGG + Intronic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1103479054 12:121239206-121239228 GGCTGGGGAAAGACGGCACCGGG - Exonic
1103713499 12:122929816-122929838 GCCTGGGCTCGGAGGGCAGCTGG + Exonic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103764451 12:123271059-123271081 GGGCGCGGATGGAGGGCTGCGGG - Intronic
1103905944 12:124327197-124327219 GGCCGGGGCTGGGGGGCAGAGGG + Intronic
1103953529 12:124564905-124564927 GCCTGGGGGTGGGGGGCAGGGGG - Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1103982610 12:124746297-124746319 GGCTGGGGAACGAGGCCAGGAGG - Intergenic
1104035827 12:125096548-125096570 GGCTGGGGCTGGAGGGAGCCAGG + Intronic
1104115358 12:125744519-125744541 GGCTGAACCTGGAGGGCAGCGGG + Intergenic
1104720891 12:131044649-131044671 GCCGTGGGAGGGAGGGCAGCGGG - Intronic
1104822316 12:131684191-131684213 GGCTGAGGATGGGCTGCAGCCGG + Intergenic
1104855003 12:131897390-131897412 GCCTGAGAACGGAGGGCAGCGGG - Intronic
1104953730 12:132453890-132453912 GGCTGGGGCTGGAGGGCTGCTGG + Intergenic
1104963688 12:132499696-132499718 GGCTGTGGCTGGGGGGCTGCAGG + Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105073643 12:133254828-133254850 GGCAGGGGTTGGTGGGGAGCTGG - Intergenic
1105585901 13:21742525-21742547 GGCTGGAGGTGGAGGGCACATGG - Intergenic
1105796347 13:23857467-23857489 GGCTGAGGCAGGAGGGCTGCTGG + Intronic
1105997466 13:25686154-25686176 GGCTTGGGAGGGAGGGAACCAGG + Intronic
1106010171 13:25813065-25813087 GGTTGGGGAGGGAGAGCATCAGG + Intronic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106193741 13:27476115-27476137 GGCCTGGGATGGAGGGAGGCTGG - Intergenic
1106284163 13:28304689-28304711 GGCTGGGGCTGGAGGGCGTGAGG - Intronic
1106471617 13:30060968-30060990 GGCTGGGGACAGAGGACAGAGGG + Intergenic
1106634354 13:31511243-31511265 GGCTTGTGCTGGAAGGCAGCAGG + Intergenic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1106726312 13:32490050-32490072 GGAGGGGGATGGAGGGGAACTGG - Intronic
1107540916 13:41388335-41388357 GGCTGGGAATGCAGCCCAGCAGG + Intergenic
1108138656 13:47393914-47393936 GGCTGGGGATGGAGTGAAAGGGG + Intergenic
1108732173 13:53246521-53246543 AGCTGGGGAAGGAGAGAAGCTGG + Intergenic
1109393048 13:61718556-61718578 GGCAGGGGGTGGAGAGCATCAGG - Intergenic
1109599944 13:64612622-64612644 GGCGGGGGATGGCTGGCGGCTGG - Intergenic
1110046558 13:70840550-70840572 GTCTGGGAATGCAGGCCAGCAGG - Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1110337200 13:74346481-74346503 GGCTGGGGAGGGAGGTCCCCTGG - Intergenic
1111194571 13:84857265-84857287 GGCTGGGGAGGGAGAGCATTAGG - Intergenic
1111220936 13:85205166-85205188 CGCTGGGCATGGCGGGCTGCGGG - Intergenic
1112080040 13:95959423-95959445 GGCTATGGTTGGTGGGCAGCAGG - Intronic
1112143505 13:96672468-96672490 GGTTGGAGATGGAGGGCTGCTGG - Intronic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1113066081 13:106375317-106375339 GGCTGGGGCTGGAGGGGACTTGG - Intergenic
1113243720 13:108369974-108369996 TGCTGGTGATGCAGAGCAGCTGG - Intergenic
1113414371 13:110116886-110116908 GGCTGGGCAGAAAGGGCAGCAGG + Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113626984 13:111854791-111854813 GACTGGGGGTGGAGGGCATTTGG + Intergenic
1113814159 13:113159917-113159939 GGCTGGGGCTGGCGGCCGGCCGG + Intronic
1113947186 13:114050976-114050998 CGCTGGGGAAAGGGGGCAGCCGG + Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1114664271 14:24368944-24368966 GCCGGGGGAAGGGGGGCAGCGGG - Intronic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1117716559 14:58587480-58587502 GACTGAGGCTGCAGGGCAGCAGG + Intergenic
1117995574 14:61474552-61474574 GGCAGGGGATGGGGGGCTGGGGG + Intronic
1118146912 14:63147688-63147710 GGTTGGGGAGGGAGAGCATCAGG - Intergenic
1118362636 14:65069240-65069262 GGCTGGGGGTGGGGGGCTGTTGG - Intronic
1118443133 14:65829681-65829703 GAATGGGGAGGGAAGGCAGCAGG + Intergenic
1118444830 14:65841360-65841382 GGCTGGGGAATGAGGGTAGCAGG + Intergenic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118871392 14:69745780-69745802 GGCTGGGGGTGGGGGGGTGCGGG + Intronic
1118932447 14:70255103-70255125 GGCTGGGGGTGGCGGGGAGGGGG - Intergenic
1119439528 14:74619020-74619042 GGCTGGGGGTGGAGGGGTGGAGG + Intergenic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1119731901 14:76956499-76956521 GGCTGGCGCTGGGCGGCAGCCGG - Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120092783 14:80353014-80353036 GGCTGGGGGAGGAGAGCATCAGG - Intronic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121792630 14:96710626-96710648 GGCAGACGGTGGAGGGCAGCCGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121991972 14:98567074-98567096 GGCTAGAGATGGAGGGGAGAGGG - Intergenic
1122058304 14:99119848-99119870 AGCTGGGTTTGGAGAGCAGCAGG + Intergenic
1122227552 14:100288553-100288575 GGCAGGGCCTGGAGGACAGCAGG - Intergenic
1122275210 14:100587438-100587460 GGCCGGGGCTGGCGGGGAGCCGG - Intergenic
1122282691 14:100633486-100633508 GGATGGGGTGGGAGGGCACCAGG - Intergenic
1122316139 14:100827074-100827096 AGCTGGGGATGGGGTGCCGCGGG + Intergenic
1122329530 14:100903318-100903340 GGCTGGGGATGAAGTGATGCCGG + Intergenic
1122374195 14:101247640-101247662 GGCATGGGCTGGAAGGCAGCAGG - Intergenic
1122424763 14:101599420-101599442 GGCTGGGGAAGAAGGTCATCTGG + Intergenic
1122549139 14:102540395-102540417 GGCCGGGGGTGGGGAGCAGCTGG + Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122748740 14:103917542-103917564 GGATGGGATTCGAGGGCAGCTGG + Intronic
1122800887 14:104228978-104229000 GGCTGTGGAGGGGGAGCAGCGGG + Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123005976 14:105324050-105324072 TGCAGGAGATGGAGGGCAGGGGG + Intronic
1123061574 14:105597030-105597052 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123061589 14:105597071-105597093 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123061603 14:105597112-105597134 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123061619 14:105597153-105597175 GGCTGTGGATGGGTGGCAGGAGG + Intergenic
1123085994 14:105717860-105717882 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086008 14:105717901-105717923 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086022 14:105717942-105717964 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086051 14:105718023-105718045 GGCTGTGGATAGATGGCAGGAGG + Intergenic
1123086065 14:105718064-105718086 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086079 14:105718105-105718127 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086093 14:105718146-105718168 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086138 14:105718268-105718290 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086153 14:105718309-105718331 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086167 14:105718350-105718372 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086182 14:105718391-105718413 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086196 14:105718432-105718454 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086211 14:105718473-105718495 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086225 14:105718514-105718536 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086240 14:105718555-105718577 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086254 14:105718596-105718618 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086269 14:105718637-105718659 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086283 14:105718678-105718700 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086298 14:105718719-105718741 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086312 14:105718760-105718782 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086327 14:105718801-105718823 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086341 14:105718842-105718864 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086357 14:105718883-105718905 GGCTGTGGATGGGTGGCAGGAGG + Intergenic
1123706636 15:22955521-22955543 GGCTGGGGAGGCAGGGGAGCAGG + Intronic
1124495689 15:30185584-30185606 GGCTGGGACTTGAGGGCAGCTGG - Intergenic
1124496474 15:30190773-30190795 GGTTGGGGATGGGGTGCAGCTGG - Intergenic
1124747101 15:32347875-32347897 GGTTGGGGATGGGGTGCAGCTGG + Intergenic
1124747884 15:32353062-32353084 GGCTGGGACTTGAGGGCAGCTGG + Intergenic
1124957052 15:34366732-34366754 AGGTGGGGATGGAGGGCTGCAGG - Intronic
1125541165 15:40470967-40470989 GGCCGGGGGTGGAGAGCGGCCGG + Intergenic
1125756952 15:42070857-42070879 GGCTGGGCATGGAGTCAAGCTGG + Exonic
1125760837 15:42094470-42094492 GGCTGGGCCTGGAGTGAAGCTGG - Exonic
1125896990 15:43310731-43310753 GGCTGGGGAGGGAGGCAAGGTGG + Intergenic
1126692060 15:51295372-51295394 GCCTAGGAATGGAGGGGAGCGGG - Intronic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1127681381 15:61301934-61301956 GGCTGAGGATGAGGGGCAGGCGG + Intergenic
1127904511 15:63366322-63366344 GGCAGGGGATGGAGGGCCTCTGG - Intronic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128167133 15:65475533-65475555 GCCTGGGGATGGATTGCACCGGG - Intronic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1128347039 15:66860870-66860892 GCCTGGGGAAGGAGGGCAAAGGG + Intergenic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128661572 15:69505040-69505062 GGCAGGTCGTGGAGGGCAGCTGG + Intergenic
1129061214 15:72861738-72861760 GACAGGGGCTGCAGGGCAGCAGG - Intergenic
1129161078 15:73748281-73748303 GGCTGGGGAAGGGGAGCAGCAGG + Intronic
1129326731 15:74803738-74803760 GGTTGAGGATGCAGGGCAGAGGG + Intergenic
1129327591 15:74809369-74809391 GGGTAGGGAGGGAGAGCAGCTGG + Intergenic
1129455909 15:75676132-75676154 GGCTGGGGCTGGAGGTGGGCAGG - Exonic
1129670546 15:77605568-77605590 GGGTTGGGCTGGAGGTCAGCTGG + Intergenic
1129843892 15:78759495-78759517 GGGTGCGGATGGTGGGCAGCTGG + Exonic
1129874188 15:78961804-78961826 GGCTGGGGAGGGACGGAAGCAGG + Exonic
1130597017 15:85255658-85255680 GGGTGCGGACGGTGGGCAGCTGG + Intergenic
1130908376 15:88255271-88255293 GGCTGGAGAGGGCGGGCTGCAGG + Intronic
1130971966 15:88740684-88740706 GGCTGGGGTTGGAGGGTGGAGGG - Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1131340859 15:91599267-91599289 GGCAGGGGGTGGAGGGGAGCAGG + Intergenic
1131732438 15:95296365-95296387 GGCTGGGGTGGGAGCCCAGCGGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132155370 15:99492240-99492262 GGTTGGGGCAGGAGGGGAGCTGG + Intergenic
1132195157 15:99909312-99909334 GGCTTGGGTTGCAGGGCTGCAGG + Intergenic
1132481710 16:169548-169570 GGCTGGGGAGGGAGAACTGCAGG + Intergenic
1132482576 16:173805-173827 GGCTGGGGAGGGAGAACTGCAGG + Intergenic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132598622 16:764243-764265 GGCCGGGGAGAGATGGCAGCAGG - Intronic
1132730421 16:1358277-1358299 GGCTGGGGGAGCGGGGCAGCTGG - Intronic
1132859834 16:2064715-2064737 GGCTGGGCAGGGAGGACGGCAGG - Intronic
1133038878 16:3049480-3049502 TACTGGGGATGGAGCCCAGCTGG + Intronic
1133303210 16:4795541-4795563 GGCTGGGCAAGGAGAGAAGCTGG + Intronic
1133440087 16:5814201-5814223 GGCTGGGAAAGGAGGGCATACGG - Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1133784453 16:8963640-8963662 GGCCGGGGGCGGAGGGCGGCCGG + Intronic
1133867488 16:9657972-9657994 GACTGGGGATGAAGGCAAGCAGG - Intergenic
1134070601 16:11257233-11257255 GGCTTGGGATGGTGGGCGGTCGG + Intronic
1134071657 16:11263897-11263919 GGCTTGGGGTGGGTGGCAGCAGG - Intronic
1134440721 16:14298377-14298399 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
1134607038 16:15579381-15579403 GGCTGGGAATGGGGAGCGGCTGG + Intronic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1134925285 16:18153743-18153765 GGCTGGGGAGGGAGAGCATTAGG + Intergenic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1135015966 16:18925783-18925805 GGCTGGGGGAGGAAGGCCGCGGG - Intronic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135321585 16:21501610-21501632 GGCTGGGGGAGGAAGGCCGCGGG - Intergenic
1135323699 16:21512943-21512965 GGTTGGGGATGGAGGGGTGCAGG + Intergenic
1135341181 16:21649442-21649464 GGCTGGAGATGGAGCTGAGCTGG - Intronic
1135437365 16:22437609-22437631 GGCTGGGGGAGGAAGGCCGCGGG + Intergenic
1135745762 16:25015152-25015174 GGCTGGGGGCGGAGGGCGGAGGG - Intronic
1135953656 16:26938031-26938053 GGCTGGGGAGGGAGAGCATTAGG - Intergenic
1135956469 16:26960334-26960356 GGCTGGGGATGAAGAGCTGCAGG + Intergenic
1136043601 16:27599193-27599215 AGCCTGGGATGGAGGCCAGCAGG + Intronic
1136173394 16:28502051-28502073 GGCTGGGGACCCAGGGCCGCTGG - Exonic
1136234703 16:28906225-28906247 GGCTGGGGCAGGAGGGCAGGAGG + Intronic
1136272185 16:29154902-29154924 GGCTGGGGATGGTGGGTGGGGGG + Intergenic
1136335182 16:29606208-29606230 GGTTGGGGATGGAGGGGTGCAGG + Intergenic
1136349606 16:29698270-29698292 GGTGGGGGGAGGAGGGCAGCAGG - Exonic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136520870 16:30795000-30795022 GGGTGGGGGGTGAGGGCAGCAGG - Intergenic
1136987731 16:35126524-35126546 GGTTGGAGATGGAGGACAGATGG + Intergenic
1137009870 16:35311481-35311503 GGCTGGGGAGGCAGAGCAGGGGG - Intergenic
1137255936 16:46775547-46775569 GGCTGGGGAAGGAGGGAATGAGG + Intronic
1137279680 16:46965115-46965137 GGCTGAGGAGGGAGGACTGCTGG + Intronic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138090454 16:54169600-54169622 GGCTGGGGCAGGAGGGGAGAGGG - Intergenic
1138097026 16:54219811-54219833 GGTGGGGGATGGAGGGCAAGAGG + Intergenic
1138205082 16:55118774-55118796 GGCAGGGGGTGGAGGGGACCAGG - Intergenic
1138529013 16:57625004-57625026 GGCTGGGAGTAGAGGCCAGCTGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138548753 16:57735787-57735809 GGCAGGGGATGGAGGCAAGTGGG + Exonic
1138607324 16:58097440-58097462 GGCTGGAGATGGGGCCCAGCTGG + Intergenic
1139599162 16:67976285-67976307 GACTAGGGCTGGTGGGCAGCGGG - Intronic
1140115323 16:72036656-72036678 GGGTGGGGCAGGAGGGCACCGGG + Intergenic
1140474107 16:75230022-75230044 AGCTGGGGCAGGAGGGAAGCAGG + Exonic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141642415 16:85348958-85348980 GGCTGGGGTTGGGGAGCGGCAGG - Intergenic
1141693285 16:85608235-85608257 GGCTGGGGGCTGAGGGCAGATGG + Intergenic
1141776167 16:86123840-86123862 GGCTGGGATTGGGGGGCAGGTGG + Intergenic
1142035906 16:87862042-87862064 GGTTGGGGGTGGAGGGGTGCAGG + Intronic
1142115713 16:88355076-88355098 GCCTGGGGAGGGTGGGCAGGGGG + Intergenic
1142122358 16:88393228-88393250 GGCCGGGCACGGAGGGCCGCTGG - Intergenic
1142172261 16:88628897-88628919 GCCTGGGGATGCGGAGCAGCTGG + Intronic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142214925 16:88825514-88825536 GGCTGGGGTTTCTGGGCAGCCGG + Intronic
1142406340 16:89892294-89892316 TGCTGGGGATGGAGGGTTGGGGG + Intronic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1142487869 17:258554-258576 GCCAGGGGAGGCAGGGCAGCTGG - Intronic
1142648548 17:1330925-1330947 GGCAGGGGAGGGAGAGCATCCGG - Intergenic
1142718748 17:1762661-1762683 GGGCTGGGATGGAGGACAGCTGG + Intronic
1142733236 17:1877329-1877351 TGCTGGGGAGTGAGGGCAGTGGG + Intronic
1142764958 17:2059525-2059547 GGCTCGGGATGGGGGGCCGCCGG - Exonic
1142865001 17:2785334-2785356 GGTGGGGGCAGGAGGGCAGCAGG - Intronic
1143103244 17:4515352-4515374 GGCTGGCAGTGGAGAGCAGCCGG + Intronic
1143119331 17:4597339-4597361 GGCTGGGGCTGGTAGCCAGCAGG - Intronic
1143306906 17:5954539-5954561 GGCTGGGGGTGGATTGCAGAAGG + Intronic
1143471117 17:7176928-7176950 GGCTGGGGCTGGGGGGCTGTCGG - Intronic
1143484519 17:7246203-7246225 GGCTTGGGAGGGAGGCCACCAGG - Intronic
1143517156 17:7425633-7425655 GGCCGGGGGTGGGGGGCAGAGGG + Exonic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143622073 17:8086448-8086470 AGCTGGGGATGGAGAGAAGGAGG - Intronic
1143779362 17:9221300-9221322 TGCTGGGGCTGGGGTGCAGCTGG + Intronic
1143904327 17:10197668-10197690 GGCTCGGGCTGGTGGCCAGCAGG + Intronic
1144043396 17:11432885-11432907 GCCTGGGGCTGGAGAGCAGGAGG + Intronic
1144051411 17:11500181-11500203 GACTGAGGATGGAGAGCAGCAGG - Intronic
1144169717 17:12648171-12648193 GGCTGGGGATCGAGGCCCGTCGG - Intergenic
1144470972 17:15540823-15540845 TGCTGGGGATGCAGTGCAGGGGG + Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144727931 17:17511150-17511172 AGCTGGAGGTGGGGGGCAGCTGG - Intronic
1144864710 17:18327770-18327792 GGCTGGTGCAGGAGTGCAGCTGG + Intergenic
1144872068 17:18377828-18377850 GGCTGGTGAAGGAGGGCAGGAGG - Exonic
1144925498 17:18803854-18803876 TGCTGGGGATGCAGTGCAGGGGG - Intronic
1145077483 17:19867766-19867788 AGCTGGGGATGGAGAGTACCGGG - Exonic
1145099729 17:20064541-20064563 TGCTGGGGTGGGAGGACAGCAGG + Intronic
1145214439 17:21041971-21041993 AGCTGGAGGTGGAGGGCGGCAGG - Intronic
1145254693 17:21316212-21316234 GACTGGGGCTGGAGGACAGGAGG - Intergenic
1145321904 17:21771753-21771775 GACTGGGGCTGGAGGACAGGAGG + Intergenic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145761973 17:27430322-27430344 GTCTGGGGCTGCAGGGCAGCTGG - Intergenic
1146272731 17:31495017-31495039 GGCTGGAGGTGAAGGGCAGGTGG - Intronic
1146525435 17:33563476-33563498 GGCTGGGGATGGGGAGCAGGAGG - Intronic
1146716272 17:35089283-35089305 GGCTGGGGATGGGTGGGAGGGGG - Exonic
1146719376 17:35113073-35113095 GGCAGGGCATGGAGGGTAGGTGG - Intronic
1146750351 17:35373370-35373392 GGCTGGGGGTGGAGTGGAGTGGG - Intronic
1146954518 17:36929558-36929580 GGCTTGGGTTGGGGGGCGGCTGG + Intergenic
1147133020 17:38419905-38419927 GACTGGGAAAGGAGGGGAGCCGG - Intergenic
1147169058 17:38607483-38607505 GGATGGGCATGGGAGGCAGCAGG + Intergenic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148026697 17:44593688-44593710 GGCTGGGATGGGAGGGCAGGGGG - Intergenic
1148082986 17:44977696-44977718 GGGCGGGGATGGAGGGCTGCTGG + Intergenic
1148159001 17:45439437-45439459 GGGTGGGGCTGGAAGGCGGCTGG + Intronic
1148331338 17:46815598-46815620 GGCTGGGGCTGTAGGGTAGATGG - Intronic
1148445614 17:47735147-47735169 GGCTTGGGGTGGAGGGGAGAGGG + Intronic
1148491021 17:48024095-48024117 CGCTGGGGGTGGAGGGCCGCCGG - Intergenic
1148534669 17:48429704-48429726 GGCTGGGGAAGGAGGGGGACGGG + Intronic
1148581902 17:48750015-48750037 GGCTGGGTCTGGAGGGCTGGCGG + Intergenic
1148690631 17:49524969-49524991 GGCTGGGAGTGGAGGGGAGGGGG - Intergenic
1148863223 17:50615292-50615314 GACTGGGGGTGGAGGGGTGCGGG + Intronic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1149388811 17:56169610-56169632 GGAAAGGGATGGAGGGTAGCAGG + Intronic
1149521147 17:57319080-57319102 AGCTGGTGATGGGGAGCAGCCGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150129175 17:62657667-62657689 GGATGGGGGTGGGGGGCATCAGG + Intronic
1150149661 17:62798849-62798871 GGCAGGGGCTGGAGAGCAGAGGG + Intronic
1150286960 17:63960143-63960165 GGCTGTGGACCCAGGGCAGCTGG - Intronic
1150639928 17:66942651-66942673 GGGAGGAGGTGGAGGGCAGCAGG - Intergenic
1150649438 17:67000372-67000394 GCCTGTGGAAGGAGGGAAGCTGG + Intronic
1150684037 17:67305833-67305855 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
1150935348 17:69629064-69629086 GGCTGGGGCTGAAGGGAAGGGGG + Intergenic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151404551 17:73878052-73878074 GGCCGGGGGTGAAGGGCAGAGGG + Intergenic
1151549540 17:74814216-74814238 TGCTGGTGATGGCGGGAAGCCGG + Intronic
1151560322 17:74866368-74866390 GGCTCGGGGTGGAAGGCAGCAGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151670879 17:75571112-75571134 GCCTGGGGTTGGGGGGCAGGGGG + Intronic
1151766718 17:76136833-76136855 GGCTGTGGATGGGGCGGAGCAGG - Exonic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1151969237 17:77449430-77449452 GGCTGGGCTTGGAGGAGAGCAGG + Intronic
1151969943 17:77452420-77452442 GGCCAGGGATGAAGTGCAGCAGG - Intronic
1151974268 17:77475602-77475624 GCCTGCAGAGGGAGGGCAGCTGG + Intronic
1152009228 17:77700679-77700701 GGCTGGGGAGGCAGGGAGGCCGG + Intergenic
1152104242 17:78319405-78319427 GGCTTGGGCAGGAGGGCACCTGG + Intergenic
1152558445 17:81066255-81066277 ACCTGGGGATGCCGGGCAGCTGG - Intronic
1152565068 17:81096684-81096706 GGCTGAGGCTGGAGCACAGCGGG + Intronic
1152570243 17:81118509-81118531 GGCCAGGGATGGAGGCCAGGTGG - Intronic
1152585642 17:81188346-81188368 GGCAGGGGGTGCAGGGCAGTGGG - Intergenic
1152593108 17:81223198-81223220 GGCGGGGGACCGAGGGCGGCGGG + Intergenic
1152649950 17:81488188-81488210 GGCTGGGGATCGCGGACCGCGGG - Intergenic
1152693267 17:81731333-81731355 GGCTGGGGAGGGAGGGATGCGGG + Intergenic
1152706670 17:81847197-81847219 GGCTGGGGATGGGGAGGAGTGGG - Intronic
1152717668 17:81907661-81907683 GGCTGGGGATGGGGAGCAGTGGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152755101 17:82083929-82083951 GGCGGGGCCAGGAGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152820932 17:82437297-82437319 GGCTGCAGGTGGCGGGCAGCGGG + Exonic
1152896196 17:82912780-82912802 GGCTGGAGATAGATGGCTGCAGG - Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153596682 18:6732538-6732560 AGCTAGGGATGGCAGGCAGCAGG - Intronic
1153736769 18:8078772-8078794 GGCAGAGGGTGAAGGGCAGCAGG + Intronic
1153951556 18:10061832-10061854 GGCTGGGGAGGGACCTCAGCAGG - Intergenic
1154086797 18:11313545-11313567 GGCTCAGGCTGGAGTGCAGCAGG + Intergenic
1154111242 18:11570265-11570287 GGCTGAGGGTGGAGGGGTGCAGG - Intergenic
1154126619 18:11697858-11697880 GGCAGTGGCTGGAGAGCAGCTGG + Intronic
1154304223 18:13218521-13218543 GGCAGGGACTGGAGGTCAGCGGG + Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154963192 18:21330131-21330153 GGCTGGGCAGGCAGGTCAGCTGG + Intronic
1154977249 18:21471512-21471534 GTCTGGGGATAGAGGGGAACAGG - Intronic
1155305335 18:24472805-24472827 GGGTGGGGAAGGAGAACAGCAGG + Intronic
1155329965 18:24705106-24705128 GGCAGATGATGGAGGGGAGCAGG + Intergenic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155923594 18:31630087-31630109 GGAGGGGGAAGGAGGGGAGCGGG + Intronic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156631791 18:38978995-38979017 GGCTGAAGATGGATGGCACCTGG + Intergenic
1156913493 18:42438812-42438834 GGCTGGGGAGGGAGAGCATCAGG - Intergenic
1157305462 18:46513902-46513924 GCCTGGGGCTGGTGAGCAGCAGG + Intronic
1157315131 18:46580476-46580498 GGCTGGGCATGCAGGGATGCAGG - Intronic
1157517557 18:48321574-48321596 GGATGGGGATGGGGAGGAGCTGG - Intronic
1157520791 18:48343872-48343894 GGCGGGGGAGGGAGTGCAGAGGG - Intronic
1157579034 18:48762867-48762889 GGGTGGGGATGGAGCCCTGCCGG - Intronic
1157594697 18:48857491-48857513 GGCTGGGGCTGCAGGTCGGCGGG + Intronic
1157738210 18:50069560-50069582 GGCTGAGGAGTGAGGGCAACGGG - Intronic
1158210568 18:55044847-55044869 GGCCGGGGAGGGAGAGCATCAGG + Intergenic
1158319646 18:56248881-56248903 GGGTGGGGGTGGAGGGGGGCAGG + Intergenic
1158660592 18:59384044-59384066 GCCTGAGGATGGAGGGCGACAGG - Intergenic
1158966299 18:62625057-62625079 GGGTGGAGATGGACCGCAGCTGG - Intergenic
1160123941 18:76153671-76153693 GGCTGGGTAGAGAAGGCAGCAGG + Intergenic
1160142109 18:76334529-76334551 GGCAGGGGATGGGGGATAGCCGG + Intergenic
1160378314 18:78430156-78430178 GGCTGGGCTGGGAGGGCTGCTGG - Intergenic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160560229 18:79751241-79751263 GGCCGGGGAGGGAGGGAGGCTGG + Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160696255 19:486038-486060 GGATGAGGATGGAGGGGAGCTGG - Intergenic
1160698499 19:495716-495738 CGCTGGGGATGGAGGCCCCCTGG - Intronic
1160703508 19:518743-518765 GGCCGGGGATGGGGGGTAGGAGG + Intronic
1160740051 19:681427-681449 GGCCGGGGCTGGAGGGCACAGGG - Exonic
1160784777 19:894785-894807 GGTTGGGGAGGGAGGGGCGCTGG + Intergenic
1160836450 19:1126929-1126951 AGCAGGGGTTGTAGGGCAGCAGG - Intronic
1160871171 19:1278625-1278647 GGCCGGGGAGGGAGGCCAGTGGG + Intronic
1160894888 19:1397699-1397721 GGCTGGGGTTCCAGGACAGCCGG - Intronic
1160896641 19:1405776-1405798 GGCTGAGGAGGGAGGATAGCTGG + Intergenic
1160917317 19:1503446-1503468 GACAGGGGAGGGAGGGCAGTGGG + Intergenic
1160985641 19:1837354-1837376 GGCTGTGCATGGAGGGCCCCGGG - Intronic
1161002263 19:1916691-1916713 GGCTGAGGCAGGAGGGCTGCTGG - Intronic
1161021426 19:2013399-2013421 GGCTGGGGAGGGAGGGACCCCGG + Intronic
1161074580 19:2279075-2279097 GGCAGGCCTTGGAGGGCAGCAGG + Exonic
1161101321 19:2423499-2423521 GGGTGGTGATAGAGGGCGGCGGG + Intronic
1161141316 19:2649856-2649878 GGCTGGGGATCGGGGGCTGATGG - Intronic
1161265463 19:3361481-3361503 GGGTGGGGGTGGAGAGCGGCGGG - Intronic
1161323600 19:3652491-3652513 AGCTGGGGATGGTCAGCAGCGGG + Intronic
1161323771 19:3653251-3653273 GGCCGGGGAGGGAGGGTGGCAGG - Intronic
1161395869 19:4044557-4044579 GGCTGGGGTTGGGGGGCTTCAGG - Exonic
1161405521 19:4089335-4089357 GGCTAGGTGTGGTGGGCAGCTGG - Intergenic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161426982 19:4209017-4209039 GGCTGGGGTGGGAGGGCAGTGGG + Intronic
1161731244 19:5962029-5962051 TGCTCGGGAGGGAGTGCAGCAGG - Intronic
1161766283 19:6210783-6210805 GGGTGGGGTGGGAGAGCAGCTGG + Intergenic
1161811839 19:6475819-6475841 TGCTGGTGAGCGAGGGCAGCTGG - Exonic
1161849546 19:6731406-6731428 GGCTGGGGTGGGCGTGCAGCAGG + Intronic
1161978166 19:7617503-7617525 GGGAGGGGGTGGGGGGCAGCAGG - Intronic
1161984487 19:7646221-7646243 GGCAGGGCAGGGAGGGCAGCAGG - Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162114138 19:8418209-8418231 GACTTGGGAGGGAGAGCAGCAGG + Intronic
1162159361 19:8699952-8699974 GGTTGGGGATGGAGAGAGGCAGG + Intergenic
1162386196 19:10361887-10361909 GCCTGCGAGTGGAGGGCAGCGGG - Exonic
1162402285 19:10453466-10453488 GGGCGTGGATGGCGGGCAGCTGG + Intronic
1162468084 19:10854765-10854787 GGCTGGGGGTGGATGTCATCTGG + Intronic
1162520070 19:11174412-11174434 GACTGGGCATGGCGGACAGCTGG + Intronic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162534170 19:11253372-11253394 GGCTGGAGATGGGGGACATCAGG + Intronic
1162584719 19:11551835-11551857 GGCTGGGGTGGGCGGGCGGCAGG + Intronic
1162791607 19:13065875-13065897 TGCTGGGGATGGAAGGGAGGTGG + Intronic
1162921573 19:13906303-13906325 GGCTCGGGATCGACGGCCGCGGG + Exonic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1162971235 19:14182643-14182665 GGCTTGGGAGGGAGGGCCGGGGG + Intronic
1163142082 19:15356526-15356548 GGCTGGGGCTGGAGGACTGCCGG + Intronic
1163182543 19:15614768-15614790 GGCTGGCAGTGGAGGGCAACAGG + Intergenic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163500682 19:17674430-17674452 GGCGGAGGCTGGCGGGCAGCAGG + Intronic
1163551835 19:17969764-17969786 AGCTGGGGATGGGGGGCACAGGG - Intronic
1163553581 19:17979964-17979986 GGCTGAGGAGGGAGGACTGCTGG + Intronic
1163636872 19:18441091-18441113 GGCTGGCGTTGGAGGGCCGGGGG + Intergenic
1163848485 19:19650617-19650639 GCCTGGGGATTGTGGGCAGGTGG - Intronic
1164438331 19:28251733-28251755 GGCTGGGGATGGGGCACAGGTGG - Intergenic
1164596590 19:29534268-29534290 GACAGGGAATGGAGGGCAGGAGG - Intronic
1164658345 19:29940900-29940922 GGCTGGGGATGGAGAGAGGATGG + Intronic
1165072527 19:33263863-33263885 GGCTGGGGACGTGGGGCGGCAGG - Intergenic
1165091151 19:33389015-33389037 TCCTGGGGAGGGAGTGCAGCCGG - Intronic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165117102 19:33535153-33535175 GGCAGGGGAGGGAAGGCAGGGGG + Intergenic
1165126848 19:33604140-33604162 GGTGGGGGATGGAGAGCATCAGG - Intergenic
1165245047 19:34493910-34493932 GGCAGGGGATGGAGGGGAGGAGG - Intronic
1165341244 19:35213799-35213821 GGCTGGGGATGGAATCCAGGCGG - Intergenic
1165436346 19:35797424-35797446 GGATGGGGTCTGAGGGCAGCGGG + Intergenic
1165532933 19:36418823-36418845 GGCAGGGCCTGGAGGGGAGCGGG + Intergenic
1165891607 19:39115899-39115921 GGCTGGGGTTGGGAGGTAGCGGG + Intergenic
1165914030 19:39247236-39247258 AGCCAGGGAGGGAGGGCAGCGGG + Intergenic
1165916831 19:39265692-39265714 AGCCAGGGAGGGAGGGCAGCGGG - Intergenic
1165924928 19:39320904-39320926 GGCTCGGGAGGGAGGGCGGGAGG - Intergenic
1166049830 19:40252113-40252135 GGCAGGGGTTGCAGGGCAGGTGG - Intronic
1166067417 19:40367913-40367935 GGCAGGGGGTGGGAGGCAGCGGG + Intronic
1166128244 19:40729436-40729458 GGGCAGGGATGGAGGGCAGGGGG + Intronic
1166154199 19:40898497-40898519 TGCTGGGGATAGAAGGCATCTGG - Intergenic
1166173905 19:41052083-41052105 TGCTGGGGATAGAAGGCATCTGG + Intergenic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
1166297713 19:41897087-41897109 GGCGGGGGGTGGGGGGCAGGGGG - Intronic
1166511570 19:43412881-43412903 GGTCGGGGGAGGAGGGCAGCAGG - Intronic
1166542713 19:43616025-43616047 GGCAGGAAATGGAGGGCAGGAGG + Intronic
1166726978 19:45034395-45034417 GGCTGGGGAGGAAGGGCTGTCGG + Intronic
1166737928 19:45097147-45097169 GTCTGGGGCTGGAGGACTGCAGG + Intronic
1166751652 19:45166752-45166774 GGCAGGAGAGGGAGGGCTGCAGG - Intronic
1167134790 19:47609814-47609836 GGATGGGGAAGGAGGCCACCGGG + Intronic
1167144381 19:47673096-47673118 GTCTGGGGAGGCAGGACAGCAGG + Intronic
1167287485 19:48606776-48606798 TCCTGGGGATGGAGGTGAGCGGG - Exonic
1167423967 19:49420259-49420281 GGATGAGAATGGAGGCCAGCAGG + Intergenic
1167497045 19:49825895-49825917 GGCTGGGGATGGGGGGATGGGGG - Intronic
1167539919 19:50079269-50079291 GGCTGGGAAGGGAAGGCAGTGGG - Intergenic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167629783 19:50618499-50618521 GGCTGGGAAGGGAAGGCAGTGGG + Intergenic
1167634867 19:50648727-50648749 GGGAGGGGATGGTGGGCAGGGGG - Intronic
1167641009 19:50681422-50681444 GGCAGGGGCAGGTGGGCAGCTGG + Intronic
1167751099 19:51380638-51380660 GGCTGGGGAGAGAGGGCGGGAGG + Exonic
1168126835 19:54288747-54288769 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168307422 19:55442985-55443007 GGCTGGGGAGGGCGGGCGGGGGG + Intergenic
1168421219 19:56205068-56205090 GGCTGGGGTGGGTGGGCAGGCGG + Intronic
1168424226 19:56225848-56225870 GGCTGGGGTGGGTGGGCAGGGGG - Intronic
1168426478 19:56243209-56243231 GGCTGGGGTGGGTGGGCAGAGGG + Intronic
925055800 2:856496-856518 GGCTGGGCAGGGAGGAGAGCAGG - Intergenic
925266335 2:2569074-2569096 GGCTGGGGCTGGACGGAAGAGGG + Intergenic
925390125 2:3488933-3488955 GGCGGGGGCTGGAGGACAGGAGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926195726 2:10762688-10762710 GGATGGGGATGGAGGAGAGGAGG - Intronic
926195858 2:10763231-10763253 GGCCGGTGATGGAGGGCGCCGGG - Intronic
926278373 2:11423920-11423942 GGTTGGGGAGGGAGAGCATCAGG + Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926349836 2:11984613-11984635 GGCGGGGGCTGGTTGGCAGCCGG + Intergenic
926688438 2:15716410-15716432 TGCTGGGGATGTGGGGGAGCAGG + Intronic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927877758 2:26670263-26670285 GACTGGGGAGGAAGGGCAGGGGG + Intergenic
927921833 2:26978424-26978446 GGGTGGGGGTGGAGGGTGGCTGG - Intronic
927977275 2:27348289-27348311 AGCTGGGCATGGTGGGCAGCAGG + Intronic
928027547 2:27752510-27752532 GGCTGGGAAGGGAAGGCTGCAGG + Intergenic
928084753 2:28339090-28339112 GGAGGGGTATGGATGGCAGCGGG - Intergenic
928087781 2:28356518-28356540 GGCTGGGGACTGGGGGCAGAGGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929124666 2:38512386-38512408 GGCTGGGGGTGGGGCCCAGCGGG - Intergenic
929681789 2:43998969-43998991 GGCTTGGATTAGAGGGCAGCAGG + Intergenic
930667629 2:54115503-54115525 GGCCTGGGAGCGAGGGCAGCCGG - Exonic
930807592 2:55506800-55506822 GGCTGAGGCAGGAGGGCAGGAGG - Intergenic
931112809 2:59131242-59131264 GGCTGGATATGGAGTGCAGTTGG + Intergenic
931355938 2:61537835-61537857 GGCTGGGGAGTGAGGGAAGGGGG + Exonic
932001513 2:67889332-67889354 GGATGAGGATGGAGGCAAGCAGG - Intergenic
932791070 2:74654713-74654735 GGCTGGGGATGAGGGGCTGAGGG - Intronic
933460871 2:82583599-82583621 GGCTGGAAATTCAGGGCAGCAGG - Intergenic
933846881 2:86333988-86334010 CCCTGGGGACGGAGGTCAGCAGG - Intronic
934174377 2:89566192-89566214 GGCTGGGCATGTAAGCCAGCTGG - Intergenic
934176508 2:89583330-89583352 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
934284693 2:91640542-91640564 GGCTGGGCATGTAAGCCAGCTGG - Intergenic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934552718 2:95271946-95271968 GGCTGGGGATGGGTGGAGGCAGG + Intergenic
934568260 2:95352556-95352578 GGCTGGAGAGGGAGGGCTGGGGG - Intronic
935360620 2:102243617-102243639 GGCAGGGGCTTGAGGTCAGCAGG + Intergenic
935749573 2:106219400-106219422 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
936020080 2:108988221-108988243 GGCTGGGCAGGGAGGTCAGCAGG - Intronic
936039952 2:109142242-109142264 GGGTGGGGAGGTGGGGCAGCTGG - Intronic
936121725 2:109751917-109751939 GGCGGGGGATGAAGGGCAGTAGG - Intergenic
936222970 2:110619555-110619577 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
936285656 2:111179161-111179183 GTCTGGGGAGGGAGGACAGCCGG + Intergenic
936525975 2:113241980-113242002 TGCTGGGACAGGAGGGCAGCGGG - Intronic
936533364 2:113292101-113292123 GCCTGGGGATGGAGAGGAACTGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936918567 2:117664515-117664537 GGCTGAGGATGGATGGGAGTGGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937231112 2:120398753-120398775 GGCTGGGGATGGCTGGCTACGGG - Intergenic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
937412279 2:121687000-121687022 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
938130746 2:128714155-128714177 GTCTGGGAATGGAGGACACCAGG - Intergenic
938383716 2:130850469-130850491 GGCTGTGGATGATGGACAGCTGG - Intronic
938457681 2:131477136-131477158 GGCTGAGGTGGGAGGGCTGCTGG - Intronic
938765727 2:134459635-134459657 GGCTGGGGGAGGAGGGAACCCGG - Intronic
938765792 2:134459851-134459873 AGCTGGGAATTGAGGGGAGCAGG - Intronic
938777050 2:134551068-134551090 GGCTGGGGGTGGGGGTCACCAGG + Intronic
940453745 2:153871885-153871907 GGCTGGGGTGGGAGGGGGGCGGG + Intergenic
940834137 2:158501533-158501555 TGCTGTGGATGGATGTCAGCAGG - Intronic
941633295 2:167908006-167908028 GGATGGGGAAGGAGGGAAGGAGG + Intergenic
942459095 2:176157402-176157424 GGCCGGGGGTGGAGGGCCGGGGG - Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
944268609 2:197755745-197755767 GGCTGGGAAGGGAGAGCATCAGG + Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944654864 2:201867387-201867409 GGCTGGGGCTGGAGGATTGCTGG + Intronic
944869910 2:203899548-203899570 GGCAGGGGAGGGAGAGCATCAGG + Intergenic
945913702 2:215680327-215680349 GGCGGGGGAGGGAGAGCATCAGG + Intergenic
946058348 2:216920249-216920271 GGCTCAGGGTGGAGGGGAGCTGG + Intergenic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946592948 2:221271719-221271741 GGCTGGGGGAGTGGGGCAGCGGG - Intergenic
946832408 2:223740050-223740072 GGGTGGGGAGGGAGAGCATCAGG + Intergenic
947445520 2:230159933-230159955 GCCTGGGGATGGCCGGCAGCAGG - Intergenic
947524122 2:230868217-230868239 GGATGGGGGTGGGGGCCAGCTGG + Intronic
947534465 2:230932019-230932041 GTCTGGGGATGGTGAGGAGCTGG - Intronic
947670183 2:231930822-231930844 GGAAAGGGAAGGAGGGCAGCTGG - Intergenic
947749727 2:232525964-232525986 GGGTGGGGAGGGAGGGCCGGGGG - Intergenic
947792476 2:232876133-232876155 GGCGGGGGAGGGAGGGGAGAGGG + Intronic
947909661 2:233792701-233792723 GGTTGGAGGTGGAGGGCAGCAGG + Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948396090 2:237646393-237646415 GGGTGGGGAGGGAGAGCATCAGG - Intronic
948588107 2:239033964-239033986 GGCTGGGGCTGGAGGCCACCTGG + Intergenic
948636830 2:239343673-239343695 GGCAGGGCAGGCAGGGCAGCAGG - Intronic
948805483 2:240452095-240452117 GCCTGGGGAAGGTGGGGAGCTGG + Intronic
948826363 2:240575169-240575191 GGCTGGGGGCAGATGGCAGCAGG - Intronic
948835159 2:240622844-240622866 GGCTGGGGGCGGAGGGCCCCGGG + Intronic
948840252 2:240645255-240645277 GGCTGAGAATGTAGGGCAGGAGG - Intergenic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948874713 2:240820377-240820399 GGCTGGGGACGGAGGGGGCCGGG + Intergenic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
949001414 2:241616267-241616289 GGCTGGAGATGGCCAGCAGCTGG + Intronic
949007232 2:241656562-241656584 GGCGGGGGCTGGTGGGGAGCAGG - Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168769728 20:407885-407907 AGCCGGGGCTGGAGGGCGGCGGG - Intronic
1168774692 20:438111-438133 GGCTTGGGATGGAGAGCAAGAGG - Exonic
1168827160 20:821740-821762 GGCTGGGGTAGGAGGGAAGCTGG - Intergenic
1168840552 20:907340-907362 GGCTGCAGAGGGAGGGGAGCAGG + Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1170192573 20:13658660-13658682 GGCTGGAGCTAGGGGGCAGCAGG + Intergenic
1170551662 20:17482089-17482111 AGCTGGGGAGGGAGGGCGGTGGG - Exonic
1170794195 20:19532305-19532327 GTCTGGACATGGAGGGCTGCGGG - Intronic
1171164389 20:22957464-22957486 GGCAGGGAATGCAGTGCAGCAGG + Intergenic
1171257526 20:23701423-23701445 GCCTTGGCATGGAGTGCAGCAGG - Intergenic
1171264943 20:23763582-23763604 GCCTGAGCATGGAGTGCAGCAGG - Intergenic
1171376223 20:24695941-24695963 GGCTGAGCATGGAGGGCTGGTGG - Intergenic
1171433951 20:25104762-25104784 TGGAGGGGAAGGAGGGCAGCAGG - Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172101057 20:32484041-32484063 GGCTGGGGGGAGAGGGCACCCGG + Intronic
1172160591 20:32865349-32865371 GCTTGGGGATGGTGGGGAGCAGG + Intronic
1172598996 20:36170704-36170726 GGCTGGGGAGGGAGGAGAGTGGG + Intronic
1172620583 20:36316012-36316034 GGCTGGTCCTGGAGGCCAGCGGG + Intronic
1172744048 20:37193025-37193047 GGCTGAGGATGGAGGATCGCTGG + Intronic
1172842546 20:37910676-37910698 GGCTGGGGCTGGAGGGTCACTGG + Intronic
1172846934 20:37935219-37935241 GGCTGGGGGTGGGGGGCTGGGGG - Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173473854 20:43344691-43344713 GGCTGGAAATGGTGGGGAGCAGG - Intergenic
1173476507 20:43363661-43363683 GGCGGGGGATGGAAGCCAGGAGG - Intergenic
1173521655 20:43704451-43704473 GGCTGGAGAAGGAAGGCAGCGGG + Intronic
1173563691 20:44023924-44023946 GGCTGAGGAAGGAGGGAAGGGGG - Intronic
1173664982 20:44757036-44757058 CGCTGGGGATAGAGGCCAGCAGG + Exonic
1173785699 20:45791657-45791679 GGCTGGGGTTGGGGAGCAGAGGG - Intronic
1173820830 20:46019266-46019288 GTGTGGGGATGGGGTGCAGCAGG + Intergenic
1173869349 20:46331810-46331832 GGCAGAGGAGGGAGGGCAGCTGG + Intergenic
1173885758 20:46457625-46457647 GACTGAGGATGGTGGGCAGGAGG - Intergenic
1174072802 20:47910329-47910351 GGCAGGGGCAGGAAGGCAGCAGG + Intergenic
1174135552 20:48376364-48376386 AGCTGGAGAAGGAGGCCAGCGGG + Intergenic
1174145213 20:48448521-48448543 GGCTGGGCTTTGAGGGCAGGTGG - Intergenic
1174151268 20:48488346-48488368 GGCAGGGGCAGGAAGGCAGCAGG - Intergenic
1174172863 20:48627968-48627990 AGCAGGGGAGGGAGGACAGCGGG + Intronic
1174313389 20:49677333-49677355 TGCTGGGGATGGTGTGCAGAGGG - Intronic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1174438955 20:50533438-50533460 GGCTGGGGGCGGGGGGCAGGGGG - Intronic
1175218524 20:57404191-57404213 GCCTGGGGCTGTGGGGCAGCTGG - Intronic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175523519 20:59618219-59618241 GGATGGGGCTGCAGGGGAGCTGG + Intronic
1175968899 20:62674039-62674061 GGCTGGGGCAGGAGGGAATCAGG + Intronic
1176030830 20:63010416-63010438 GGGTGGGGGAGGAGGGGAGCCGG - Intergenic
1176103380 20:63374615-63374637 GGCTCGGGATGGAGGGAGGAGGG + Intronic
1176155248 20:63616737-63616759 GGCTGAGGATGGCAGGTAGCTGG - Intronic
1176286045 21:5020295-5020317 GGCAGGGGCAGGAAGGCAGCTGG - Intergenic
1176297983 21:5084576-5084598 GGGTGGCGAGGGGGGGCAGCAGG + Intergenic
1176332516 21:5561146-5561168 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1176382852 21:6121752-6121774 GGCGGGGGCAGGAGGGGAGCGGG + Exonic
1176395241 21:6259805-6259827 GGGAGGGGAAGGAGAGCAGCAGG + Intergenic
1176441916 21:6729299-6729321 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1176466178 21:7056368-7056390 GGGAGGGGAAGGAGAGCAGCAGG - Intronic
1176489739 21:7438146-7438168 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1177210031 21:18059632-18059654 TGCTGGGGAGGGAGAGCATCAGG - Intronic
1177723476 21:24937723-24937745 AGCTGGAGATGGAGGAAAGCTGG + Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178020006 21:28396788-28396810 AGCTGGGGACCGAGGGCAGTGGG - Intergenic
1178290428 21:31363287-31363309 GGCTGGGGTTAGGGGACAGCTGG - Intronic
1178404206 21:32311395-32311417 GGTGGGGGGTGGAGGGGAGCAGG - Exonic
1178459527 21:32790085-32790107 TGCTGGGAATGCAGGCCAGCAGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1179243131 21:39609384-39609406 GGCTGGTGATGGTGGGAGGCGGG - Intronic
1179545974 21:42112420-42112442 AGCTGGGGATGCAGAACAGCTGG - Intronic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1179711905 21:43268316-43268338 GGCTGGTGGGGGAGGGAAGCAGG + Intergenic
1179740617 21:43416487-43416509 GGCGGGGGCAGGAGGGGAGCGGG - Exonic
1179859046 21:44177373-44177395 GGGTGGCGAGGGGGGGCAGCAGG - Intergenic
1179871136 21:44243180-44243202 GGCAGGGGCAGGAAGGCAGCTGG + Intergenic
1179908808 21:44437435-44437457 GGCTGCGGCTGGAGGCCACCTGG + Intronic
1179979264 21:44887958-44887980 GGCTGGGGCTGGGGGGCCGCTGG - Intronic
1180161564 21:46000642-46000664 GGCCGGGGAAGGAGGGCGGCCGG + Intronic
1180180695 21:46117555-46117577 GGCTGGGGCTGCTGGGCTGCCGG - Intronic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180868749 22:19134358-19134380 TGCTGGGGATGGTGTGTAGCTGG + Exonic
1181049360 22:20231341-20231363 GGCTGGGGCAGGAGGGCTGTGGG + Intergenic
1181081030 22:20415251-20415273 GTCTGAGGATGGGGGGCTGCGGG - Intergenic
1181282133 22:21727797-21727819 GCCTGGGGATTGAGGGGAACAGG - Intronic
1181292020 22:21802475-21802497 GGCTGGGACTGGGAGGCAGCAGG - Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181570630 22:23766244-23766266 TGCAGGGGCTGGGGGGCAGCGGG + Exonic
1181610101 22:24006422-24006444 GGCTGGGAAGACAGGGCAGCTGG + Intergenic
1181690220 22:24555052-24555074 GGCTGGGGCGGGAGGGCGGTCGG + Intronic
1181861534 22:25823060-25823082 GGTTGGGGGAGGAGGGCAGCAGG + Intronic
1182481646 22:30613059-30613081 CGCTGGGGGTGGGGAGCAGCTGG + Intronic
1182718510 22:32378637-32378659 GGCTGGGGCTGGACTGGAGCTGG + Intronic
1182878349 22:33711745-33711767 GGCTGAGGAAGGAGGACTGCTGG - Intronic
1183086702 22:35491392-35491414 GGATAGGGGTGGAGGGCACCTGG - Intergenic
1183113223 22:35668629-35668651 GGATGGAGATGGGGGGCAGGAGG - Intergenic
1183152333 22:36047647-36047669 GGGTGGGGATAGCGGGCATCAGG - Intergenic
1183332722 22:37230003-37230025 GGCAGGGGTTGGAGGGGTGCTGG + Intronic
1183343399 22:37294267-37294289 GGCTGGGGGAGGTGGGCAGTGGG + Intronic
1183353820 22:37348216-37348238 TGCTGGGGAAGGAGGAGAGCAGG + Intergenic
1183513036 22:38246960-38246982 GGATGGGGACACAGGGCAGCTGG + Intronic
1183522337 22:38302832-38302854 GGCTGGGGATGGAGGGGACGGGG + Intronic
1183609037 22:38884793-38884815 GTCTGAGGCTGGAGTGCAGCAGG - Intergenic
1183672511 22:39281376-39281398 GGAGGGGGATGGAGAGCAGTGGG - Intergenic
1183702734 22:39458869-39458891 GGCTGGGCAGGGAGGCCAGGTGG + Intronic
1183731031 22:39618716-39618738 GTCTGGTGATGGGGGGCAGGGGG + Intronic
1183731147 22:39619262-39619284 GGATGGTGCTGGAGGCCAGCTGG - Intronic
1183733776 22:39632345-39632367 GGCTGGGCAAGGAGGTCTGCTGG - Intronic
1183982293 22:41548435-41548457 TGCTGGAGTTGGGGGGCAGCAGG + Intergenic
1184004140 22:41696591-41696613 GGGTGGGGAGGGAGAGCATCTGG + Exonic
1184057695 22:42063353-42063375 GGTTGGGAGAGGAGGGCAGCAGG - Intronic
1184115145 22:42417804-42417826 GGGTGGAGCAGGAGGGCAGCAGG + Intronic
1184147370 22:42619428-42619450 GGCCGGGAATGGTGGGCAGACGG + Exonic
1184149103 22:42628294-42628316 AGCTGGGGACTGAGGGCTGCGGG - Intronic
1184164623 22:42720326-42720348 GGACGGGGATGGAGAGCGGCCGG - Intronic
1184172739 22:42769290-42769312 GGCAGAGGGTGGGGGGCAGCAGG + Intergenic
1184355586 22:43977357-43977379 GGCTTGAGAGTGAGGGCAGCAGG + Intronic
1184385521 22:44172208-44172230 GGCTTGGGATGAATGGCTGCTGG + Intronic
1184421316 22:44384423-44384445 GGCTGGAGATGGACAACAGCTGG + Intergenic
1184654260 22:45933236-45933258 TGCTGGGGAGGGAGGGATGCTGG - Intronic
1184999996 22:48239507-48239529 AGCTGGGGTTGGGAGGCAGCAGG + Intergenic
1185055609 22:48576967-48576989 GGCTGGGGCGGGAGCGGAGCTGG + Intronic
1185110216 22:48896432-48896454 GGCAGGGGGTGGAGGGCATGTGG + Intergenic
1185136845 22:49078203-49078225 GGCAGGGCCTGGAGGGCATCAGG + Intergenic
1185204700 22:49531123-49531145 GCCTGTGGATGGAGGGCGTCTGG + Intronic
1185217064 22:49607391-49607413 GGCCCAGGGTGGAGGGCAGCAGG - Intronic
1185272885 22:49936764-49936786 GGGTGTGGATGGAGGGCTGTGGG - Intergenic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1185308373 22:50136716-50136738 GGCAGGGGACAGAGAGCAGCTGG + Intronic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
1185398997 22:50606328-50606350 GGCTGAGGCTGGGGGGCAGTAGG + Intronic
949478904 3:4474562-4474584 GGGTGGGGGTGGAGGGCATGGGG + Intergenic
949836927 3:8279731-8279753 GGCTGGGGTTGGCGGGGAGCAGG - Intergenic
950105200 3:10384198-10384220 GGCAGGGGATGGGAGGCTGCGGG + Intronic
950198886 3:11028870-11028892 GTCTGGGGATGGAGAGCTCCTGG - Intronic
950282766 3:11720918-11720940 TGCTGGGGATGGCGGGGGGCGGG - Intergenic
950468905 3:13172735-13172757 TGCTGGTGAGGGATGGCAGCAGG + Intergenic
950478905 3:13232574-13232596 GTCTGGGGAGAGAGGGCAGGGGG + Intergenic
950556468 3:13699130-13699152 GGCGGGGGATGAGGGGCGGCTGG - Intergenic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
951004189 3:17598002-17598024 GGCTGGGGTTGGGGGGCGGGGGG - Intronic
951038012 3:17954968-17954990 GGCAGGGGATGGAGGGTGGGAGG - Intronic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
951522417 3:23621867-23621889 GGAAGGGGATGGAGCGTAGCTGG - Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952729120 3:36620512-36620534 GACAGGGGGTGGAGGACAGCAGG + Intergenic
952875932 3:37944482-37944504 AGCTGGGGCTGGAAGGCAGTAGG + Intronic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953315703 3:41924788-41924810 GGAAGAGGATGGAGAGCAGCAGG - Intronic
953435055 3:42871505-42871527 GGCTGGGGCTGTGGGGAAGCAGG - Intronic
953699341 3:45183903-45183925 GGGTTGGGGTGGAGGGCAGTGGG + Intergenic
953881907 3:46695065-46695087 GCCTGGGGGTGGAGGGCATGGGG - Intergenic
954130651 3:48559069-48559091 GGCTGGGGGTAGAGGACAGCTGG + Intronic
954131073 3:48561213-48561235 GGCTGGGGAGGCGGGGCTGCAGG - Intronic
954134105 3:48574261-48574283 GGCTGGGCCTGAAGGGAAGCCGG - Exonic
954196272 3:48998969-48998991 GGCTGGGGGTTGGGGGCAGGCGG - Intronic
954390809 3:50267198-50267220 GGCTGGGGTGGCCGGGCAGCTGG - Intergenic
954417307 3:50399633-50399655 GGCTGTGAAAGGAGGGGAGCAGG - Intronic
954448879 3:50561114-50561136 GGCAGGGCCTGGAGGGCTGCTGG - Intronic
954813004 3:53259502-53259524 GGATGGGGTGTGAGGGCAGCAGG - Intergenic
954838941 3:53494687-53494709 GGCTCGGGACCGCGGGCAGCCGG - Intronic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
955097278 3:55811998-55812020 GGCAGGGGAAGGAGAGCATCAGG - Intronic
955929182 3:64038600-64038622 GGCTGGGGACGCAGGTCTGCAGG - Intergenic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
956738643 3:72258347-72258369 TGCTGGGGTGGGATGGCAGCTGG - Intergenic
956740334 3:72270789-72270811 GGCTGGGGATGGGGAGCAACAGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958165890 3:89877398-89877420 GGCTGTGGATGGACAGCAGGAGG + Intergenic
958548383 3:95587241-95587263 GGCTGGGGAAAGAGAGAAGCTGG - Intergenic
958837926 3:99168779-99168801 TGCTGGGGAGGGAGAGCATCAGG - Intergenic
959082152 3:101813341-101813363 GGCGGGGCAGGGAGGGCTGCGGG - Intronic
959400190 3:105891330-105891352 GGCGGGGGTTGGAGGGCTGCTGG - Intergenic
959517113 3:107280881-107280903 TGCTGAGGATGGAGAGCAACTGG + Intergenic
959599772 3:108168626-108168648 GGATGGGGAGGGAGAGCAGTAGG - Intronic
960987978 3:123292710-123292732 GGCTGGGGGTGGGGGGTAGGGGG + Intronic
961167100 3:124770881-124770903 GGTGGGGGATCGGGGGCAGCTGG - Intronic
961346869 3:126268641-126268663 GGCGGGGAAAGGGGGGCAGCAGG + Intergenic
961720528 3:128892117-128892139 GCCTGGGGATGGTGGACAGATGG + Intronic
961780450 3:129317409-129317431 GGCTGGGGCTGGGGGGTGGCAGG + Intergenic
961787023 3:129353456-129353478 AGCTGGGGATGGGGGACAGGTGG - Intergenic
962267671 3:133955244-133955266 GGCCGGGTTTGGAGGCCAGCCGG - Intronic
962800939 3:138889974-138889996 AGCTGGAGATGCAGGGCAGTGGG - Intergenic
962920955 3:139950043-139950065 AGCTAGGGAGGCAGGGCAGCAGG + Intronic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
965006471 3:163032666-163032688 TGCTGTGGAGGCAGGGCAGCAGG - Intergenic
965066097 3:163850636-163850658 GGCAGGGGGTGGAGGGGAGGAGG + Intergenic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
966912686 3:184568374-184568396 GGCGAGGGATGGGGTGCAGCAGG + Intronic
967108446 3:186272398-186272420 GGCTAGGGTGGGAGGGCAGCTGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967253971 3:187571039-187571061 TGCTGGGGGTGAAGGGCAGTAGG - Intergenic
968129373 3:196183834-196183856 GGCGGGTGAGGGATGGCAGCAGG - Intergenic
968235967 3:197030089-197030111 AGTCGGGGCTGGAGGGCAGCTGG + Intergenic
968545048 4:1194172-1194194 GGCTGGGGGTGGAGGGAGGCCGG - Intronic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
968591522 4:1462150-1462172 GGCTGGGACTGGAGGGAGGCGGG - Intergenic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968737365 4:2304362-2304384 GGCTGGGGTTGCAGGTCAGCAGG - Exonic
968929808 4:3572896-3572918 GGCTGGAGAAGCAGGGCAGAGGG - Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969466037 4:7357018-7357040 AGCTGGGGACGGTGGGCTGCAGG + Intronic
969486306 4:7474271-7474293 GGCTGGGCAGTGAGGTCAGCGGG + Intronic
969548741 4:7849945-7849967 GGCTGGGGATGGGGGGTGGAGGG + Intronic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969697726 4:8744597-8744619 GGCTGGGCATGGGGTTCAGCTGG - Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969741028 4:9026775-9026797 GGCTGAGGAGGGAGGACTGCTGG - Intergenic
970456112 4:16226194-16226216 GACTGGGGACCGAGGGCGGCGGG - Intronic
970708676 4:18836264-18836286 AGATGGGGATGGATGGTAGCTGG + Intergenic
970913148 4:21302678-21302700 GGCGGGGGATGGTGGAGAGCTGG - Intronic
971138240 4:23894005-23894027 GGCAAGGTTTGGAGGGCAGCTGG + Intronic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
972172370 4:36362145-36362167 GCCTGCTGATGGTGGGCAGCAGG - Intergenic
972314213 4:37910662-37910684 GGCTGGGGAGTGAGGGGAGATGG + Intronic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
972381656 4:38525307-38525329 GGCTGGGGAAGGAGGCCCGGTGG - Intergenic
972858898 4:43142509-43142531 GGCAGTGGAGGGAGGGCATCAGG + Intergenic
973552612 4:52051269-52051291 CGCGCGGGCTGGAGGGCAGCAGG - Intergenic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
973801465 4:54482826-54482848 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
973878139 4:55241724-55241746 GGCAGGGGCAGGAGGGCGGCAGG - Intergenic
973930821 4:55791749-55791771 GGCTGGGGCTGGACTGCAGCTGG - Intergenic
974004724 4:56544679-56544701 GGCAGCGGCTGGAGGGCTGCGGG - Intronic
975443326 4:74436871-74436893 GGCAGGGCAGGGAGGGTAGCGGG + Intergenic
975622108 4:76306366-76306388 GGCTGGGCCTCGCGGGCAGCAGG + Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976100300 4:81554945-81554967 GGTTGGGGATGGGGGGCACGGGG + Intronic
976396199 4:84558346-84558368 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
976614010 4:87057895-87057917 GGGTGGGGATGGTGGGCGGGGGG - Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
976785909 4:88820758-88820780 GTCTAGGGAAGGAGGGCAACAGG + Intronic
976927653 4:90520827-90520849 GGCTGGGGCAGGATGGCAGGAGG + Intronic
976936666 4:90644607-90644629 GGTTGGGGAGGGAGAGCATCAGG - Intronic
978629711 4:110730313-110730335 GGGAGGGGAGGGAGAGCAGCAGG - Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
980091482 4:128447571-128447593 GGCTGGGGTTGGGGAGCTGCAGG + Intergenic
980893568 4:138839720-138839742 GGCCGGGGTGGGAGGGCGGCAGG + Intergenic
981340449 4:143615937-143615959 GCCTGAGGATACAGGGCAGCAGG + Intronic
981704654 4:147646654-147646676 GGCTGGGGAGGGGGGGGAGGGGG + Intronic
981973065 4:150689305-150689327 GTATGGGGATGGAGGGCAAGGGG + Intronic
982010108 4:151098228-151098250 GGTAGGGGATGGAGGCTAGCAGG + Intergenic
982107350 4:152022543-152022565 GGCTGTGGATGAAGAGCAGTAGG - Intergenic
982436223 4:155384958-155384980 GTCTGGGGCTGCGGGGCAGCTGG - Intergenic
982751679 4:159169577-159169599 GGCTGGGGAGGGGGGGCTGTTGG - Intronic
983904607 4:173169711-173169733 GGCTGGGGGCGGCGGGCAGGCGG - Intronic
984073764 4:175149956-175149978 GGCTGGGGATGGAGAGGGGGTGG - Intergenic
984172771 4:176380795-176380817 GGGTGGGGATGGGGGTGAGCTGG + Intergenic
984289880 4:177781787-177781809 GGCTGGACATGGAGAGCACCTGG - Intronic
984850761 4:184150548-184150570 GGCTGAGGCTGGAGGGAACCAGG + Intronic
984947726 4:184983072-184983094 GGCTGGGGATGGAGGAAGACAGG - Intergenic
985033225 4:185813354-185813376 GGTTGGGGAGGAAGGGGAGCGGG - Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985058552 4:186056784-186056806 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058557 4:186056798-186056820 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058569 4:186056826-186056848 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058574 4:186056840-186056862 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058586 4:186056868-186056890 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058591 4:186056882-186056904 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058620 4:186056952-186056974 GGCTGGGGGTGGATGGCGGGGGG - Intergenic
985058656 4:186057043-186057065 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058683 4:186057113-186057135 GGCTGGGGGTGGATGGCGGGGGG - Intergenic
985058709 4:186057176-186057198 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058714 4:186057190-186057212 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058726 4:186057218-186057240 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058731 4:186057232-186057254 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058777 4:186057344-186057366 GGCTGGGGGTGGATGGCGGGGGG - Intergenic
985058822 4:186057456-186057478 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058827 4:186057470-186057492 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058839 4:186057498-186057520 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058844 4:186057512-186057534 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058888 4:186057624-186057646 GGCTGGGGGTGGATGGCGGGGGG - Intergenic
985058914 4:186057687-186057709 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058919 4:186057701-186057723 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058931 4:186057729-186057751 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058936 4:186057743-186057765 GGCTGGGGGTGGATGGCTGGGGG - Intergenic
985058948 4:186057771-186057793 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985058969 4:186057827-186057849 GGCTGGGGGTGGATGGCGGGAGG - Intergenic
985068642 4:186146375-186146397 GTCTTGGGATGCAGGGCAGGGGG - Intronic
985089441 4:186348424-186348446 GGCTGGGGAGGGGGGGCAGGTGG - Intergenic
985478995 5:95578-95600 GGCTGGGAAGGGAGGGAATCTGG - Intergenic
985517843 5:356267-356289 TGCGGGGCATGGAGGGGAGCTGG + Intronic
985521158 5:374423-374445 GGCTGAGCCTGGAGGGCAGGAGG + Intronic
985542147 5:492200-492222 TGTTGGGGAGGGAGGTCAGCGGG + Intronic
985549374 5:525216-525238 GTCTGGGGCTGGAAGGCTGCAGG - Intergenic
985576368 5:675227-675249 GGCTGGGGGTGCAGTGCAGGGGG + Intronic
985635155 5:1032225-1032247 GTTTGGGGAGGGAGGGCTGCGGG - Intronic
986923040 5:12711317-12711339 GGATGGGGAGGGAGAGCATCAGG - Intergenic
987309976 5:16672781-16672803 GCCTGGCCATGGAGGACAGCAGG - Exonic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
987753562 5:22070981-22071003 GGATGGGGAGGGAGAGCATCAGG + Intronic
988061984 5:26183189-26183211 GTCGGGGGATGGGGGGCAACGGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
989605688 5:43242371-43242393 GGCAGGAGATGGAGGGGAGCAGG + Intronic
989774082 5:45181971-45181993 GGTGGGGGCTGGAGGGCAGGAGG - Intergenic
990208048 5:53451286-53451308 GGGTGGGGGGAGAGGGCAGCTGG - Intergenic
991522229 5:67513988-67514010 GAGCGGGGATGCAGGGCAGCAGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992334472 5:75751465-75751487 GGTTGGGGTTGGAGGGGAGAGGG + Intergenic
992550143 5:77852001-77852023 GGCTGCGGGTGGCGGGGAGCCGG - Intronic
992991980 5:82293007-82293029 GGCTGAGGCAGGAGGGCTGCTGG + Intronic
993040774 5:82812262-82812284 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
994536899 5:101042634-101042656 TCCAGGGGAAGGAGGGCAGCAGG + Intergenic
995764568 5:115601980-115602002 GGCTGGGGAGGTAGCGCAGGCGG + Intronic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996888165 5:128384284-128384306 GGCTGGGGATGGATGAAAGGAGG + Intronic
997207216 5:132056969-132056991 GGATGGGCAGGGAGGCCAGCTGG - Intergenic
997361467 5:133297916-133297938 GGCTAGGGATAGAGGACTGCTGG - Intronic
997469445 5:134108712-134108734 GGCAGGGGTTGGAGGACTGCAGG + Intergenic
997586538 5:135047029-135047051 GGCTTGAGATGGAGGGCTGAGGG - Intronic
998138844 5:139688746-139688768 GGCTGGGGGTGGGGGGCGGGGGG - Intergenic
998161138 5:139813600-139813622 TGCTGGAGATGGAGCGCCGCAGG - Exonic
998165198 5:139838739-139838761 GGGTGGTGCAGGAGGGCAGCAGG - Exonic
998352207 5:141508968-141508990 GGCTGGGGGTGGGGGCCAGCTGG + Intronic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998476744 5:142428440-142428462 GGCTGGTGAAGGAGAGGAGCTGG + Intergenic
998506014 5:142673641-142673663 GGCTGAGGCTGGAGTGGAGCAGG - Intronic
999306130 5:150520936-150520958 TTCTGGGGGTGCAGGGCAGCAGG - Exonic
999584960 5:153080176-153080198 GTCAGGGGGTGGAGGGCTGCGGG - Intergenic
1000258066 5:159559871-159559893 GGCGGGGGATGGGGGTCAGGGGG - Intergenic
1000725995 5:164771619-164771641 GGGTGAAGATGGAGGGGAGCAGG - Intergenic
1001085844 5:168699510-168699532 TGCTGGGGAAGGTGGGAAGCAGG + Intronic
1001288652 5:170441156-170441178 TGCTGGGCTGGGAGGGCAGCTGG - Intronic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1001939699 5:175731764-175731786 GGCTGGGGTCAGAGGGCTGCAGG - Intergenic
1002051451 5:176573927-176573949 GGCTGCGGGTGGAAGGCACCTGG - Intronic
1002169118 5:177365718-177365740 GGCTGGGGGAGGAGGGAACCAGG + Intronic
1002190570 5:177475273-177475295 GGCTGGGGGGTGAGGGGAGCGGG - Intergenic
1002419586 5:179138672-179138694 GCCTGGGGCAGGAGGACAGCAGG + Intronic
1002587190 5:180256598-180256620 GGGTGGGGATGGTGAGCAGGAGG + Intronic
1002876545 6:1215760-1215782 GCCTGGGGATGGAGGGCTCCAGG + Intergenic
1003172687 6:3732781-3732803 GGCTGGGGATGGGGACCTGCAGG - Intronic
1003224606 6:4192241-4192263 GGCTGGAGAGTGAGGGCAGGGGG - Intergenic
1003254599 6:4463858-4463880 AGGAAGGGATGGAGGGCAGCTGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003394837 6:5744162-5744184 GCCTGGGGAGGGTGAGCAGCTGG + Intronic
1003465053 6:6371040-6371062 GGCTGGGGAGGGAGGAATGCAGG + Intergenic
1003577593 6:7312627-7312649 GGCTGGGGGTGGAGCGGAGCCGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004353538 6:14911871-14911893 GGCTAGGGAAGGAGAGGAGCAGG + Intergenic
1004501922 6:16217079-16217101 GGCTAGGCATGGTGGGCTGCAGG - Intergenic
1004565913 6:16797540-16797562 GGCTGAGGCTGGAGAGAAGCTGG + Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1005988637 6:30890012-30890034 AGCTGGAGATGGCGGGCAGGTGG - Intronic
1006063273 6:31441834-31441856 GGCTGGGGAGAAAGGGGAGCGGG - Intergenic
1006136687 6:31900355-31900377 GCCTGGGGGCGGGGGGCAGCCGG - Exonic
1006430442 6:33992709-33992731 GTCTGGGGCTGATGGGCAGCTGG - Intergenic
1006448171 6:34091431-34091453 GGGTGAGGGTGGAGGGCCGCGGG - Intronic
1006458633 6:34145459-34145481 GGCTGGGAAGGGAGCGGAGCGGG + Intronic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006790673 6:36699095-36699117 GCCTGGGGCAGGAAGGCAGCAGG - Intronic
1006806595 6:36793230-36793252 GGCAGGGGAGGAAGGGAAGCCGG + Intronic
1007095329 6:39209394-39209416 GGCTGGGGATGGATGGTGGGCGG - Intronic
1007398018 6:41588185-41588207 GGCTGAGGCTGGAGGGGAGCAGG - Intronic
1007416669 6:41694981-41695003 GGCTGTGGGTGGACAGCAGCAGG - Intronic
1007757758 6:44111425-44111447 GGATGGTGGTGGAGGGCAGTGGG - Intergenic
1008583433 6:52927178-52927200 GGTTGGGGGAGGAGGGCAGCAGG - Intergenic
1009928800 6:70151663-70151685 GGGCAGGGGTGGAGGGCAGCTGG + Intronic
1010084627 6:71902666-71902688 GGCAGGGGAGGGAGAGCATCAGG - Intronic
1010810027 6:80290248-80290270 GGCTGGGGTGGGAGGGGAGCAGG + Intronic
1010836898 6:80599413-80599435 GGGTGGGGAGGGAGAGCATCAGG + Intergenic
1010945405 6:81968751-81968773 GGCTAGGGATTGAGGGCTCCAGG - Intergenic
1011727535 6:90225619-90225641 GGGTGGGGAGGGAGAGCATCAGG + Intronic
1011783176 6:90813425-90813447 GGTTGGGGAGGGAGAGCATCAGG - Intergenic
1013369077 6:109454982-109455004 GGCTGGGGGTCGACCGCAGCCGG + Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013787399 6:113796979-113797001 GGCTGAGGTAGGAGGTCAGCAGG - Intergenic
1014099815 6:117499494-117499516 GGCTGGGGATGGAAGTGAGGAGG - Intronic
1014557678 6:122853649-122853671 GGCTGGGGAAAGAGAGAAGCCGG + Intergenic
1015543055 6:134335117-134335139 GGCTGAGGAGAGAGGGTAGCAGG - Intergenic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1016827820 6:148404695-148404717 GGCTGGGCTTGGGGGGCAGGTGG - Intronic
1017488088 6:154921235-154921257 GGCTCAGGATAGAGGGCACCAGG + Intronic
1017561842 6:155636501-155636523 GGCTGCAGATGGAGGGCTGGGGG + Intergenic
1017694420 6:157000195-157000217 GGCTGGAGAGGGAGGGAACCAGG + Intronic
1017842291 6:158232040-158232062 GGCCGGGGAGGGAGGGCGGCCGG + Intergenic
1018240310 6:161767757-161767779 GGCTGGGGGTGGGGGGCTGGGGG + Intronic
1018733374 6:166669661-166669683 GGCAGGGGATGGGGAGGAGCAGG - Intronic
1018835984 6:167484617-167484639 GGCTGGGCATGTGGGACAGCTGG + Intergenic
1019409869 7:901748-901770 GGCGGGGGAAGGAGGGGAGGCGG - Intronic
1019431316 7:1001100-1001122 AGCTGCGGATGGAGCGAAGCTGG + Intronic
1019496357 7:1342246-1342268 GGCTGGAGATGGAGGCCTGGAGG + Intergenic
1019538374 7:1540387-1540409 GGCGGGGGGTGGCGGGCGGCGGG + Exonic
1019580276 7:1758518-1758540 GGCTGAGGGTGGAGGCTAGCTGG + Intergenic
1019599619 7:1874763-1874785 GGGTGGGGCTGGAGGGCTCCAGG + Intronic
1019732102 7:2634141-2634163 GGCGGGGGATGGAGGCAGGCCGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019826351 7:3287585-3287607 GTCTGGGGAGGGAGAGCATCAGG - Intergenic
1019996019 7:4725021-4725043 TGCTGGGGACAGAGGGCAGCAGG - Intronic
1020106243 7:5423523-5423545 GCCGCGGGATGGCGGGCAGCAGG - Exonic
1020279444 7:6642918-6642940 GGCTGGGGGCTCAGGGCAGCTGG + Intronic
1020678032 7:11203355-11203377 GGCTGAGGCTGGAGGACAGCTGG + Intergenic
1021633984 7:22673255-22673277 AGCTGGGGAAGAAGGGCTGCGGG - Intergenic
1022200180 7:28109044-28109066 GGCTGGGGGTGGATGGCTGGAGG + Intronic
1022363534 7:29685677-29685699 GGCTGGGGGAGGAGGGAAGGTGG - Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022427753 7:30284848-30284870 GGCTGGGGGAGGAGGGAAGGTGG + Exonic
1022528292 7:31052252-31052274 GGCTGGGGAGGGGGTGCTGCAGG - Intergenic
1022697840 7:32728067-32728089 GGCTGGGGGAGGAGGGAAGGTGG + Intergenic
1022964724 7:35461953-35461975 GGGTGGGGATTCTGGGCAGCAGG + Intergenic
1023037599 7:36147148-36147170 GGATGGGGAAGGAGTGCAGCTGG - Intergenic
1023170486 7:37386258-37386280 AGCTGGGGAGGGAGGGCTGGAGG + Intronic
1023410506 7:39885222-39885244 GGCTGGGGTAGGAGAGCAGGAGG + Intergenic
1023811721 7:43917091-43917113 GGCTTGGGATTGAGCTCAGCAGG + Intronic
1023827629 7:44020023-44020045 GGCTGAGGCTGGAGGACTGCTGG - Intergenic
1024004682 7:45216738-45216760 TGCAGGGGATGCAGGGCAGTGGG + Intergenic
1024042115 7:45563937-45563959 GGCTGGAGACAGAGGGCAACTGG + Intergenic
1024049407 7:45609327-45609349 GGCTGGGGATGGAGAGGAGGCGG + Intronic
1024715869 7:52078610-52078632 TGCTTGGGATGGAGAGCAGCAGG - Intergenic
1024799065 7:53054951-53054973 GGCTGGGGATGGGAGGCTGGGGG + Intergenic
1025113888 7:56241447-56241469 GGCGGGGGAGGGAGAGCACCAGG - Intergenic
1025139097 7:56448051-56448073 GGGTGGGGCTGGGCGGCAGCCGG - Intergenic
1025187583 7:56873281-56873303 TGCTCAGGATGGAGAGCAGCAGG + Intergenic
1025684341 7:63703645-63703667 TGCTCAGGATGGAGAGCAGCAGG - Intergenic
1026019123 7:66694483-66694505 GGCGGGGCCTGGAGGGCAGTGGG + Intronic
1026440328 7:70438394-70438416 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1026828312 7:73597132-73597154 GCCTGGGGAGGGAGGCCAGGGGG - Intronic
1026834373 7:73628311-73628333 GGCTGGGGAAGGAGGGATGTTGG - Intergenic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1027137190 7:75633008-75633030 GGGTGGGGAGGGAGAGCATCAGG + Intronic
1027239226 7:76316499-76316521 GGCTGAGGTAGGAGGGTAGCTGG - Intergenic
1027277107 7:76568491-76568513 GGCTGAGCATGTGGGGCAGCAGG + Intergenic
1028311413 7:89342610-89342632 GGCTGGAAGTGTAGGGCAGCAGG - Intergenic
1028477133 7:91264966-91264988 GGCTGGCGGAGGAGGGCAGCGGG + Exonic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028869678 7:95755697-95755719 GGCTGGGGATGCAGTGCAGTGGG + Intergenic
1029268790 7:99363773-99363795 GGCTGAGGTGGGAGGGCTGCTGG - Intronic
1029382281 7:100221867-100221889 AGCTGTGGAAGGAGGGCATCAGG - Intronic
1029402439 7:100354316-100354338 AGCTGTGGAAGGAGGGCATCAGG - Intronic
1029610576 7:101624515-101624537 GGCTCCGGAAGGTGGGCAGCCGG + Intronic
1029677447 7:102080122-102080144 GCCTTGGGAAGGACGGCAGCCGG - Intronic
1029738806 7:102479792-102479814 GGCTGAGGCTGGAGGACTGCTGG - Intergenic
1029755931 7:102573448-102573470 GGCTGAGGCTGGAGGACTGCTGG - Intronic
1029773872 7:102672520-102672542 GGCTGAGGCTGGAGGACTGCTGG - Intergenic
1030191087 7:106810769-106810791 GGGTGGGGTTGGAGGGCAAGAGG - Intergenic
1030454848 7:109760470-109760492 GGCTGGGGGTGGGGGGTTGCTGG + Intergenic
1032027330 7:128454503-128454525 GGTTGGGGCTGGAGGTCTGCTGG - Intergenic
1032068639 7:128790993-128791015 GGCGGGGGAGGGAGGGAAGGAGG + Intronic
1032254747 7:130288170-130288192 GGCTGAGGCGGGAGGGCTGCTGG - Intronic
1032504340 7:132424359-132424381 GGCTGAGGAGGGAGCTCAGCTGG + Intronic
1032525688 7:132577052-132577074 GGCCGGGGCTGGGGGGCCGCGGG + Exonic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1033448795 7:141444757-141444779 GGCTGGGGATGCAAGAAAGCAGG - Intronic
1034124453 7:148658431-148658453 GGGTGAGCATGGAGGACAGCTGG + Intergenic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034437129 7:151068060-151068082 GGCGGGAGGTGGAGGGGAGCGGG - Intronic
1034439181 7:151077822-151077844 GGCTGGAGAGGCAGGGGAGCAGG - Intronic
1034516081 7:151580785-151580807 GGCTGGGAAGGGAGGGTAGTGGG + Intronic
1034676949 7:152898716-152898738 AGCCGGGGGTGGGGGGCAGCTGG + Intergenic
1034691764 7:153019708-153019730 GGTCGGGGGAGGAGGGCAGCAGG - Intergenic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1035003257 7:155634169-155634191 GGCTGGGGAGTGAGGGCAGGAGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035732008 8:1860126-1860148 GGCTGGAGTAGGCGGGCAGCAGG - Exonic
1035908653 8:3541381-3541403 AGCTGGGGAGGGAGAGCATCAGG + Intronic
1035918170 8:3648051-3648073 GGTTGGAGATGGAGGACAGATGG + Intronic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036214153 8:6865238-6865260 GGGTGGGGATGGAGCCCCGCTGG + Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1036663798 8:10726059-10726081 GGCAGGAGATGGGGGACAGCCGG + Exonic
1036756754 8:11476298-11476320 GACTGGGGATGGGGGAAAGCCGG - Intergenic
1036944347 8:13080654-13080676 GGCAGGGGAGGGAAAGCAGCTGG + Intergenic
1037164707 8:15812628-15812650 TACTGGGGATGGAGGACAGTGGG + Intergenic
1037308473 8:17530175-17530197 GACCGGGGATGGGGGGCAGGGGG - Intronic
1037493017 8:19413290-19413312 GGCTGAGGATGCTGGGCAACAGG - Intronic
1037562082 8:20084211-20084233 AGCTGGGGACAGAGAGCAGCTGG - Intergenic
1037805675 8:22056926-22056948 AGCTGGCGAAGGAGGGGAGCTGG - Intronic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1038447324 8:27612951-27612973 GGCGGGGGGTGGGGGGCAGGGGG + Intronic
1038727416 8:30094215-30094237 GACTGGGGATGGAGGGATGGAGG + Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039470410 8:37809877-37809899 GCCTGGGGAGGGATGGGAGCCGG + Intronic
1039476438 8:37841603-37841625 GGCGGGGCATGGGGGGCCGCGGG - Exonic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039793429 8:40893084-40893106 TGCTGGAGATGGAGAACAGCTGG + Intronic
1040300863 8:46187346-46187368 GGGTGGTGTTGGAGGGCTGCAGG - Intergenic
1040310985 8:46236743-46236765 GCCTGGGGAGGGGGGGCTGCTGG + Intergenic
1040655867 8:49506765-49506787 GGCTGAGGCTGGAGGGTAGCTGG - Intergenic
1040848143 8:51867804-51867826 GGCTGGGGCAGGAGGGTAGATGG + Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1043676576 8:82963464-82963486 AATTGGGGATGCAGGGCAGCAGG + Intergenic
1043816052 8:84802884-84802906 GGCTGGGAATGGAATGCAGAGGG + Intronic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1044750492 8:95411167-95411189 GGCAGGGGAAGGAGGACAGAAGG - Intergenic
1045305103 8:100951555-100951577 GGGTGGGGATGGATCGCGGCCGG + Intronic
1045404230 8:101849208-101849230 GGATGGGGAGGGAGAGCATCAGG + Intronic
1045622761 8:104001678-104001700 GGATTGGGATGGAGGTCAGAGGG - Intronic
1046654061 8:116874249-116874271 GGCTGCGGAGGGAGGGGAGGAGG - Intronic
1047121230 8:121907842-121907864 GGCTGGGGAGGGAGGTCCCCCGG - Intergenic
1047646902 8:126879062-126879084 GGATGGGGTTGGAGGGGAGTGGG - Intergenic
1047683857 8:127283600-127283622 GAATGTGGATGGAGGCCAGCTGG + Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048336182 8:133504107-133504129 AGGTGGGGAGGGAGGGCATCTGG + Intronic
1049015741 8:139918805-139918827 GTTTGGAGAGGGAGGGCAGCTGG - Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049360853 8:142212000-142212022 GGATGGGAATGGAGGCCAACAGG - Intergenic
1049377924 8:142297897-142297919 GGCGCGGGACGGAGGGCGGCGGG - Intronic
1049491465 8:142905475-142905497 TGCTGGGGATGGAGGGTCACTGG - Intronic
1049493008 8:142914974-142914996 GGATGGGGATGGAGGACTGAAGG - Intronic
1049541517 8:143211256-143211278 CGCGGGGGAGGTAGGGCAGCAGG + Intergenic
1049584759 8:143427787-143427809 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1049603206 8:143517628-143517650 GGCTGGGGCTGCAGGCCAGTGGG - Intronic
1049674368 8:143883239-143883261 GGCAGGGGATGAAGCTCAGCTGG - Intergenic
1049812753 8:144582793-144582815 GGCTGGTGGTGGAGGGCTGCAGG + Intronic
1049818246 8:144618599-144618621 GCCTGGGGATGGAGGGCGCATGG - Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050259420 9:3825895-3825917 TGCTGAGGAAGGAGGGCTGCAGG + Intronic
1050495276 9:6234425-6234447 GACTGGGGATGAGGGGAAGCAGG - Intronic
1050961834 9:11743669-11743691 GACTAGGTATGGAGGGCAGGGGG + Intergenic
1051371968 9:16366416-16366438 GGCTGGGGAAGGGGGACACCAGG - Intergenic
1051737224 9:20213032-20213054 GGGTGGGGAGGGAGAGCATCAGG + Intergenic
1051985934 9:23086940-23086962 GGCTGGGGATGGATAGCATTAGG + Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052824938 9:33167477-33167499 GCCTCGGGAGGGTGGGCAGCGGG + Intergenic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1053424104 9:37999914-37999936 GGCTGGGGGTAGAGGGCATGGGG - Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1054449918 9:65398224-65398246 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449928 9:65398242-65398264 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449938 9:65398260-65398282 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449948 9:65398278-65398300 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449958 9:65398296-65398318 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449968 9:65398314-65398336 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449978 9:65398332-65398354 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449988 9:65398350-65398372 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054449998 9:65398368-65398390 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054450008 9:65398386-65398408 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054450018 9:65398404-65398426 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054450028 9:65398422-65398444 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054450038 9:65398440-65398462 GGCGGGGGAGGGAGGGGAGGCGG + Intergenic
1054460471 9:65459576-65459598 GGCTGGAGAAGCAGGGCAGAGGG + Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1055364338 9:75527108-75527130 GGCTGGGGAGGGTTGGGAGCAGG + Intergenic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055530532 9:77178300-77178322 GGCTGGGGAAGCAAGGAAGCGGG - Intronic
1056078216 9:83062837-83062859 GGATGGGGACGGAGAGGAGCTGG - Exonic
1056586515 9:87930987-87931009 ATCTGGGGCTGTAGGGCAGCTGG + Intergenic
1056610363 9:88121955-88121977 ATCTGGGGCTGTAGGGCAGCTGG - Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1057204029 9:93160052-93160074 GGACAGGGAGGGAGGGCAGCAGG + Intergenic
1057505114 9:95627334-95627356 GGCTGGGGAGGGAGGGGACCAGG - Intergenic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1057768543 9:97945490-97945512 GTCTGGGGGTGGGGGGCAGGGGG - Intergenic
1057775775 9:98008116-98008138 GGCTGGGGACGGAGAGCATCAGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057938332 9:99259038-99259060 GGCTGGGGGTGGGGCGCAGGGGG - Intergenic
1057949258 9:99356752-99356774 GGCCGGGGACAGAGGGCAGGTGG + Intergenic
1058113445 9:101056986-101057008 GGCTGGGGACACAGGGCAGAGGG - Intronic
1058418997 9:104817192-104817214 GGCTGGGGCTGGGTGGCTGCGGG - Intronic
1058691694 9:107525525-107525547 GGTTGGGGATGGGGGGCGGTTGG + Intergenic
1058703613 9:107621006-107621028 GACCGGGGCTGGAGCGCAGCCGG - Intergenic
1058878400 9:109265066-109265088 AGCTGGGGATTGGGAGCAGCTGG - Intronic
1058968889 9:110062230-110062252 GGGTGGGGAGGGAGAGCATCAGG - Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059268940 9:113060602-113060624 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059270076 9:113066051-113066073 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059271210 9:113071499-113071521 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059272343 9:113076945-113076967 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059273478 9:113082387-113082409 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059274614 9:113087833-113087855 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059344186 9:113616998-113617020 GGCCGTGGTTGGAGGGCAGGGGG - Intergenic
1059351152 9:113665920-113665942 GGCTGGGGACGAAGGGTACCTGG - Intergenic
1059381946 9:113933821-113933843 GGCTGGGGAGGGATAGCAGTGGG + Intronic
1059743913 9:117181955-117181977 GGGTGGGGAAGGAGGGCACTGGG - Intronic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1059961582 9:119570127-119570149 GGCGGGGGAGGGAGAGCATCAGG + Intergenic
1060124060 9:121024338-121024360 GGGAGGGGAGGGAGGGGAGCGGG + Intronic
1060389521 9:123267340-123267362 TGATGGGGATGGAGAGCAGGAGG - Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060666693 9:125436050-125436072 GGCTGGGGATGCAGGGCTACAGG + Intergenic
1060736455 9:126069560-126069582 AGCTGGGGGCGGAGGGGAGCCGG - Intergenic
1060807700 9:126587984-126588006 GGCGGGGGATGGAGGGGGCCAGG + Intergenic
1060819589 9:126653743-126653765 GGCTGGGGATGAAGGGTGGGAGG - Intronic
1060879669 9:127109120-127109142 GGCTGGGGAGGGGAGGCAGAGGG + Intronic
1060913104 9:127366464-127366486 ACCTGGGGATGCAGGGCAGCAGG - Intronic
1060949086 9:127589367-127589389 GGGGGGTGAAGGAGGGCAGCTGG + Intergenic
1061077052 9:128348088-128348110 GGAAGGGGATGGAGGGCCACTGG + Intronic
1061188281 9:129067849-129067871 GGCTGGAGCTGGAGGGCCGAGGG + Exonic
1061261994 9:129485493-129485515 GGATGGGGAGGGAGGAGAGCTGG + Intergenic
1061324230 9:129853133-129853155 GGCTGGGGAGGGTGGGCACAGGG - Intronic
1061617280 9:131788567-131788589 TGCTGGGGATGCCGAGCAGCTGG + Intergenic
1061716366 9:132520900-132520922 GGGTAGGGATGGAGGACTGCGGG - Intronic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061883489 9:133579333-133579355 GGTTGCGGTTGGAGTGCAGCGGG + Exonic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062018364 9:134303802-134303824 GGCTGAGGACGGAGGTGAGCAGG - Intergenic
1062020386 9:134316541-134316563 GGCAAGGGGTGGAGGGCAGAGGG - Intergenic
1062062130 9:134502374-134502396 AGCTGGGGTTGGGGGGCTGCCGG - Intergenic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062159920 9:135074597-135074619 GGCCAGGGAAGGAGGGCACCAGG + Intergenic
1062287014 9:135777840-135777862 AGCTGGGAATGGAGAGTAGCTGG - Intronic
1062321929 9:135994361-135994383 GGCTTGGAAGGGAGGGCAGGCGG + Intergenic
1062405173 9:136392803-136392825 GGCTGGGGCACGAGGGCTGCGGG + Intronic
1062423398 9:136494903-136494925 GGCAGGGGCTGGAGGGAGGCGGG - Exonic
1062477325 9:136735206-136735228 GGTTGGGGACGAAAGGCAGCAGG - Intergenic
1062493921 9:136822639-136822661 GATGGGGGAGGGAGGGCAGCTGG - Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062573086 9:137194485-137194507 GGCTGGGCCTGGAGGGCTTCGGG - Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062646484 9:137550926-137550948 CGCTGGGGAGGGGGTGCAGCTGG + Intergenic
1062646507 9:137550979-137551001 CGCTGGGGAGGGGGTGCAGCTGG + Intergenic
1062646530 9:137551032-137551054 CGCTGGGGAGGGGGTGCAGCTGG + Intergenic
1062646568 9:137551139-137551161 CGCTGGGGACGGGGTGCAGCTGG + Intergenic
1203429575 Un_GL000195v1:79186-79208 GGGAGGGGAAGGAGAGCAGCAGG + Intergenic
1185505643 X:630869-630891 GGCCGGGGCTGGCGAGCAGCCGG - Exonic
1185646500 X:1619416-1619438 GGCTGGGGAGGGAGAGCACTAGG + Intronic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1187470087 X:19561956-19561978 GGTTGGAGTTGGAGGTCAGCAGG - Intronic
1187471816 X:19576676-19576698 GGCTGAGGCTGGAGGACTGCTGG - Intronic
1188053997 X:25520766-25520788 GGTAGGGGAGGGAGGGCATCAGG + Intergenic
1189422445 X:40868190-40868212 GGCTGGGGAGGGTGGGGAGATGG - Intergenic
1189728263 X:43990677-43990699 GGCAGGGGAGTGAGGGAAGCAGG - Intergenic
1189818061 X:44844174-44844196 AGCTGTAGATGGAGGGCTGCTGG - Exonic
1189988103 X:46571597-46571619 GGCGGGGGGTGGGGGGAAGCGGG + Intergenic
1190337297 X:49270127-49270149 GGATGGGGATGAAGGGGAGGAGG + Exonic
1190362768 X:49665065-49665087 GGTTGGCGATGAAGGGCAACGGG - Intergenic
1191053889 X:56222702-56222724 GGCAGGGCATGGCGGGCTGCAGG + Intergenic
1191874007 X:65775824-65775846 GGCTGGGGGTAAAGGGCAGTGGG - Intergenic
1192149223 X:68701635-68701657 GGGTGGGGAGGGAGTGCAGGAGG + Intronic
1192451013 X:71244941-71244963 GGGTGGGGCAGGAGGGCTGCAGG - Intronic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1192608370 X:72543384-72543406 GGCTGTGGCTGGAGAGCAGGTGG + Intronic
1193335872 X:80288180-80288202 GGCTGGGGATGGAAAAGAGCTGG + Intergenic
1194388976 X:93292812-93292834 GCCTGGGGCTGGAGGACAGGTGG - Intergenic
1195001157 X:100644603-100644625 GGCTGGGGGTGGAGGTCGGGGGG + Intronic
1195144587 X:102000360-102000382 GGCTGGGGTTGGATACCAGCAGG - Intergenic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1195728039 X:107937184-107937206 GGCGGGGGACGGAGGGCGGAGGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197252418 X:124229619-124229641 GGGTGGGGATAGAGAGGAGCAGG + Intronic
1197520726 X:127492727-127492749 GGCTGGGGATGGAAGAGAGGTGG + Intergenic
1197579614 X:128264797-128264819 GGTAGAGGATTGAGGGCAGCAGG + Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198360405 X:135889761-135889783 GGTAGGGGGAGGAGGGCAGCAGG - Intronic
1198373639 X:136015989-136016011 GGATGGGGCAGGCGGGCAGCAGG + Intronic
1198469325 X:136931277-136931299 GGTGGGGGGAGGAGGGCAGCAGG + Intergenic
1198469920 X:136936607-136936629 GGTAGGGGGAGGAGGGCAGCAGG + Intergenic
1199673236 X:150163835-150163857 GGCTGGGGGTGCAAGGGAGCAGG + Intergenic
1199712046 X:150476576-150476598 GGATGTGGATGGAGGCCAGTTGG + Intronic
1199832930 X:151562792-151562814 GGCTGGGGTGAGGGGGCAGCGGG + Intergenic
1199992152 X:152993364-152993386 GGGTGGGGATTGGGGGGAGCAGG - Intronic
1200060637 X:153482280-153482302 GGCTGGGGTTGGGGGCCTGCTGG - Intronic
1200091344 X:153637536-153637558 ACCCGGGGATGGGGGGCAGCAGG + Intergenic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200247113 X:154532149-154532171 GGCTGGGGACAGAGCCCAGCGGG - Intronic
1200327020 X:155251354-155251376 GGCAGGGGAGGGAGAGCATCAGG + Intergenic
1200384983 X:155881398-155881420 GGCTCGGGACGGAGGGACGCGGG - Exonic
1200686722 Y:6265212-6265234 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1200989600 Y:9336128-9336150 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1200992269 Y:9356461-9356483 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1200994920 Y:9376739-9376761 GATTTGGGATGGCGGGCAGCAGG - Intronic
1201000097 Y:9465621-9465643 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1201002756 Y:9485931-9485953 GATTTGGGATGGCGGGCAGCAGG - Intronic
1201005413 Y:9506215-9506237 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1201008075 Y:9526544-9526566 GATTTGGGATGGCGGGCAGCAGG - Intergenic
1201063887 Y:10070602-10070624 GGCAGGGGATGGGGGACAGGTGG + Intergenic