ID: 927516404

View in Genome Browser
Species Human (GRCh38)
Location 2:23674370-23674392
Sequence AGGGCCCCAGCCTCATTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927516398_927516404 18 Left 927516398 2:23674329-23674351 CCAGAACTTGGGGTCTGAGTCTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG 0: 1
1: 0
2: 2
3: 13
4: 252
927516403_927516404 -5 Left 927516403 2:23674352-23674374 CCTCTGAAGGAGGATGTCAGGGC 0: 1
1: 0
2: 1
3: 23
4: 170
Right 927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG 0: 1
1: 0
2: 2
3: 13
4: 252
927516397_927516404 19 Left 927516397 2:23674328-23674350 CCCAGAACTTGGGGTCTGAGTCT 0: 1
1: 0
2: 1
3: 15
4: 233
Right 927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG 0: 1
1: 0
2: 2
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927516404 Original CRISPR AGGGCCCCAGCCTCATTCAG CGG Intronic
900404956 1:2488767-2488789 AGGACCCCAGGGCCATTCAGAGG + Intronic
900496443 1:2978101-2978123 AGGGCCCCAGCTTAAGTCATGGG + Intergenic
900643728 1:3699294-3699316 TGGGCCCCAACCTCACCCAGGGG - Intronic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
901164324 1:7206952-7206974 AGTGCCCCTCTCTCATTCAGTGG + Intronic
901687045 1:10948730-10948752 AGGTCCCCAGCCTCCCCCAGGGG - Exonic
903049730 1:20591591-20591613 AAGGCTCGAGCCTCATCCAGTGG + Intronic
904610796 1:31725245-31725267 AGTGCCCCAGCCTCCTTCCTGGG + Intergenic
907734134 1:57095240-57095262 AGGGCGCTTGCCTCACTCAGTGG - Intronic
909715348 1:78701403-78701425 AGGGCCCCAGATTTATTCTGTGG + Intergenic
912066878 1:105755769-105755791 GGGTCCCCAGACTCATTCTGTGG + Intergenic
912560275 1:110546575-110546597 AAGGCCCCAGCATCATTGAAAGG - Intergenic
913172200 1:116243132-116243154 AGGGCACCATCCTCTTTCAAAGG + Intergenic
921902309 1:220463477-220463499 AAGGCCCCACCCTCAGGCAGTGG + Intergenic
922721801 1:227903464-227903486 AGGGACACAGCCTCACTCTGGGG + Intergenic
922874459 1:228929057-228929079 AGAGCCCCAGCCTCTAGCAGTGG + Intergenic
1063600269 10:7474661-7474683 CGGGCCCCAGCCTCACTCACAGG + Intergenic
1063765740 10:9138085-9138107 AGGGATTCAGCCTCTTTCAGTGG + Intergenic
1066227874 10:33402351-33402373 AAGCCCCCAGCATCAATCAGAGG + Intergenic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067852501 10:49762492-49762514 AGGGCCTCAGCCCCGTTCTGCGG - Intergenic
1068623039 10:59207906-59207928 AGGGCAGCAGCCCCAGTCAGGGG + Intronic
1070627477 10:78061604-78061626 AGAGCCCCAGCTTCTCTCAGAGG - Intergenic
1071487750 10:86114090-86114112 GAGGCCCCACCCTCCTTCAGGGG - Intronic
1073032237 10:100536004-100536026 AGGGCTCCAGCCTCCTCCCGGGG - Exonic
1073698164 10:105893913-105893935 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1074992828 10:118725975-118725997 AGGGCGTCAGCCTCAGTCAAGGG - Intronic
1075919518 10:126198646-126198668 AGGCACTCAGCCTCATCCAGAGG - Intronic
1076887126 10:133268017-133268039 GGGGCTCCAGCCCCATCCAGGGG - Exonic
1077043338 11:534101-534123 AGGGCCACAGCACCATGCAGGGG + Intronic
1078852007 11:15172539-15172561 AGGGCCTCTGCATCCTTCAGTGG - Intronic
1080826391 11:35852504-35852526 TGGGCCCCTGCCTTATTTAGGGG + Intergenic
1083689518 11:64398629-64398651 AGGGCCCCACCCTCATGAATGGG + Intergenic
1084274794 11:68045838-68045860 AGGGGCCCTGCCTCATCCAGTGG - Intronic
1084665858 11:70575864-70575886 AGGGCCCCAGCCTAGCTCCGAGG - Intronic
1084972298 11:72778556-72778578 AGGGTCCCAGCCTCCTTCCTGGG + Intronic
1088783034 11:113154851-113154873 AGACCCCCAGTGTCATTCAGGGG - Intronic
1089186266 11:116617281-116617303 CAGGTCCCTGCCTCATTCAGGGG + Intergenic
1090513374 11:127398989-127399011 AGGTCCCCAGCCTGATTCCTGGG - Intergenic
1091280516 11:134379324-134379346 AGGGCCCCAGCCTACTGAAGAGG - Intronic
1091549549 12:1527594-1527616 AGGCCCCCATCCACACTCAGAGG - Intergenic
1092154724 12:6274709-6274731 GGGGCCATAGCCTCACTCAGGGG + Intergenic
1096741585 12:53697464-53697486 AGGGCCTCAGCTTCCTTCTGCGG + Intergenic
1099744945 12:86689970-86689992 AAGGCAGCAGCCTCAATCAGGGG - Intronic
1100281709 12:93124714-93124736 AGGGCTCCAGCCTCCTTCTTGGG - Intergenic
1101830552 12:108253305-108253327 AGGGACCCAGCCTCCTCCGGAGG + Intergenic
1102898382 12:116616853-116616875 AAGGCCCTTTCCTCATTCAGTGG + Intergenic
1102957905 12:117071420-117071442 AGGCCCACAGCCTCCTTCTGGGG - Intronic
1103009579 12:117448012-117448034 AGGGACCCAGCCCCAACCAGAGG + Intronic
1103129301 12:118452954-118452976 AGAGCCCCGGCCTCCTACAGTGG + Intergenic
1104104162 12:125643192-125643214 AGGGCCCCCACCTCAACCAGTGG - Intronic
1104115568 12:125746200-125746222 AAGGCAGCAGCCCCATTCAGGGG - Intergenic
1104801131 12:131555916-131555938 AGGGCCTCAGCCTGACCCAGGGG + Intergenic
1105552441 13:21410515-21410537 AAGGCAGCAGCCTCAGTCAGGGG - Intronic
1106561604 13:30851500-30851522 AGGGCTCCATCCTCATGCATGGG - Intergenic
1108304635 13:49118839-49118861 AAGGCTCCAGCCCCAGTCAGGGG + Intronic
1108767710 13:53653275-53653297 AGGGCCCCAACCTTATTTTGAGG + Intergenic
1109578099 13:64288615-64288637 AGGGGGCCAGCAGCATTCAGTGG - Intergenic
1110824722 13:79958606-79958628 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1115910355 14:38249786-38249808 AGGGCCTCAGTGTCACTCAGAGG - Intergenic
1116369882 14:44116820-44116842 AGGGCTCTAGTCTCATTCAGAGG + Intergenic
1119886338 14:78146113-78146135 AGGGCACAACCCTCATTTAGAGG - Intergenic
1120073986 14:80135017-80135039 AGGGCTCCACCCTCATTAATGGG - Intergenic
1120770150 14:88370353-88370375 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1122757191 14:103990964-103990986 AAGGCCCCATGGTCATTCAGGGG - Intronic
1122869907 14:104633770-104633792 AGGGCCTCAGGCTAAGTCAGGGG - Intergenic
1122953846 14:105060884-105060906 CGGGCCCCAGCCGCAGGCAGAGG + Intronic
1124661350 15:31553291-31553313 AGGGCCCCAGCCTGAGTCTTTGG + Intronic
1127227532 15:56948646-56948668 CAGGCCCCAGCTTCATTCTGAGG - Intronic
1129069944 15:72942439-72942461 AGGGCTCCAGCTTCATTAATGGG - Intergenic
1129217168 15:74107082-74107104 AGGGCCCTGGCCTCCTGCAGGGG + Intronic
1129241307 15:74253769-74253791 AGAGCACCTGGCTCATTCAGAGG + Intronic
1129303789 15:74643513-74643535 ACAGCCTCAGCCTCATGCAGTGG - Intronic
1129874256 15:78962316-78962338 AGGGCCCAAGCCTCTTACTGTGG + Intronic
1131535256 15:93232094-93232116 AGGACTCCAGCCTCCTGCAGTGG - Intergenic
1132111930 15:99107809-99107831 GGGGTCCCAGCCTCACTCTGAGG - Intronic
1132384847 15:101393071-101393093 AGGGTCCCAGCCTCACCCATCGG - Intronic
1132612191 16:822701-822723 AGGGCCCGAGCGTCCTCCAGGGG - Intergenic
1132613908 16:831102-831124 GGGGCCCCAGCCTCTGGCAGGGG - Intergenic
1132888033 16:2191011-2191033 AGGGCCCCAGCGTCCTCCTGGGG + Intronic
1134056961 16:11176366-11176388 AGGACCAAAGCCTCATGCAGTGG + Intronic
1134387172 16:13784251-13784273 AGGGCACTAATCTCATTCAGAGG + Intergenic
1136104159 16:28017180-28017202 AGGACCCCAGCATCATTCTGGGG + Intronic
1139384458 16:66556082-66556104 AGAGACCCAGACTCATTGAGTGG + Intronic
1139661330 16:68422937-68422959 ACAGCCCCAGCCTGATTTAGAGG + Intronic
1141246079 16:82309068-82309090 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
1141481133 16:84307739-84307761 GGCGCCCCAGCCTCCTTCGGAGG - Intronic
1144837045 17:18161944-18161966 GGGGCCCCAGCCTCCTTCTTAGG - Intronic
1144959582 17:19037580-19037602 AGGGCACCAATCCCATTCAGGGG - Intronic
1146671551 17:34741387-34741409 AGGATCCCAGCCTGAGTCAGGGG - Intergenic
1147325333 17:39667215-39667237 AGGGCCCGGGACTCATCCAGAGG + Intergenic
1147525296 17:41216652-41216674 AAGGCAGCAGCCCCATTCAGGGG + Intronic
1147747314 17:42702744-42702766 AGGGACACAGCCTTATTCACCGG + Intronic
1147791007 17:43014283-43014305 AGGCCCCTAGCCTGACTCAGAGG - Exonic
1147818023 17:43224213-43224235 AGGTCACCAGCCTACTTCAGCGG - Intergenic
1148205280 17:45775875-45775897 AGGGCCCCTGCCAGACTCAGTGG - Intergenic
1150907340 17:69351912-69351934 AGGGCTCCAGCCTCGGTCATTGG - Intergenic
1151006933 17:70448768-70448790 AGGGCCCCATCCTCATGAATGGG - Intergenic
1151166891 17:72211555-72211577 AGGGCTCCAGCTTCATTCTTGGG + Intergenic
1151515130 17:74588895-74588917 AGGGCCACAGCCTCGTGCATTGG + Intronic
1151887517 17:76931935-76931957 GGGGCCTCAGCCTCAAACAGGGG + Intronic
1154068308 18:11129898-11129920 GGGTCCCCAGCCTCATCCTGTGG + Intronic
1154287484 18:13073762-13073784 AGGGCTCCAGCCCCATGCACGGG - Intronic
1155627693 18:27853728-27853750 AGGGCCACGTCCTCATTGAGGGG - Intergenic
1157572655 18:48723313-48723335 AGGGCTGCTGCCTCATTCAAAGG + Intronic
1157688791 18:49664252-49664274 GGGGCCCAGGCCTCAGTCAGGGG + Intergenic
1159965287 18:74589100-74589122 GGGGCCACACCTTCATTCAGAGG + Intergenic
1160836032 19:1124810-1124832 TGGGCCACAGACTCATCCAGAGG - Intronic
1163028607 19:14529005-14529027 TGAGCCCCAGCCCCATTCTGGGG - Intronic
1164446559 19:28322663-28322685 AGGGCCTCAACTTCAGTCAGTGG - Intergenic
1165059794 19:33199556-33199578 AGCAGCCCAGCCTCATGCAGAGG - Intronic
1165748987 19:38248566-38248588 GGGGCCCCAACTTCAGTCAGTGG + Intronic
1166697261 19:44859173-44859195 AGGGCACAAGCCTCATTTCGAGG - Intronic
1166868334 19:45854592-45854614 AGGGCCCAAGCCTCCTTCCCAGG + Intronic
924985912 2:269780-269802 AGGGGCCCTGCCTCATTCCTGGG + Intronic
925160994 2:1684022-1684044 AGAGCCCAAGCCTCAGTCACTGG - Intronic
925930759 2:8706064-8706086 AGGGCCCCAGCCTTTCTCACTGG + Intergenic
927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG + Intronic
929424219 2:41827431-41827453 GGGGACCCAGCCTCATCAAGTGG - Intergenic
930097981 2:47581498-47581520 AGGGCCCCAGGCTCATTGGAAGG + Intergenic
930439927 2:51391991-51392013 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
931538498 2:63303611-63303633 AGGCCTCCAACCTCAGTCAGTGG - Intronic
932803265 2:74761669-74761691 AGGGCCCCATGCTCATTGTGAGG - Intergenic
933152057 2:78927471-78927493 ATGTCCCAAGCCTCATTCAGAGG - Intergenic
933166601 2:79083413-79083435 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
935848187 2:107189059-107189081 AGGGGCACAGTCTCTTTCAGGGG - Intergenic
936080568 2:109429907-109429929 AGTGGCCCAGCCCCAGTCAGCGG + Intronic
937277323 2:120693314-120693336 ATGGCCCCAGCATTAGTCAGTGG - Intergenic
938020986 2:127905672-127905694 AGTGCCTGAGCCTCACTCAGTGG - Intergenic
939670899 2:145010770-145010792 AGGGCACCTGCCTCATCTAGAGG - Intergenic
947458825 2:230284151-230284173 ATGGCCCAAGGCTCATGCAGAGG + Intronic
948057213 2:235017683-235017705 AGGGGCCCAGTGTCATTCACTGG + Intronic
948272503 2:236685474-236685496 ATGGGACCAGCCTCATTCAAAGG - Intergenic
948627027 2:239275682-239275704 AGGCCCCCAGCCTCACTCTGAGG - Intronic
948675854 2:239596202-239596224 AGGGGCTCAGCCTCACTCGGGGG - Intergenic
948789164 2:240368469-240368491 AGGGCACCAGTCCCATTCACGGG - Intergenic
948914976 2:241029962-241029984 TGGGCCCTGGCCTCAGTCAGTGG - Intronic
1168938822 20:1691359-1691381 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1169260413 20:4134414-4134436 AGGGGCCCTCCCACATTCAGAGG + Intronic
1170720414 20:18873057-18873079 AGGGCAACAGCCCCAGTCAGGGG - Intergenic
1170791250 20:19511244-19511266 AGGGCCCCAGCCTAAGGCATGGG + Intronic
1171409128 20:24934438-24934460 AGGGCCCCAGCCAGGTTCTGTGG - Intergenic
1173618055 20:44415789-44415811 TTGTCCCCAGCCTCATACAGGGG + Intronic
1176297700 21:5083006-5083028 ATGGCCCCAGCCTCAGGGAGGGG + Intergenic
1177136409 21:17309101-17309123 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1179477742 21:41658746-41658768 AGGGCCCCACCCTCATCCCTGGG - Intergenic
1179859329 21:44178943-44178965 ATGGCCCCAGCCTCAGGGAGGGG - Intergenic
1180098852 21:45574943-45574965 AGGGCCCCACCCCCAGGCAGAGG + Intergenic
1181139360 22:20792749-20792771 ATGGCCCCAGTCTCCTTCAGGGG - Intronic
1182887331 22:33786529-33786551 AGGTCCCCAACCTCCTTCTGAGG - Intronic
1183444487 22:37844132-37844154 AGGCCCTCAGCGTCAGTCAGCGG + Exonic
1183831032 22:40418482-40418504 AGGGCCCCAGCCTCATCAAGGGG - Exonic
1184522673 22:45004695-45004717 AACCCCCCAGCTTCATTCAGTGG + Intronic
1185338701 22:50282262-50282284 AGGGCTTCAGCCTGATCCAGAGG - Exonic
951254462 3:20432781-20432803 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
951839981 3:27023930-27023952 AGGGCCCCACCCTCATGAATGGG - Intergenic
952410531 3:33046160-33046182 AGGTCCCCAGCCTCACTCAGTGG + Exonic
952955657 3:38555771-38555793 AAGGCACCAACCTCATTCTGGGG + Intronic
953749274 3:45596733-45596755 AGAGCCCCTGCCTCAATCACTGG - Intronic
953982885 3:47421414-47421436 AGAGCCCAGGCCTGATTCAGGGG + Intronic
954377201 3:50201508-50201530 AGAGCCCCAGCAACATGCAGGGG + Intergenic
954439507 3:50514060-50514082 AGGACCCTTGCCTCATTCATGGG - Intergenic
954490589 3:50901131-50901153 AAGGCAGCAGCCCCATTCAGGGG - Intronic
954856182 3:53645905-53645927 AGGGCCACAGCATGAATCAGTGG + Intronic
956500898 3:69883959-69883981 AAGGCTACATCCTCATTCAGGGG + Intronic
959746164 3:109778445-109778467 GGGTCCCCAGACTCATTCTGTGG - Intergenic
959875721 3:111380020-111380042 AAGGCAGCAGCCTCAGTCAGGGG + Intronic
961826913 3:129603946-129603968 AAGGCCCCAGTGTCATTCTGGGG + Intronic
964391219 3:156200476-156200498 AAGGCACCAGCCCCAGTCAGGGG - Intronic
966533266 3:181004162-181004184 AAGGCAGCAGCCCCATTCAGGGG - Intergenic
969230427 4:5826695-5826717 AGGGTCCCAGCATGAGTCAGTGG + Intronic
969261286 4:6035798-6035820 AGTGCCCCAGGCTCATTCCAGGG - Intronic
969405657 4:6989758-6989780 AGAGCCCCAGTCTCATGCAGAGG - Intronic
969498698 4:7540362-7540384 AGGACCCCAGCCTTCTTCTGTGG + Intronic
971381580 4:26103486-26103508 CGGGCCCCATCCCCAGTCAGGGG + Intergenic
972896946 4:43634230-43634252 ATGACCCCACCCTCAATCAGAGG + Intergenic
976852860 4:89568241-89568263 AAGGCACCAGCCCCAGTCAGGGG - Intergenic
977623486 4:99164051-99164073 AGGGCACTGGCCTCATTGAGAGG - Intergenic
978966697 4:114749749-114749771 AGGTCCCCAGACTCATCCTGTGG + Intergenic
979819345 4:125151508-125151530 AAGGCAACAGCCTCAGTCAGGGG - Intergenic
980171259 4:129292596-129292618 AAGGCAGCAGCCCCATTCAGGGG - Intergenic
980495400 4:133584091-133584113 AGGGCCCCACCCTCAAGCATGGG + Intergenic
982815359 4:159877565-159877587 AAGGCAGCAGCCTCAGTCAGAGG - Intergenic
984012568 4:174388286-174388308 AGGGCTCCACCCTCATTAATGGG + Intergenic
984857520 4:184207722-184207744 AGGGCCCCAGCGTGCTGCAGAGG - Intronic
986699889 5:10396172-10396194 AGGGACCCTGTCTCATTCATAGG - Intronic
990171365 5:53053528-53053550 AGGGCCCCAGGCTCCTTCCAGGG - Intronic
990175153 5:53099640-53099662 AGGGGACCTGCCTCAGTCAGTGG - Intronic
990183735 5:53190990-53191012 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
993450077 5:88062193-88062215 AGAGCCACAGCATCACTCAGAGG - Intergenic
994291528 5:98033169-98033191 AGGTCCCCAGGCTCATCCTGTGG - Intergenic
994378109 5:99038089-99038111 AGGGCAGCAGCCCCAGTCAGGGG + Intergenic
994450079 5:99930057-99930079 GGGGCCACAGCCCCATGCAGTGG + Intergenic
998184288 5:139966970-139966992 AGGCCCCCAGCCTCCCCCAGTGG + Intronic
998972745 5:147610839-147610861 AAGGCAGCAGCCCCATTCAGGGG - Intronic
999144230 5:149381890-149381912 AGGACCCCAGCCTCACTCGTGGG - Intronic
999262578 5:150246895-150246917 CTGGCCCCAGCCCCAGTCAGAGG + Intronic
999705756 5:154271133-154271155 ACAGCCCCAGCCTCATTTACAGG - Intronic
1000590068 5:163147215-163147237 AGGGCAGCAGCCCCAGTCAGGGG + Intergenic
1000860389 5:166450184-166450206 AGGGCAGCAGCCCCAGTCAGGGG - Intergenic
1001141217 5:169145541-169145563 AGGGGCCCAGCCACATACATTGG + Intronic
1001362638 5:171103256-171103278 AGGGCAGCAGCCCCAGTCAGGGG - Intronic
1002303918 5:178272573-178272595 AGGGCCTCAGCCTCCATCACAGG + Intronic
1003172736 6:3733007-3733029 AGAGCCTCAGCCTCCTGCAGGGG - Intronic
1003593916 6:7457899-7457921 AAGGCCCCAGCCTCAATCCTGGG + Intergenic
1007419057 6:41708350-41708372 AGGGCCCCAGCCACATGCTCTGG + Intronic
1008425195 6:51348963-51348985 AGGGCAGCAGCCTCAGTCAGTGG - Intergenic
1012076957 6:94700612-94700634 AGGCCCCCATTCTCATTCACGGG - Intergenic
1013813007 6:114065798-114065820 GGGTCTCCAGCCTCATACAGGGG + Intronic
1013939624 6:115645634-115645656 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1014387034 6:120815850-120815872 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
1015170303 6:130244865-130244887 AGGGGCCCAGCATCATTCTATGG - Intronic
1018631928 6:165829104-165829126 ATGGCCCCAGCTTCATTCCCAGG + Intronic
1021222705 7:17991871-17991893 AGGGCCCCTGCATCATGTAGGGG + Intergenic
1021347639 7:19547897-19547919 AGGGCGGCAGCGTCAGTCAGGGG - Intergenic
1022058814 7:26770110-26770132 AAGGCAGCAGCCTCAGTCAGGGG - Intronic
1022257004 7:28668882-28668904 AGGGCCCCAGCCTCTGAAAGAGG - Intronic
1022615654 7:31927280-31927302 AAGGCGGCAGCCTCAGTCAGGGG + Intronic
1023004380 7:35847328-35847350 AGGGCCCCAGCATCCATCAGGGG + Intronic
1026998882 7:74637829-74637851 GGGGACCAAGCCTCATTCATTGG - Intergenic
1027505973 7:79017256-79017278 TGGGCCCCAGCTTTATTCTGTGG - Intronic
1027616791 7:80433785-80433807 AAGACCCCAGACTCAGTCAGTGG + Intronic
1028145845 7:87319171-87319193 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
1028385679 7:90250362-90250384 AGGGCCTCAGTTTCATTAAGAGG + Intronic
1029634687 7:101776144-101776166 GGAGCCCCAGTCTCCTTCAGGGG - Intergenic
1030985250 7:116233907-116233929 AGGGCTCCACCCTCATTGATGGG - Intronic
1032651007 7:133878576-133878598 AGGTCACAAGCCTCATCCAGGGG - Intronic
1033153700 7:138938088-138938110 AGGGCCCCACCCTCATGAACAGG + Intronic
1035756461 8:2036468-2036490 AGGGCCTCAGCCTTATCCTGGGG + Intergenic
1036002792 8:4626635-4626657 AGGGCGCCAGCTTGATTCTGAGG + Intronic
1039274943 8:35924994-35925016 AGGGAGCCAGCCTCAGTCTGGGG + Intergenic
1039350101 8:36754774-36754796 AGGGCCTCAGCGTCATTTGGAGG + Intergenic
1039490359 8:37942955-37942977 AGGGCCCCAGCTTCATTCTCTGG + Intergenic
1041654077 8:60331058-60331080 AGGGCTGCAGCCTCATTCAAAGG - Intergenic
1042197121 8:66240496-66240518 AGGGCCCCATCCTTATGCATGGG + Intergenic
1043036641 8:75207980-75208002 AGGGCAGCATCCCCATTCAGGGG - Intergenic
1044503602 8:92991237-92991259 AGGGCAGCAGCCCCAGTCAGGGG + Intronic
1045390617 8:101710749-101710771 AAGGCAGCAGCCCCATTCAGGGG + Intronic
1046047940 8:108986218-108986240 AGGGCAGCAGCCCCAATCAGTGG - Intergenic
1049411038 8:142474158-142474180 AGGGGCCCTGCCTCCCTCAGTGG - Intronic
1049488566 8:142879081-142879103 AGGGCTCCAGGCTCATCCTGTGG + Exonic
1052382306 9:27784861-27784883 AAGGCCGCAGCCCCAGTCAGGGG - Intergenic
1053070141 9:35096337-35096359 CGGGCCCCAGCCTCCTTGCGTGG - Exonic
1055711157 9:79063425-79063447 AGTGGCCCAGCATCAGTCAGGGG - Intergenic
1056752639 9:89363360-89363382 AGGGCACCTGCCACATCCAGTGG - Intronic
1059820172 9:117963753-117963775 GCTGCCCCCGCCTCATTCAGAGG - Intergenic
1060470347 9:123943146-123943168 AGGGCCCTGTCCCCATTCAGAGG - Intergenic
1061444954 9:130632408-130632430 AGGGCCCAAGCCCCACCCAGAGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062175411 9:135159365-135159387 AGGGCACCTCCCTCATTGAGTGG - Intergenic
1062371237 9:136239959-136239981 AGGGCACTGGCCTCATTCAACGG + Intronic
1186114638 X:6292663-6292685 ACGGGACCAGCCTCAATCAGAGG - Intergenic
1186630177 X:11340168-11340190 AGAGCCCCATCCTAATTCAATGG + Intronic
1186960914 X:14735890-14735912 AAGGCAGCAGCCTCAGTCAGGGG - Intergenic
1189680351 X:43509525-43509547 ATGGCCTCAGCCACATGCAGAGG - Intergenic
1191148080 X:57190059-57190081 AAGGCACCAGCCCCAGTCAGGGG - Intergenic
1191208132 X:57855470-57855492 AAGGCAGCAGCCCCATTCAGGGG + Intergenic
1192208865 X:69114403-69114425 ATGTTCCCAGCTTCATTCAGAGG - Intergenic
1192703137 X:73497695-73497717 AAGGCAGCAGCCCCATTCAGGGG - Intergenic
1193510050 X:82388562-82388584 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1193971740 X:88063645-88063667 AGTGCCCCATTCTCATGCAGAGG - Intergenic
1194752285 X:97698327-97698349 AGGGCTCCAGCCTCATGAATGGG - Intergenic
1195710515 X:107769762-107769784 AGGGCACCAGGCTCACTCATTGG + Intronic
1195985605 X:110626801-110626823 AAGGCAGCAGCCTCAGTCAGGGG + Intergenic
1198085659 X:133279416-133279438 AAGGCAGCAGCCCCATTCAGGGG + Intergenic
1200042054 X:153378047-153378069 AGGGCCCTAAGCTCATACAGGGG - Intergenic
1200707352 Y:6454214-6454236 AGGGCCCAACCATCATTCATAGG - Intergenic
1201026760 Y:9710494-9710516 AGGGCCCAACCATCATTCATAGG + Intergenic