ID: 927516909

View in Genome Browser
Species Human (GRCh38)
Location 2:23677184-23677206
Sequence GGCTGCACACCAGTGGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927516909_927516925 16 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516925 2:23677223-23677245 AGGCACGGAGGGGACCTCTGAGG 0: 1
1: 0
2: 0
3: 29
4: 212
927516909_927516921 1 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516921 2:23677208-23677230 TGGGTCAGGGGCTGTAGGCACGG 0: 1
1: 0
2: 3
3: 41
4: 335
927516909_927516918 -4 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516918 2:23677203-23677225 AGCCCTGGGTCAGGGGCTGTAGG 0: 1
1: 0
2: 1
3: 55
4: 499
927516909_927516922 4 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516922 2:23677211-23677233 GTCAGGGGCTGTAGGCACGGAGG 0: 1
1: 0
2: 1
3: 18
4: 222
927516909_927516923 5 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516923 2:23677212-23677234 TCAGGGGCTGTAGGCACGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 193
927516909_927516924 6 Left 927516909 2:23677184-23677206 CCCGCACCCACTGGTGTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 927516924 2:23677213-23677235 CAGGGGCTGTAGGCACGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927516909 Original CRISPR GGCTGCACACCAGTGGGTGC GGG (reversed) Intronic
900247925 1:1647666-1647688 GGCTGGTCACAAGTGGGTGGCGG + Intronic
900259151 1:1714821-1714843 GGCTGGTCACAAGTGGGTGGCGG + Intronic
900440374 1:2652118-2652140 GGATGCTCACCTGGGGGTGCAGG - Intronic
900440512 1:2652760-2652782 GGATGCTCACCTGGGGGTGCAGG - Intronic
900440736 1:2653883-2653905 GGATGCTCACCTGTGGGTGTGGG - Intronic
900441087 1:2655688-2655710 GGATGCTCACCTGGGGGTGCAGG - Intronic
900441516 1:2657896-2657918 GGATGCTCACCTGGGGGTGCAGG - Intronic
900441991 1:2660304-2660326 GGATGCTCACCTGGGGGTGCAGG - Intronic
900442882 1:2664920-2664942 GGATGCTCACCTGGGGGTGCAGG - Intronic
900443775 1:2669536-2669558 GGATGCTCACCTGGGGGTGCAGG - Intronic
900444304 1:2672306-2672328 GGATGCTCACCTGGGGGTGCAGG - Intronic
900444777 1:2674714-2674736 GGATGCTCACCTGGGGGTGCAGG - Intronic
900445206 1:2676962-2676984 GGATGCTCACCTGGGGGTGCAGG - Intronic
900445387 1:2677926-2677948 GGATGCTCACCTGGGGGTGCAGG - Intronic
900445918 1:2680696-2680718 GGATGCTCACCTGGGGGTGCAGG - Intronic
900446192 1:2682141-2682163 GGATGCTCACCTGGGGGTGCAGG - Intronic
900446806 1:2685272-2685294 GGATGCTCACCTGGGGGTGCAGG - Intronic
900447635 1:2689369-2689391 GGATGCTCACCAGGGGGTGTGGG - Intronic
900448308 1:2692739-2692761 GGATGCTCACCTGGGGGTGCAGG - Intronic
900450487 1:2747149-2747171 GGATGCTCACCAGGGGGTGTGGG - Intronic
900451781 1:2753691-2753713 GGATGCTCACCTGGGGGTGCAGG - Intronic
900480085 1:2894020-2894042 GGCTGCAGACCACTGATTGCTGG - Intergenic
901162770 1:7192655-7192677 CGCTGCCCGCCAGTGTGTGCTGG + Intronic
901618263 1:10559622-10559644 GGCTGTACACCGTTGGGTGGTGG - Intronic
901632830 1:10656227-10656249 GGCTGCCCGCCAGTGAGCGCGGG - Intronic
902000086 1:13185172-13185194 GGCTGCAGAACAGTGGATACTGG - Intergenic
902221427 1:14968383-14968405 GGCTGCACAGCAGGAGGTGAGGG - Intronic
904435197 1:30490462-30490484 GCCTGCAGTCCTGTGGGTGCTGG + Intergenic
907955067 1:59220539-59220561 TGCTCAATACCAGTGGGTGCAGG + Intergenic
910821947 1:91360268-91360290 GACTGCATACCAGTGGGTCTTGG - Intronic
910986395 1:93008754-93008776 GACTACACACCGGTGGGGGCAGG + Intergenic
915801193 1:158795057-158795079 GGCTCCCCACATGTGGGTGCAGG + Intergenic
917562667 1:176175605-176175627 GGCTGCACAGCAGGAGGTGAGGG - Intronic
917785071 1:178446320-178446342 TGCTGCTCAACAGTGTGTGCAGG - Intronic
919854944 1:201698787-201698809 GGCTGCACAGGAGTGGGAGTGGG + Intronic
920690997 1:208146164-208146186 GGCAACACACCAATGAGTGCAGG + Intronic
922010186 1:221575541-221575563 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
922467512 1:225854262-225854284 GGCTGGACAGCAGTGGGCGAGGG + Intronic
923195241 1:231660391-231660413 GACAGCACACCAGTGGGTCTTGG + Intronic
924285515 1:242481900-242481922 GGCTGCAGAACAGTGGATACTGG - Intronic
1065755303 10:28925165-28925187 GGCTGCGCACCAGAGGGAGGCGG + Intergenic
1066152911 10:32642649-32642671 GGTTGCAGGACAGTGGGTGCGGG - Intronic
1067049019 10:43001387-43001409 GGCAGCCTACCAGGGGGTGCAGG - Intergenic
1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG + Intronic
1068351081 10:55845942-55845964 GGCTGCACAATAGTGGGGACAGG + Intergenic
1069362846 10:67663136-67663158 GGCTTCACACCTGTGTGTTCAGG + Intronic
1069868481 10:71518859-71518881 GGCTTCACCCCACTGGGTGGAGG - Intronic
1072004531 10:91231570-91231592 GGCTGGACAGCAGTGAGTGAAGG + Intronic
1073578427 10:104642972-104642994 GGCTGCACAGCGCTGGGTGCCGG - Intronic
1074258800 10:111831407-111831429 GGCTGCAAACCAGTGCGGTCTGG + Intergenic
1074544477 10:114391959-114391981 GGCAGCTCACCAGTGGCTGTGGG - Intronic
1074706260 10:116134848-116134870 GTTTGCACAGCAGAGGGTGCAGG - Intronic
1076802366 10:132836486-132836508 GGCTCCAGGCCAGTGGGAGCTGG + Intronic
1076811650 10:132889370-132889392 GGCGGCACCCCATTGGATGCTGG + Intronic
1077119799 11:901666-901688 GGCTGCACACAGGCGTGTGCAGG - Intronic
1077508551 11:2943349-2943371 GGATGCACGCAGGTGGGTGCAGG + Intergenic
1077792946 11:5461246-5461268 GGCTGCAGGCCAGGGGGTGGAGG + Intronic
1078380495 11:10835677-10835699 GGCTGCACAGCAGGAGGTGAGGG + Intronic
1079174653 11:18128071-18128093 GGCTGCAGAACAGTGGATACTGG + Intronic
1082002421 11:47400367-47400389 GGCTGCCCACCTGGGGGGGCTGG - Intergenic
1083006330 11:59350158-59350180 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1083188889 11:61035434-61035456 GGCTGGGCACCAGGGGCTGCAGG + Intergenic
1083367144 11:62148279-62148301 GTGTGCACACCTGAGGGTGCAGG - Intronic
1083944228 11:65915270-65915292 GGCTGTGCACCAGGGGGTGAAGG + Intergenic
1084063173 11:66688769-66688791 CGCTGCGCACCAGTGGCTCCTGG + Exonic
1084569316 11:69949961-69949983 GGCTGCACGTGTGTGGGTGCTGG - Intergenic
1086481809 11:87247852-87247874 GGGTGCAGTACAGTGGGTGCAGG - Intronic
1087454881 11:98372354-98372376 GGCTGCACAGCAGAAGGTGAGGG - Intergenic
1089710783 11:120313019-120313041 GGCTGCAAACCAGGGAGTGAGGG + Intronic
1090391092 11:126387946-126387968 GGCTGCAAACCTATGCGTGCTGG - Intronic
1095483354 12:42658668-42658690 GGCTGCAGAACAGTGGGTATTGG + Intergenic
1096080560 12:48829694-48829716 GGAGGGACACCACTGGGTGCGGG - Intergenic
1101401811 12:104394550-104394572 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1103910024 12:124346906-124346928 GCCTCCACACCAGTGGGTTCTGG + Intronic
1104637772 12:130448730-130448752 GGCTGCACCCAGGTGGGGGCAGG - Intronic
1104869842 12:131987129-131987151 GGCTGCAGACTGGTGGCTGCAGG - Intronic
1104964753 12:132503905-132503927 AGCTGCTCTCCAGTGGGGGCAGG - Intronic
1105328384 13:19391150-19391172 GGCTGCACAACAGAAGGTGGGGG + Intergenic
1105351222 13:19617735-19617757 GGGTGCAGGACAGTGGGTGCGGG - Intergenic
1105863481 13:24438375-24438397 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1106019223 13:25899022-25899044 GGGTGCAAGACAGTGGGTGCAGG - Intronic
1106428559 13:29657632-29657654 AGCAGCACACCAGCGGGTGCAGG + Intergenic
1112761023 13:102693373-102693395 GCCAGCACACCACTGGGTGGTGG + Intronic
1112903970 13:104394420-104394442 GGCTGCAGCCCAGTGAGTGAAGG - Intergenic
1113949838 13:114065810-114065832 GGCTGCAACCCAGTGTGTGTGGG - Intronic
1114517283 14:23308177-23308199 GGATCCACAGCAGTGGGGGCTGG + Exonic
1114749229 14:25184248-25184270 GGCTGCAGAACAGTGGATGTTGG - Intergenic
1115321303 14:32082119-32082141 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1117798521 14:59419242-59419264 GGCTGCTCATGAGTGGGTGAGGG - Intergenic
1117839650 14:59846360-59846382 GGCTGCACAGATATGGGTGCTGG - Intronic
1119042256 14:71285617-71285639 GGCTGCAAACCAGGGGGTGCCGG - Intergenic
1119650343 14:76378611-76378633 GGCTGCTGCCCAGTGGGTCCTGG - Intronic
1121611318 14:95282798-95282820 GGCTGTAAGCCAGTGGGAGCAGG - Intronic
1122425944 14:101605287-101605309 TGCTGGTCACCAGTGGGTGGAGG - Intergenic
1124596691 15:31097195-31097217 GCCTGCCCTCCAGTGGGAGCAGG + Intronic
1124870967 15:33542147-33542169 GGTTTCTCACCAGTGGATGCTGG - Intronic
1125334976 15:38618064-38618086 GGCTGCACACCTGTGTCTGCTGG - Intergenic
1125761489 15:42098875-42098897 GACAGGCCACCAGTGGGTGCTGG + Intergenic
1125766893 15:42142195-42142217 CGCTCCACACCTGTGGGTGGGGG + Exonic
1129396133 15:75248068-75248090 GGCTGCACAGCTGTGTGTGGGGG + Intergenic
1129523874 15:76202001-76202023 GGCTGGACTGCACTGGGTGCTGG - Intronic
1129831319 15:78672799-78672821 GGCTGCACAACTGTGCGTGGGGG + Intronic
1130108864 15:80948976-80948998 GGCAGCAGACCAGTGGGGGATGG + Exonic
1130933286 15:88448111-88448133 CTCATCACACCAGTGGGTGCTGG + Intergenic
1131664166 15:94552360-94552382 GGCTGCACATAAGCGGGTGCAGG - Intergenic
1132033352 15:98457511-98457533 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1132148519 15:99443190-99443212 GGGGGCACAGCAGTGGGTACTGG + Intergenic
1132738766 16:1400501-1400523 GGATGCAGGCCAGTGAGTGCAGG + Intronic
1134128067 16:11630021-11630043 CGCTGAGCACCTGTGGGTGCTGG - Intronic
1135325077 16:21520760-21520782 GGCTGCGGGCCAGTGGGTGAAGG - Intergenic
1136336560 16:29614028-29614050 GGCTGCGGGCCAGTGGGTGAAGG - Intergenic
1136349363 16:29696983-29697005 GGCTGCCCAGCAGGCGGTGCGGG + Exonic
1136399828 16:30011215-30011237 GTGTGCACACGAGTGTGTGCCGG - Intronic
1136736861 16:32474330-32474352 GGTTTGACACCAGTGGGAGCCGG + Intergenic
1136771195 16:32842689-32842711 GAGTGCCCAACAGTGGGTGCAGG - Intergenic
1136899381 16:34018793-34018815 GAGTGCCCAACAGTGGGTGCAGG + Intergenic
1137273235 16:46916767-46916789 GGCTGCAGAACAATGGGGGCTGG - Intronic
1138692932 16:58785850-58785872 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1138973079 16:62170325-62170347 GGATGCACACCTGTCTGTGCTGG - Intergenic
1139691361 16:68644029-68644051 TGCTGCACACAAGTGGGCTCTGG - Intronic
1140926174 16:79586204-79586226 GGCTGCCAACCAGTGGGTTATGG - Intronic
1142037286 16:87869812-87869834 GGCTGCGGGCCAGTGGGTGAAGG - Intergenic
1142058151 16:88013504-88013526 GGCTGAGCTCTAGTGGGTGCGGG - Intronic
1203016208 16_KI270728v1_random:355247-355269 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1203034543 16_KI270728v1_random:628405-628427 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1203073618 16_KI270728v1_random:1104802-1104824 GAGTGCCCAACAGTGGGTGCAGG - Intergenic
1144673872 17:17148636-17148658 GGCTGCATACTAGAGTGTGCAGG + Intronic
1147966702 17:44198129-44198151 GGCTGCACACACGGGGGTGGGGG + Intronic
1151343448 17:73486692-73486714 GACTGCACTCCACTGGGTACAGG - Intronic
1151464813 17:74277648-74277670 GGCACCAGACCAGTGGGTCCTGG - Intronic
1152249504 17:79204257-79204279 GGATACACACCAGTGGACGCCGG + Intronic
1152249521 17:79204313-79204335 GGGTACACACCAGCGGGTGCCGG + Intronic
1152352461 17:79791326-79791348 GACTTCACAGCAGTGGGGGCGGG - Intergenic
1152437759 17:80286635-80286657 GGCTGCACCTCAGTGTGTGCAGG + Intronic
1152563728 17:81091045-81091067 GGGTCCACACAAGTGGGGGCGGG - Intronic
1154060820 18:11058144-11058166 GGCTGCAGAACAGTGGATACTGG - Intronic
1155537599 18:26833070-26833092 GGAAGCACACTGGTGGGTGCAGG + Intergenic
1155762596 18:29586412-29586434 GGCTGCACAGCAGGTGGTGAAGG + Intergenic
1157305509 18:46514259-46514281 GGGTGCCCAGCAGTGAGTGCAGG + Intronic
1157367936 18:47083536-47083558 GGCTGCACACCTGTCACTGCTGG - Intronic
1160303396 18:77706741-77706763 AGGTGCAGGCCAGTGGGTGCAGG - Intergenic
1160404756 18:78637918-78637940 GTCTGCACTGCGGTGGGTGCGGG - Intergenic
1160552864 18:79706171-79706193 GGCTGCAGGTCAGTGGGCGCCGG - Intronic
1160894570 19:1396520-1396542 GGCTGCACACATGTGGATGCAGG + Intergenic
1161590240 19:5126225-5126247 GGCTGCTTCCCAGTGGCTGCTGG + Intronic
1161912704 19:7206414-7206436 GGCTGCACAGCAGTGGACGAGGG + Intronic
1162379341 19:10322607-10322629 GGCTGTAGAGCAGTGGGTGAGGG + Intronic
1163111910 19:15166449-15166471 AGCTCCTAACCAGTGGGTGCAGG - Intronic
1163721041 19:18898445-18898467 GGCTGCCAACGGGTGGGTGCAGG + Intergenic
1163974948 19:20841831-20841853 GGCTGCACAACAGTGGATATTGG - Intronic
1164576044 19:29405785-29405807 CGCGCCACACCAGAGGGTGCAGG + Intergenic
1165745741 19:38228882-38228904 GGCTGCCCAGGAGGGGGTGCCGG - Intronic
1166012551 19:39953371-39953393 GGCTGCACCCCAAAGGGAGCAGG + Intergenic
1166828005 19:45621364-45621386 GGATGCACACGGGTGGGTGTGGG + Intronic
1167725505 19:51210409-51210431 GGCTTCACAGCTGTGGATGCTGG - Intergenic
926274798 2:11395672-11395694 GGTTGCACACCAGTGTGAGCCGG + Intergenic
926856451 2:17261587-17261609 GGCTGCTGACCTGAGGGTGCGGG - Intergenic
927516909 2:23677184-23677206 GGCTGCACACCAGTGGGTGCGGG - Intronic
928818201 2:35325055-35325077 GGCTGCAGAACAGTGGATACTGG + Intergenic
931172347 2:59816584-59816606 TGCTTCTCACCAGTGGCTGCTGG + Intergenic
932085098 2:68750775-68750797 GGCTGCACAGAAGAGGGTGGAGG + Intronic
932497600 2:72154119-72154141 GGCTGCAGAGGAGTGGGTGAGGG - Intergenic
933970598 2:87466956-87466978 GACTGCACACCAGAGGTTCCTGG + Intergenic
936323131 2:111483226-111483248 GACTGCACACCAGAGGTTCCTGG - Intergenic
936762586 2:115804731-115804753 GGCTGCAGAACAGTGGATACTGG + Intronic
940918482 2:159283728-159283750 GGCTGCACAGCAGGAGGTGAGGG - Intronic
944600662 2:201300072-201300094 GGGTGCAGGACAGTGGGTGCAGG + Intronic
946451454 2:219783586-219783608 GGCTGCAGACCTGTGGGGCCTGG + Intergenic
948769493 2:240242863-240242885 GGCTGCAAAACAGTGGATGAAGG + Intergenic
949050344 2:241894553-241894575 GGCTGCTGACCAGTGGTTGGTGG + Intronic
1169946682 20:10996514-10996536 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
1171392331 20:24809534-24809556 GGCTCCACAGCAGTAGGTGCTGG + Intergenic
1171869095 20:30511875-30511897 GGCAGCCCACCAGCGGGGGCGGG + Intergenic
1172061102 20:32188147-32188169 GGCTGCCAAGCTGTGGGTGCTGG - Intergenic
1173985812 20:47260412-47260434 GGCTGCATCCCAGTGAGTGAGGG - Intronic
1175198334 20:57261673-57261695 GGCTGCTCACCAGTGAGGGCCGG + Intronic
1176310129 21:5145050-5145072 GGCTGGACTCCAGTGGGAGGAGG - Intronic
1177116268 21:17090648-17090670 GGGTGCAGGTCAGTGGGTGCAGG + Intergenic
1179846927 21:44116986-44117008 GGCTGGACTCCAGTGGGAGGAGG + Intronic
1181032190 22:20153992-20154014 GGCAGGACAGCAGTGGGAGCTGG - Intergenic
1181366427 22:22380528-22380550 GGCTGGACACCAGGGGACGCTGG + Intergenic
1181554849 22:23663111-23663133 GGGTGCAGGACAGTGGGTGCAGG + Intergenic
1181938641 22:26457685-26457707 GACTGCACAACAGTGGATGATGG + Intronic
1183517117 22:38272994-38273016 GGCTGCACTCCACTGGGCCCGGG - Exonic
1184212393 22:43043695-43043717 GTCTCCACACCAGGGGCTGCAGG - Intronic
1184518717 22:44979479-44979501 GGCTGCCCTCCAGGGGCTGCAGG - Intronic
949821053 3:8115770-8115792 GTCTGCCTTCCAGTGGGTGCAGG - Intergenic
950566833 3:13774379-13774401 GGCTGACCACCAGTGGGTGTGGG + Intergenic
950645954 3:14376935-14376957 GGCTTCACAACAGTGGGAGGGGG - Intergenic
950969235 3:17170039-17170061 GGCTGCACAGCAGGAGGTGAGGG - Intronic
951829645 3:26911771-26911793 GGCTGCACACATCTGTGTGCAGG - Intergenic
953660964 3:44891214-44891236 GGCTTCTCTCCAGAGGGTGCTGG + Intronic
954285496 3:49616276-49616298 GGCTGTAGAGCAGTGGGTGCTGG - Intronic
955182365 3:56683599-56683621 GGCTTCAGAGCAGTGGATGCGGG + Intergenic
955864584 3:63369676-63369698 GCCTTCACACCAGTGGGTAGTGG - Intronic
956943947 3:74197607-74197629 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
957040392 3:75331661-75331683 TGCTGCTCACCATTGGGTGCTGG + Intergenic
960584755 3:119310474-119310496 GGCTGCACAGCAGGAGGTGAGGG + Intronic
960675035 3:120185341-120185363 GGAAGCACAGAAGTGGGTGCTGG + Exonic
961045182 3:123703240-123703262 CGCTGCTCACCCTTGGGTGCTGG + Intronic
961435930 3:126916651-126916673 AGCTGACCACCAGTGGGGGCAGG - Intronic
961547977 3:127649216-127649238 GGCTGCAGAGCTGTGTGTGCTGG - Intronic
961999788 3:131284093-131284115 GGCTCCACTCCAGTGGCTCCTGG - Intronic
964578177 3:158198656-158198678 GGGTGCACGACAGTGGGTGAAGG - Intronic
965271142 3:166618264-166618286 GGCTGCAGAACAGTGGATACTGG - Intergenic
966745895 3:183276845-183276867 GACTGCACATCCGTGGGTGCAGG - Intronic
968649078 4:1753345-1753367 GTCTCCACAGGAGTGGGTGCGGG - Intergenic
970204866 4:13645599-13645621 GGCTGGACAGCGGTGGGTGAGGG + Intergenic
970416288 4:15860967-15860989 GGCTGTGCACGTGTGGGTGCAGG + Intergenic
980090340 4:128436802-128436824 GGCTGCAGAACAGTGGATGTTGG + Intergenic
980139344 4:128896365-128896387 GGCTGCAGAACAGTGGATGTTGG - Intronic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
981286311 4:143023311-143023333 GGATGCAGAGCAGTGGTTGCTGG - Intergenic
981839418 4:149093886-149093908 GGCTGCAGAACAGTGGGTATTGG + Intergenic
982328057 4:154149878-154149900 GGCTGCACAACAGTGGATATTGG + Intergenic
982484412 4:155950631-155950653 GGCTGCACAGCAGGTGGTGAGGG + Intronic
983088331 4:163473920-163473942 CGGTGCACATCAGAGGGTGCAGG - Intergenic
983295051 4:165856758-165856780 GGCTGCACAGCAGGAGGTGAGGG - Intergenic
984360249 4:178720864-178720886 GGATGTACACCGGTGGGGGCAGG - Intergenic
985070045 4:186158668-186158690 GGCTGAGCAGCAGTGCGTGCAGG - Intronic
985558940 5:571981-572003 TGCTGCACACCCCTGTGTGCAGG - Intergenic
985721868 5:1493701-1493723 GGCTGCGCACAGGTGGGTGAGGG + Intronic
986319404 5:6615743-6615765 GACTTCACACACGTGGGTGCAGG + Intronic
987340915 5:16937847-16937869 ATCTGAACACCAGTGGTTGCAGG - Intergenic
988323995 5:29738101-29738123 GGCGGGATACCAGTGGGAGCAGG - Intergenic
988553320 5:32216242-32216264 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
989407648 5:41079272-41079294 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
993658750 5:90603890-90603912 GCCTGCACACACGTGTGTGCAGG + Intronic
993658751 5:90603891-90603913 GCCTGCACACACGTGTGTGCAGG - Intronic
994096701 5:95853730-95853752 GGCTCCATTCCAGTGGGTGGGGG - Intronic
995861416 5:116644718-116644740 GGACTCACACCAGTGAGTGCTGG - Intergenic
997212403 5:132085190-132085212 GGCTGCACTCCACAGTGTGCTGG - Intergenic
997264279 5:132486046-132486068 GGCTGCAGTACAGTGGGGGCTGG - Intronic
1000037769 5:157461733-157461755 GGATGTGCCCCAGTGGGTGCTGG + Intronic
1000775367 5:165413377-165413399 GGCTGCAGAACAGTGGATACTGG - Intergenic
1001294512 5:170489532-170489554 GGGTGCACACCAGTGGGAGGAGG - Intronic
1001971252 5:175956621-175956643 GACTGCACAGCAGCGGGTGAAGG - Intronic
1002246190 5:177887156-177887178 GACTGCACAGCAGCGGGTGAAGG + Intergenic
1002913592 6:1510444-1510466 AGCTTCACACCAGTGGGGGAGGG - Intergenic
1006942494 6:37762339-37762361 GGGTGCACCCGCGTGGGTGCAGG - Intergenic
1007250199 6:40490085-40490107 TGCTGCAGAGCAGTAGGTGCTGG - Intronic
1007336561 6:41158958-41158980 GGCTGCAGCCCAGAGGGCGCTGG + Exonic
1007381750 6:41494813-41494835 GGCTGCACTCCAGAGGCTCCCGG + Intergenic
1008566731 6:52776525-52776547 GGCTGCAGAACAGTGGATGTTGG + Intergenic
1010905736 6:81485961-81485983 AGTTACACACCAGTTGGTGCTGG - Intergenic
1010989968 6:82469640-82469662 GGGTGCAGGACAGTGGGTGCAGG + Intergenic
1011704273 6:89985445-89985467 GGCAGCAGTCCAGTGGGGGCGGG + Intronic
1012338441 6:98089049-98089071 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1014841430 6:126224852-126224874 GGCTGCAGGCAAGTGCGTGCTGG + Intergenic
1015261313 6:131240899-131240921 GGGTGCAGGACAGTGGGTGCAGG - Intronic
1015261316 6:131240913-131240935 GGGTGCAGGACAGTGGGTGCAGG - Intronic
1016844891 6:148560240-148560262 CGCTGCACCCCAGCAGGTGCAGG - Intergenic
1017116954 6:150986679-150986701 GGCTGCAGACCAGGGGGTTAGGG + Intronic
1018789937 6:167140615-167140637 GGCTGTGCACGGGTGGGTGCTGG - Intergenic
1019268778 7:134262-134284 AGCTCTACCCCAGTGGGTGCAGG - Intergenic
1019274234 7:167390-167412 GGCTCCTCCCCAGTGGGAGCTGG + Intergenic
1019866135 7:3712128-3712150 GGCTGCACAGCAGGAGGCGCAGG + Intronic
1021143176 7:17053077-17053099 GGGTGCAGGACAGTGGGTGCAGG + Intergenic
1021753402 7:23827894-23827916 GGCTGCAGAACAGTGGATACTGG + Intronic
1023110220 7:36802694-36802716 GGCTGGTCCCCAGTGGGTGGTGG + Intergenic
1023585514 7:41725763-41725785 GGCTGCCCAACTGTGGTTGCAGG + Intergenic
1024326988 7:48116502-48116524 GGCTGGTCACCAGTGGATGTAGG + Intergenic
1024494713 7:50032034-50032056 GGGTGCACTTCAGTGTGTGCAGG - Intronic
1024558751 7:50626494-50626516 TGCTGCACACCTGTGGGCGGGGG - Intronic
1024986941 7:55202372-55202394 GTCTGCACCCTGGTGGGTGCTGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026793379 7:73349792-73349814 TGCTGAACACGTGTGGGTGCTGG - Intronic
1027827210 7:83131297-83131319 GGCTGCACCCCAGGGCCTGCAGG + Intronic
1033606701 7:142932965-142932987 GGATGCACTCCTGTGGGTGGTGG - Intronic
1034028887 7:147738010-147738032 GGGTGCAGGACAGTGGGTGCAGG - Intronic
1035530773 8:349541-349563 GGACCCAGACCAGTGGGTGCTGG + Intergenic
1036663112 8:10721097-10721119 GGCTACACTCCAGCAGGTGCAGG + Intergenic
1036792531 8:11730937-11730959 GGCTGCACCTCAGTGGGCACTGG - Intronic
1037822638 8:22142317-22142339 GGTCTCACACCAGTGGGTCCAGG + Intergenic
1037826330 8:22162745-22162767 GGATGCACAGCAGTGGGCACAGG + Intronic
1040629966 8:49198928-49198950 GGTTTCACACCAGTGTGTGCTGG + Intergenic
1041148574 8:54907311-54907333 GCCTGCAGTCCAGTGTGTGCGGG + Intergenic
1045334014 8:101182144-101182166 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1048299456 8:133240578-133240600 TTCTGCACACCACGGGGTGCTGG - Intronic
1049003723 8:139841832-139841854 GGCTGCTCCCCAGTGGGTGGTGG - Intronic
1049574410 8:143383749-143383771 GGCTGCCCCCTAGTGGCTGCAGG - Exonic
1057186254 9:93058912-93058934 GGCCGCACAGCCGTGGGTGGGGG + Intronic
1061955948 9:133961436-133961458 GGCTGCAGACCAGAGGGCCCTGG + Intronic
1062051034 9:134447186-134447208 AGCTGCACCCCAGTGAGTGCCGG - Intergenic
1062541478 9:137043547-137043569 GGCTGCACACTTGTCAGTGCCGG - Intronic
1187801434 X:23067816-23067838 GTCTGCACACACGTGTGTGCTGG - Intergenic
1189866705 X:45337848-45337870 GGCAGCATACCAGTGGGTATTGG - Intergenic
1190921775 X:54859945-54859967 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1191049600 X:56177402-56177424 GGCTGCAGAACAGTGGATACTGG + Intergenic
1191065200 X:56340943-56340965 GGCTGCAGAACAGTGGATACTGG + Intergenic
1191180582 X:57559052-57559074 GGCTGCAGAACAGTGGGTATTGG + Intergenic
1192222147 X:69204513-69204535 GTAGGCACATCAGTGGGTGCAGG + Intergenic
1192631127 X:72778458-72778480 GGCCCCACAGCAGTGGGTGCTGG + Intronic
1192650582 X:72942343-72942365 GGCCCCACAGCAGTGGGTGCTGG - Intronic
1192912261 X:75617227-75617249 GGCTGCAGAACAGTGGATGTTGG - Intergenic
1193555131 X:82944803-82944825 AGCTCCACACAAGTAGGTGCTGG - Intergenic
1194944548 X:100051605-100051627 GGCTGCAGAACAGTGGATACTGG - Intergenic
1195003416 X:100664343-100664365 GGCTGTACATGTGTGGGTGCTGG - Intronic
1195630165 X:107047510-107047532 TGCTGCACACCTGTGGGAGGCGG - Intergenic
1197177376 X:123500329-123500351 GGCTGCAAGCAAGTGTGTGCTGG + Intergenic
1199086180 X:143633584-143633606 CGCTGCACTCCGGTGGATGCAGG - Intronic
1199486426 X:148352892-148352914 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1200135115 X:153871046-153871068 GGATGAACAGCAGTGGGTGCCGG - Exonic
1200212495 X:154352969-154352991 GGCTGCCCACCAGCTGGGGCGGG - Intronic
1201494208 Y:14575889-14575911 GGCTGCACAACAGTGGATATTGG + Intronic
1201522177 Y:14887830-14887852 GGCTGCAGAACAGTGGGTATTGG + Intergenic
1202344431 Y:23906363-23906385 GGGTGCAGGACAGTGGGTGCAGG - Intergenic
1202526337 Y:25763720-25763742 GGGTGCAGGACAGTGGGTGCAGG + Intergenic